A Lamina-Associated Domain Border Governs Nuclear Lamina Interactions, Transcription, and Recombination of the Tcrb Locus

A Lamina-Associated Domain Border Governs Nuclear Lamina Interactions, Transcription, and Recombination of the Tcrb Locus

Article A Lamina-Associated Domain Border Governs Nuclear Lamina Interactions, Transcription, and Recombination of the Tcrb Locus Graphical Abstract ...

4MB Sizes 0 Downloads 6 Views

Article

A Lamina-Associated Domain Border Governs Nuclear Lamina Interactions, Transcription, and Recombination of the Tcrb Locus Graphical Abstract

Authors

Wild-type Tcrb locus x

x

x

x Nuclear lamina (NL)

Lamina-associated domain (LAD) border

Shiwei Chen, Teresa Romeo Luperchio, Xianrong Wong, ..., Kingshuk Roy Choudhury, Karen L. Reddy, Michael S. Krangel

Correspondence

Low transcription and recombination Enhancer

[email protected]

In Brief LAD border-deleted Tcrb locus

x

x New LAD border

Loss of NL association Increased transcription Increased recombination

Highlights d

A lamina-associated domain (LAD) border controls Tcrb nuclear lamina (NL) association

d

The LAD border consists of CTCF-binding elements and an active promoter

d

Deletion of the LAD border causes regional loss of NL association

d

Disrupted NL association results in increased transcription and VDJ recombination

Chen et al., 2018, Cell Reports 25, 1729–1740 November 13, 2018 ª 2018 The Author(s). https://doi.org/10.1016/j.celrep.2018.10.052

Chen et al. identify a Tcrb locus laminaassociated domain border that constrains the activity of the Tcrb enhancer. Deletion of the border causes enhancer-dependent loss of nuclear lamina association, spreading of H3K27 acetylation, and elevated transcription and VDJ recombination of gene segments in affected chromatin.

Cell Reports

Article A Lamina-Associated Domain Border Governs Nuclear Lamina Interactions, Transcription, and Recombination of the Tcrb Locus Shiwei Chen,1 Teresa Romeo Luperchio,2 Xianrong Wong,2 Europe B. Doan,1 Aaron T. Byrd,1 Kingshuk Roy Choudhury,3 Karen L. Reddy,2 and Michael S. Krangel1,4,* 1Department

of Immunology, Duke University Medical Center, Durham, NC 27710, USA of Biological Chemistry, Center for Epigenetics, Johns Hopkins University, Baltimore, MD 21205, USA 3Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC 27710, USA 4Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2018.10.052 2Department

SUMMARY

Tcrb locus V(D)J recombination is regulated by positioning at the nuclear periphery. Here, we used DamID to profile Tcrb locus interactions with the nuclear lamina at high resolution. We identified a lamina-associated domain (LAD) border composed of several CTCF-binding elements that segregates active non-LAD from inactive LAD regions of the locus. Deletion of the LAD border causes an enhancer-dependent spread of histone H3 lysine 27 acetylation from the active recombination center into recombination center-proximal LAD chromatin. This is associated with a disruption to nuclear lamina association, increased chromatin looping to the recombination center, and increased transcription and recombination of recombination center-proximal gene segments. Our results show that a LAD and LAD border are critical components of Tcrb locus gene regulation and suggest that LAD borders may generally function to constrain the activity of nearby enhancers. INTRODUCTION The association of chromatin with the nuclear periphery plays an essential role in gene regulation. The nuclear periphery consists of the inner nuclear membrane, nuclear membrane proteins, and the nuclear lamina (NL), a filamentous network of A-, C-, and B-type lamin proteins (Dobrzynska et al., 2016). Regions of chromatin in molecular contact with the NL, termed lamina-associated domains (LADs), have been defined by DamID, a profiling technology that utilizes adenine methylation of DNA to label chromatin localized to the NL (Guelen et al., 2008; van Steensel and Henikoff, 2000). The mapping of LADs in human and mouse cell lines by DamID has shown that approximately one-third of the genome is organized into LADs, which typically span 0.1– 10 Mb in size (Guelen et al., 2008). LADs and non-LADs are not static subnuclear compartments but can interconvert upon cell differentiation or activation (Peric-Hupkes et al., 2010; Robson

et al., 2017). DNA sequence composition (Bian et al., 2013; Meuleman et al., 2013; Zullo et al., 2012), histone modifications (Bian et al., 2013; Towbin et al., 2012), and transcription factors (Harr et al., 2015; Zullo et al., 2012) have all been implicated as molecular regulators of LAD formation. The nuclear periphery is generally considered to be transcriptionally repressive (van Steensel and Belmont, 2017). LADs have a lower gene density than non-LADs, and genes within LADs are either transcriptionally inactive or expressed at lower levels than non-LAD genes (Guelen et al., 2008; Peric-Hupkes et al., 2010). Transcriptional suppression at the NL is mediated directly, by repressors like heterochromatin protein 1 (HP1) and histone deacetylase 3 (HDAC3), which interact with the NL or NL-associated proteins (Poleshko et al., 2017; Polioudaki et al., 2001; Somech et al., 2005; Zullo et al., 2012), and indirectly, by the exclusion of transcription factors and transcriptional machinery from the nuclear periphery (Yao et al., 2011). The adaptive arm of the mammalian immune system is composed of T and B lymphocytes that recognize antigens using diverse arrays of T and B cell receptors, respectively, with each lymphocyte bearing a receptor of unique specificity. Complete antigen receptor genes are not encoded in the germline but are instead generated by a process of somatic recombination termed V(D)J recombination (Schatz and Ji, 2011). V(D)J recombination mediates the assembly of variable (V), diversity (D), and joining (J) gene segments at antigen receptor loci and depends on the activity of recombination activating gene 1 and 2 proteins (hereafter referred to as RAG) and DNA repair proteins. Antigen receptor gene assembly is regulated by multiple mechanisms. V(D)J recombination is limited to developing lymphocytes by tight control of RAG gene expression. In addition, antigen receptor gene segments are selectively made available for recombination by regulated transcription from nearby promoter elements (Abarrategui and Krangel, 2006, 2007; Yancopoulos and Alt, 1985). This transcription removes repressive histone modifications in favor of activating histone modifications and promotes chromatin remodeling needed for RAG binding (Bevington and Boyes, 2013; Gopalakrishnan et al., 2013; Ji et al., 2010; Maman et al., 2016). High-level RAG binding is directed to D and J segments to form the recombination center (RC) (Schatz and Ji, 2011). Because antigen receptor loci can span megabases along the linear genome, large-scale changes

Cell Reports 25, 1729–1740, November 13, 2018 ª 2018 The Author(s). 1729 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

in chromatin conformation and looping are required to bring distal V gene segments into spatial proximity of the RC for recombination (Bossen et al., 2012). These changes in looping and conformation are dependent on the activity of architectural proteins like CTCF (Chen et al., 2015; Guo et al., 2011; Shih et al., 2012) and transcription factors like Pax5 (Ebert et al., 2011) and YY1 (Medvedovic et al., 2013). V(D)J recombination is also regulated by subnuclear positioning, with antigen receptor loci generally localized with the NL or repressive heterochromatin compartments during developmental stages when the loci are inactive and repositioned to the nuclear interior to set the stage for recombination (Kosak et al., 2002; Schlimgen et al., 2008). The mouse T cell receptor (TCR) b locus (Tcrb) encodes one chain of the TCRab heterodimer. This locus includes Vb, Db, Jb, and Cb gene segments along with multiple trypsinogen genes that are inactive in the T cell lineage. These trypsinogen genes are organized into two discrete chromatin regions of 150 and 250 kb that flank the major cluster of 21 functional Vb gene segments and segregate the Vb gene segments from the Db-Jb RC. The RC also contains the only known Tcrb locus enhancer, Eb. Tcrb recombination is a two-step process that takes place in the CD4CD8 double-negative (DN) stage of thymocyte development, with Db-to-Jb recombination followed by Vb-to-DJb recombination. Vb-to-DJb recombination is tightly regulated to ensure that only one of the two Tcrb alleles in a cell undergoes functional recombination, a process known as allelic exclusion (Brady et al., 2010). The Tcrb locus is unique among antigen receptor loci in that it localizes to the nuclear periphery during the developmental stage (DN) in which it undergoes recombination. Prior work showed that Tcrb alleles associate frequently and stochastically with the NL in DN thymocytes and that high-frequency association persists during the subsequent CD4+CD8+ double-positive (DP) stage of development, when Tcrb recombination has concluded (Schlimgen et al., 2008). Analysis of DN thymocytes revealed that Vb-to-DJb recombination of NL-localized Tcrb alleles was suppressed compared to alleles localized to the nuclear interior, and this suppression was hypothesized to contribute to Tcrb allelic exclusion (Chan et al., 2013). Suppression may be mediated, in part, by sequestration of Tcrb alleles from RAG proteins. Here, we defined the organization of the Tcrb locus at the NL and identified a LAD border that separates the Vb gene segments and trypsinogen genes from the RC. Deletion of the LAD border disrupts NL association of 300 kb of Tcrb locus chromatin. This disruption is accompanied by changes in histone modification, long-distance chromatin contacts, transcription, and recombination, that primarily affect RC-proximal genes. Therefore, we demonstrate that the LAD border is a core regulatory element of the Tcrb locus. RESULTS Tcrb Locus Organization at the NL To obtain a high-resolution map of Tcrb-NL interactions, we conducted DamID. To do so, we transduced the mouse DP thymocyte cell line VL3-3M2 (Groves et al., 1995) with con-

1730 Cell Reports 25, 1729–1740, November 13, 2018

structs encoding either a Dam-Lamin B1 fusion protein or unfused Dam and assayed adenine methylation of cellular DNA. VL3-3M2 cells bear an in-frame VDJb rearrangement on one Tcrb allele and a DJb rearrangement on the second allele (Figures 1A and 1B). Because the VDJb-rearranged allele joins Trbv3 to Trbd1 by deletional recombination, the 500-kb region between these gene segments is represented in a monoallelic fashion on the DJb-rearranged allele. Thus, the DJb-rearranged allele (hereafter referred to as the experimental allele) can serve as a valuable substrate for analysis and manipulation. Moreover, because VL3-3M2 cells express RAG proteins and support V(D)J recombination on extrachromosomal substrates (Williams et al., 2001), these cells offer a potentially valuable experimental system to test the relationship between NL association and Vb-to-DJb recombination at the endogenous Tcrb locus. High-throughput sequencing coupled with DamID (DamIDseq) was used to generate a high-resolution map of Tcrb-NL interactions. We observed that, compared to the unfused Dam control, Dam-Lamin B1 signals were generally enriched throughout the Tcrb locus and were highest at the RC-proximal and RC-distal trypsinogen regions, consistent with these regions constituting LADs (wild-type, Figure 1C). The cluster of Vb gene segments that lies between the trypsinogen regions exhibited a mixed character, wherein RC-proximal Vb gene segments were associated with the NL and RC-distal ones were generally free of the NL. In contrast, a well-defined border between the RC and the RC-proximal trypsinogen region segregated the RC into a non-LAD (Figure 1C). The LAD Border Upstream of the RC Insulates Tcrb Chromatin from the Influence of Eb We assessed the mechanisms enforcing segregation of the Tcrb locus into LAD and non-LAD chromatin regions by characterizing the sharp LAD border immediately upstream of the RC. The 28-kb region spanning the LAD border contains previously characterized regulatory elements (Figure 1A; Majumder et al., 2015). The 30 end of this region, immediately adjacent to the RC, contains elements of the Trbd1 promoter PDb1, including a pair of CTCF-binding elements (CBEs), which function as an insulator that blocks the spread of activating histone modifications from the RC. The 50 end of this region, farthest from the RC, is marked by the CBE 50 PC, which functions as a tether that brings distal Vb segments into proximity of the RC. The trypsinogen gene Prss2, normally silent in T-lineage cells, is found between 50 PC and PDb1. Using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, we created a derivative VL3-3M2 cell line that deleted this 28-kb region on the experimental allele, taking care that core PDb1 promoter elements were not disrupted and that PDb1 transcription was minimally affected (Figure S1). We designated this 28-kb region ‘‘upstream of the recombination center’’ (usRC) and the VL33M2 derivative cell line bearing a deletion of this region DusRC. DamID-seq analysis of DusRC revealed that the RCproximal trypsinogen genes and two most RC-proximal Vb genes, Trbv29 and Trbv30, showed substantial reductions in NL association, whereas Vb gene segments spanning Trbv23

Figure 1. Characterization of Tcrb-NL Association in Wild-Type VL3-3M2 and DusRC (A) Scale schematic of the Tcrb locus indicating positions of Vb gene segments, trypsinogen regions, and regulatory elements. The 30 end of the locus is magnified to show elements within the recombination center (RC) and the lamina-associated domain (LAD) border upstream of the RC (usRC). Filled triangles denote the position and orientation of relevant CTCF-binding elements (CBEs). The filled circle denotes the Tcrb enhancer (Eb). Functional Vb gene segments and pseudogenes are indicated in blue and gray, respectively. (B) Tcrb alleles in the VL3-3M2 cell line. The rearranged allele bears a Trbv3-Trbd1-Trbj2.4 rearrangement while the experimental allele bears a Trbd1-Trbj2.4 rearrangement. (C) DamID-seq profiles of the Tcrb locus in wildtype and DusRC. Experimental values are expressed as the log2 ratio of Dam-Lamin B1 over unfused Dam. Reads were merged from two independent replicates. CTCF ChIP-seq data are from GEO: GSE41743 (Shih et al., 2012). CTCF ChIP-seq values are expressed as reads per million. See also Figure S1.

to Trbv26 had more modest reductions in NL association (Figure 1C). In contrast, the remainder of the locus, as well as surrounding chromatin, was largely unchanged (Figure 1C). Analysis of DamID by qPCR (DamID-qPCR) recapitulated the results of DamID-seq with respect to the alternating regions of NL association on the wild-type allele as well as a highly significant loss of NL association in the RC-proximal region in DusRC (Figures 2A and 2B). We hypothesized that the RC is positioned away from the NL due to the activity of the Tcrb enhancer, Eb, and that this activity is normally confined to the RC by the usRC LAD border. To test this, we assessed the effects of Eb deletion. In these experiments, we plotted differences in DamID-qPCR signals relative to wild-type VL3-3M2 cells. DEb exhibited an increase in NL association at the RC (as indicated by Trbj2-7) and at all Vb gene segments (Figure 2C). Minimal effects were observed on either the proximal or distal trypsinogen regions. The effects of Eb deletion on NL association were generally opposite in nature to the effects of usRC deletion. To determine the functional relationship between usRC and Eb, we created an additional line

bearing deletions in both elements (DusRC+DEb) and observed a Tcrb-NL association pattern similar to that of the DEb line (Figure 2C). Because the deletion of usRC diminishes RC-proximal chromatin-NL associations only in the presence of Eb, we conclude that usRC functions as a boundary to modulate the activity of Eb and prevent encroachment of non-LAD chromatin into the RC-proximal trypsinogen and Vb regions. However, usRC does not inhibit the impact of Eb on more distal Vb gene segments, which is likely to occur by a distinct mechanism. Multiple Elements Contribute to usRC Function To dissect the functional elements contributing to the LAD border activity of usRC, we created several VL3-3M2 lines bearing smaller deletions (Figure 2D; Table S1). We used DamID-qPCR data to calculate overall effect sizes and p values relative to wild-type for the region spanning Trbv30 to Tp4, which showed the greatest change in DusRC. Among D50 PC, DPrss2, and DPDb1, only DPDb1 displayed an effect size approaching that of DusRC. Further dissection of PDb1 into a 50 region containing both CBEs (DPDb1CBE) and a 700-bp 30 region containing a binding site for the transcription factor Sp1 (DPDb1700) (Sikes et al., 1998) revealed that both segments contribute to PDb1 activity. The greatest effect sizes were obtained by the combined deletion of 50 PC with either PDb1 (D50 PC+DPDb1) or PDb1CBE (D50 PC+DPDb1CBE). We therefore conclude that the three elements 50 PC, PDb1CBE, and PDb1700 function cooperatively to enforce a boundary that prevents

Cell Reports 25, 1729–1740, November 13, 2018 1731

Figure 2. Dissection of usRC LAD Border Function (A) Scale schematic of the Tcrb locus indicating sites analyzed by qPCR. Td and Tp refer to sites within the RC-distal and RC-proximal trypsinogen regions, respectively. (B) DamID-qPCR profiles of the Tcrb locus (left) and non-Tcrb control loci (right). Control loci were chosen from regions that showed consistently high or low signals in DamID-seq. The data represent the mean and SE of 16 (wildtype) or 6 (DusRC) independent experiments. **p < 0.01 and ****p < 0.0001, by two-way ANOVA with Holm-Sidak’s multiple-comparisons test. (C) DamID-qPCR difference maps relative to wildtype VL3-3M2. The graph shows the difference in DamID-qPCR signals from wild-type at each site analyzed. Data for wild-type and DusRC were transformed from Figure 2B. (D) Effects of Tcrb locus deletions on NL association of the RC-proximal region. Clonal derivative VL3-3M2 cell lines bearing the indicated deletions were analyzed by DamID-qPCR. Overall effect sizes and p values were calculated for six RC-proximal sites spanning Trbv30 to Tp4, using a restricted maximum-likelihood model, which accounted for DamID signal, genotype, and batch effects. Positive effect sizes indicate greater NL association; negative effect sizes indicate reduced NL association. Data for wild-type, DusRC, DEb and DusRC+DEb were from the same dataset that was used to generate Figure 2C. See also Figure S1 and Table S1.

Eb-mediated positioning of the RC-proximal region of the Tcrb locus into the nuclear interior.

We also analyzed transcription in the VL3-3M2 lines bearing smaller deletions within usRC. Among the lines bearing deletions of individual elements, transcriptional upregulation was restricted to Try5 and only observed in DPDb1 (Figure 3C). Among the lines with compound deletions, D5 0 PC+DPD b 1 CBE largely mirrored 0 DPDb1, whereas D5 PC+DPDb1 had a transcriptional profile very similar to DusRC (Figure 3D).

usRC Suppresses RC-Proximal Transcription We asked whether the boundary function of usRC influenced transcriptional activation across the Tcrb locus. The two most proximal Vb gene segments (Trbv29 and Trbv30) and two genes in the proximal trypsinogen region (Try5 and Prss1) showed substantial transcriptional upregulation in DusRC compared to wildtype (Figures 3A and 3B). However, there was no transcriptional upregulation of the RC-distal Vb gene segments Trbv3, Trbv5, and Trbv13-2 on the experimental allele. Notably, all detected transcription was dependent on Eb, as transcription was completely abrogated in DEb and DusRC+DEb (Figure 3B). Thus, similar to NL association, usRC blocks the effects of Eb on RC-proximal promoters but fails to block more distal effects.

usRC Suppresses RC-Proximal V(D)J Recombination Since VL3-3M2 cells express RAG and can support V(D)J recombination (Williams et al., 2001), we asked whether deletion of usRC impacted Tcrb recombination. As an initial assessment, we analyzed recombination in genomic DNA (gDNA) from wildtype, DusRC, DPDb1, and D50 PC+DPDb1 by qPCR. Relative to wild-type, we detected 15- to 150-fold increases in Trbv29 and Trbv30 rearrangement on the experimental allele in DusRC and D50 PC+DPDb1 (Figure 4A). However, the detection and quantification of rearrangement events was challenging due to the low rate of recombination of the experimental allele in wild-type VL3-3M2 cells and non-standardized culture periods during which recombination events would have accumulated.

1732 Cell Reports 25, 1729–1740, November 13, 2018

Figure 3. usRC Protects RC-Proximal Genes from Eb-Dependent Transcriptional Activation (A) Scale schematic of the Tcrb locus indicating gene segments assayed. (B–D) Transcription of Vb gene segments and RCproximal trypsinogen genes were analyzed by RTqPCR. (B) Effects of usRC and Eb. (C) Dissection of usRC. (D) Effects of compound usRC deletions. Vb primers only detect transcripts originating from unrearranged gene segments on the experimental allele. Expression values are normalized to Actb, with Actb expression set to 4 on a log10 scale. The data represent the mean and SE of two to eight independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, by two-way ANOVA with Holm-Sidak’s multiple-comparisons test. Number sign, not detectable. The same data for wild-type and DusRC were plotted in all three panels.

To circumvent the abovementioned problems, we devised a controlled system in which cells with an initial DJb rearrangement on the experimental allele were cultured for a defined time period prior to assaying Vb-to-DJb recombination (Figure 4B). VL3-3M2 cells have one functional Tcrb and one functional Tcra rearrangement and express surface ab TCRs detectable by a pan-TCRb monoclonal antibody (mAb). We used the CRISPR/Cas9 system to disrupt the coding sequence on the rearranged Tcrb allele in order to generate surface TCRb derivatives of the VL3-3M2 lines. This allowed us to reliably detect cells with newly generated in-frame recombination events on the experimental allele by staining for the appearance of TCRb+ cells. After expanding single-cell sorted TCRb cells for 21 days in culture, we assayed the rate of recombination in wild-type VL3-3M2, DusRC, DPDb1, and D50 PC+DPDb1 by flow-cytometric analysis. DusRC and D50 PC+DPDb1 displayed 2.5- to 3-fold increases in Tcrb recombination frequency compared to wild-type (Figure 4C). To analyze the Tcrb repertoire in greater detail, we sorted TCRb+ cells that arose in these cultures and analyzed Vb usage by flow cytometry using Vb-specific mAbs. We observed a modest increase in the usage of Vb7 (encoded by the RC-proximal Trbv29 gene segment) in DPDb1 and dramatic increases in usage in DusRC and D50 PC+DPDb1 (Figure 4D). We could not

assay recombination of the RC-proximal Trbv30 gene segment in this manner because a mAb that recognizes its protein product is not available. To analyze Tcrb repertoires in a more comprehensive fashion, we quantified Vb usage in TCRb+ wild-type and DusRC cultures by high-throughput sequencing. Unique rearrangements to the DJb gene segment on the experimental allele exhibited a very strong bias toward the usage of Trbv29 and, to a lesser extent, Trbv30, in DusRC compared to wild-type (Figure 4E). Because the number of unique sequences represented a substantial proportion of the number of TCRb+ cells seeded, the RC-proximal bias in Vb usage reflected multiple unique recombination events, rather than the outgrowth of a limited number of clones that had rearranged early and expanded throughout the 21-day time course. In addition to recovering recombination events that utilized the DJb gene segment on the experimental allele, we also recovered an unexpected class of recombination events that restored TCRb expression to TCRb VL3-3M2 cells. These appeared to be direct Vb-to-Jb rearrangements that used Trbv1 or Trbv2 with Trbj2-5 or Trbj2-7. Based on their limited Vb usage, these events were most likely to have occurred on the rearranged rather than the experimental allele, replacing the CRISPR/ Cas9-inactivated Trbv3-Trbd1-Trbj2-4 rearrangement by joining an upstream Vb to a downstream Jb. Direct Vb-to-Jb rearrangement is not observed in vivo, even though it is formally permissible according to the 12/23 rule (Bassing et al., 2000; Sleckman et al., 2000). To independently verify this result, we performed qPCR to detect the original rearrangement and the most heavily represented Vb-to-Jb ‘‘replacement rearrangement’’ (Trbv2Trbj2-5) in pre-sorted (mostly TCRb) and sorted TCRb+ populations. In two wild-type and three DusRC samples, the original Trbv3-Trbd1-Trbj2-4 rearrangement was abundant

Cell Reports 25, 1729–1740, November 13, 2018 1733

Figure 4. Changes in Tcrb Recombination Frequency and Repertoire upon usRC Deletion (A) Relative Tcrb rearrangement in unsynchronized populations of VL3-3M2 cell lines analyzed by qPCR of gDNA. qPCR values were initially normalized to Cd14 in each sample, and normalized values for each Vb rearrangement in VL3-3M2 mutant cell lines were expressed relative to wildtype, which was set to 1 (n = 1). (B) Timeline for the disruption of the rearranged allele in VL3-3M2 and its derivatives and analysis of the subsequent accumulation of Tcrb rearrangements in synchronized cultures. (C) Flow-cytometric analysis of Tcrb recombination in clonal cultures of TCRb cells grown for 21 days (n = 12). Horizontal lines denote the mean in each genotype. ***p < 0.001 and ****p < 0.0001, by non-parametric one-way ANOVA with Dunn’s multiple-comparisons test. (D) Flow-cytometric analysis of Vb usage in TCRb+ cells obtained from synchronized cultures of wildtype (n = 2) and mutants (n = 3) by sorting at 25 days followed by expansion in culture. Another wild-type sample in which TCRb+ cells arose predominantly from an early replacement rearrangement on the rearranged allele was excluded from analysis. Horizontal lines denote the mean in each genotype. *p < 0.05, **p < 0.01, and ****p < 0.0001, by two-way ANOVA with HolmSidak’s multiple-comparisons test. (E) Tcrb repertoire analyzed by high-throughput sequencing of gDNA isolated from TCRb+ cells analyzed in (D). Vb usage is plotted as the percentage of unique reads (n = 206 and 209 for wild-type; n = 162, 216, and 240 for DusRC) representing rearrangement events on the experimental allele. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, by two-way ANOVA with HolmSidak’s multiple-comparisons test. See also Figure S2.

both pre- and post-sort, with the replacement rearrangement detected at low levels in the post-sorted TCRb+ populations (Figure S2A). However, in the remaining wild-type sample, we observed a substantial depletion of the original rearrangement with a proportional increase in the replacement rearrangement. Consistent with this result, two-thirds of the sorted TCRb+ cells in this sample expressed surface Vb4 (encoded by Trbv2) (Figure S2B). Notably, sequence analysis of this wild-type sample identified only a single highly abundant Trbv2-Trbj2-5 sequence and only three unique rearrangements on the experimental allele. This indicated that a single replacement rearrangement had occurred early in the culture period, thus compromising the selection for functional rearrangements on the experimental allele. Hence, we excluded this highly unusual sample from the analyses in Figures 4D and 4E.

1734 Cell Reports 25, 1729–1740, November 13, 2018

usRC Limits Proximal Vb-RC Looping To better understand the basis for the effects of usRC on transcription and recombination, we analyzed the spatial organization of the Tcrb locus using chromosome conformation capture (3C). We initially used Eb as a viewpoint to test interactions between the Eb-containing HindIII fragment and other HindIII fragments in the locus. The Eb-containing HindIII fragment interacted broadly across the Tcrb locus in wild-type cells, and these interactions were diminished by an average of 60% in DEb, showing that Eb is an essential regulator of Tcrb locus conformation (Figures 5A and 5B). Compared to wild-type, DusRC and D50 PC+DPDb1 exhibited significant increases in Eb interactions with RC-proximal Trbv29 and Try5. This was accompanied by significant decreases in interactions with the RC-distal Trbv13-1 gene segment and a similar trend at several other RC-distal sites (Figure 5B). In accordance with these results, the use of Trbv29 as a viewpoint revealed increased interactions with Eb, 50 PC and the

Figure 5. Looping of the RC to RC-Proximal Chromatin Is Suppressed by usRC (A) Scale schematic of the Tcrb locus indicating positions of 3C viewpoint and test fragments analyzed. (B) 3C analysis of long-distance interactions between test HindIII fragments and the Eb-containing HindIII viewpoint fragment. Results for different ligation products were normalized to their abundance in a digested and religated BAC standard and were expressed relative to the frequency of ligation with an Eb nearest neighbor fragment. The data represent the mean and SE of five to six independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, by two-way ANOVA with Holm-Sidak’s multiple-comparisons test. (C) 3C analysis of HindIII fragments with the Trbv29 viewpoint (n = 5–6). (D) 3C analysis of BglII fragments with the Eb viewpoint (n = 4–5). (E) 3C analysis of BglII fragments with the Trbv30 viewpoint (n = 4–5).

DJb-rearrangement in the same cell lines (Figure 5C). Similar 3C experiments testing interactions among BglII fragments revealed elevated Trbv30 interactions with Eb, 50 PC, and DJb (Figures 5D and 5E). Therefore, we conclude that Eb acts as a key regulatory element that mediates the interactions of Vb gene segments with the RC and that usRC functions to balance these interactions by reducing the frequency of interactions with RC-proximal targets and increasing the frequency of interactions with RC-distal targets. usRC Prevents the Spread of H3K27ac from the RC To further explore the mechanism for usRC effects on NL association, transcription, and recombination, we analyzed histone modifications across the Tcrb locus. Histone H3 lysine 27 acetylation (H3K27ac) is enriched at actively transcribed genes and their enhancers (Creyghton et al., 2010; Tie et al., 2009). Chromatin immunoprecipitation sequencing (ChIP-seq) analysis revealed substantial enrichment of H3K27ac at the RC in wildtype VL3-3M2 cells, with small peaks of H3K27ac detected at Vb segments (Figure 6A). A large peak detected at Trbv3 most likely represents a signal from the rearranged allele. Similar analysis of DEb cells revealed complete depletion of H3K27ac across the entire Tcrb locus (Figure 6A). Thus, Eb is absolutely required for Tcrb locus transcription and deposition of

H3K27ac in VL3-3M2 cells. Notably, DusRC displayed elevated H3K27ac that extended from the RC, across the RC-proximal trypsinogen region and Vb segments Trbv29 and Trbv30, terminating at a CBE located 8.5 kb upstream of Trbv29 (Figure 6A). Hence, elevated H3K27ac was tightly correlated with portions of the locus that dissociated from the NL and displayed elevated transcription and Vb-to-DJb recombination. Histone H3 lysine 9 dimethylation (H3K9me2) is enriched at the nuclear periphery and overlaps with LADs genome-wide (Kind et al., 2013; Peric-Hupkes et al., 2010; Poleshko et al., 2017; Wen et al., 2009). Disruption of the methyltransferases that deposit H3K9me2 by knockdown or inhibition has been shown to cause genes in LADs to move away from the nuclear periphery (Bian et al., 2013; Harr et al., 2015; Kind et al., 2013; Towbin et al., 2012). Analysis of wild-type VL3-3M2 cells confirmed the correlation between H3K9me2 and DamID at the Tcrb locus (Figure 6A). Consistent with increased NL association, DEb cells showed increased H3K9me2 across the Vb array and the RC. However, despite the substantially reduced NL association of the RC-proximal region in DusRC, we detected no loss of H3K9me2 in DusRC compared to wild-type (Figure 6A). Further analysis of wild-type VL3-3M2 cells confirmed that LAD borders were demarcated by a sharp transition from H3K9me2 to H3K27ac genome-wide (Figure 6B), and that DamID and H3K9me2 signals were strongly correlated (Figure 6C). However, a fraction of the genome displayed low DamID signals despite enrichment for H3K9me2 (Figure 6C; Figure S3, red box). This observation, together with finding that usRC deletion perturbs NL association with no loss of H3K9me2, agrees with the literature indicating that H3K9me2 is necessary but not sufficient for NL association

Cell Reports 25, 1729–1740, November 13, 2018 1735

Figure 6. usRC Blocks the Spread of H3K27ac from the RC (A) ChIP-seq and DamID-seq profiles of the Tcrb locus. CTCF ChIP-seq data are from GEO: GSE41743 (Shih et al., 2012). DamID-seq data are identical to Figure 1C. CTCF and H3K27ac ChIPseq values are expressed as reads per million. H3K9me2 ChIP-seq values are expressed as the log2 ratio of bound H3K9me2 over input. Reads were merged from two independent replicates. (B) Feature profiles of LAD borders. LAD borders were identified genome-wide, and average signals across LAD borders were graphed across 100 kb centered on the LAD border. Non-LADs are oriented on the left, and LADs are oriented on the right. (C) Correlation between H3K9me2 ChIP-seq and DamID-seq in wild-type VL3-3M2. Reads were placed into 10-kb bins. Pearson correlation coefficient is indicated. See also Figures S3 and S4.

(Bian et al., 2013; Harr et al., 2015; Kind et al., 2013; Towbin et al., 2012). In this regard, some studies have revealed enrichment of H3K27 trimethylation (H3K27me3) within LADs (Guelen et al., 2008; Harr et al., 2015), although this observation is not universal (Bian et al., 2013; Kind et al., 2015). It has been hypothesized that H3K27me3 maintains the integrity of LADs near LAD borders (Harr et al., 2015). Because elevated H3K27ac should erase H3K27me3, we hypothesized that the extended region of H3K27ac in DusRC disrupts NL association in the RC-proximal portion of the locus by reducing H3K27me3. To test this hypothesis, we performed H3K27me3 ChIP-qPCR at various sites across the RC-proximal region of the Tcrb locus, including 50 PC, which was shown to be H3K27me3-enriched in mouse embryonic fibroblasts (Simon et al., 2013). However, relative to H3K27me3-enriched control loci (Ins1 and Olfr446), we detected only low levels of H3K27me3 at all sites tested across the Tcrb locus in wild-type VL3-3M2 cells (Figure S4). In addition, there were no reductions of H3K27me3 in DusRC, although we did detect a trend toward increased H3K27me3 in DEb (Figure S4). Therefore, the NL association of the Tcrb locus is likely regulated by H3K9me2 and H3K27ac but is independent of H3K27me3.

1736 Cell Reports 25, 1729–1740, November 13, 2018

Because it has not been possible to perform DamID in vivo, we assayed H3K9me2 in primary DN and DP thymocytes as a surrogate measure of NL association. Primary DN and DP thymocytes had very similar H3K9me2 profiles, with high signals in both trypsinogen regions and depletion of H3K9me2 at the RC and across large sections of the Vb array (Figure 6A). These H3K9me2 profiles are broadly similar to the H3K9me2 profile obtained in wild-type VL3-3M2, although there is a greater depletion of H3K9me2 across the Vb array in primary DN and DP thymocytes. We conclude that the organization of the Tcrb locus is likely to be similar in wild-type VL3-3M2 cells and primary DN and DP thymocytes, with the Tcrb locus anchored to the NL by the proximal and distal trypsinogen regions. This configuration suggests that Vb and RC looping from the NL facilitates transcriptional activation and recombination of Tcrb gene segments (Figure 7). DISCUSSION In this study, we described the LAD organization of the Tcrb locus and identified a LAD border, termed usRC, which segregates Vb gene segments and trypsinogen genes from the RC. In wildtype VL3-3M2 cells, the RC is positioned away from the nuclear periphery in an Eb-dependent manner, and usRC insulates upstream genes from Eb to ensure NL positioning and suppression. Deletion of usRC caused H3K27ac to spread from the RC into the RC-proximal portion of the Tcrb locus, causing proximal Vb gene segments and trypsinogen genes to dissociate from the NL and interact more frequently with the RC (Figure 7). These changes in Tcrb locus structure and localization resulted in greatly elevated transcription and recombination of the two most RC-proximal Vb gene segments and transcriptional

Figure 7. Model of usRC LAD Border Function in VL3-3M2 Tcrb locus organization at the NL is depicted for wild-type VL3-3M2 and DusRC. Dotted lines indicate looping interactions with the RC; line thicknesses represent relative frequencies of looping interactions.

activation of normally silent trypsinogen genes. Thus, our results show that a Tcrb locus LAD and LAD border are critical components of Tcrb locus gene regulation. Multiple elements contribute to LAD border function. The 28-kb usRC LAD border region contains three CBEs: 50 PC and two CBEs upstream of PDb1. Deletion of all three CBEs (D50 PC+DPDb1CBE) was required to obtain an effect on NL association similar to that of DusRC. However, transcriptional upregulation at Trbv29, Trbv30, Try5, and Prss1 in D50 PC+DPDb1CBE was 3- to 8-fold lower than in DusRC. Maximal transcriptional upregulation required the additional deletion of PDb1700 (D50 PC+DPDb1). In fact, D50 PC+DPDb1 phenocopied DusRC with regard to NL association, Tcrb locus conformation, transcription, and recombination. Because transcriptional activation did not accompany NL dissociation in all experimental genotypes, we believe that dissociation from the NL occurs prior to transcriptional activation. Tcrb locus LADs and the usRC LAD border have properties typical of LADs and LAD borders genome-wide. LAD borders are enriched for CTCF binding and active promoters oriented away from the LAD (Guelen et al., 2008). usRC has a similar organization and our functional dissection of this LAD border indicates that the CBEs and promoter elements cooperate to mediate LAD border activity. LADs have been shown to be enriched for H3K9me2 along their entire length, and this modification is thought to be essential for anchoring to the NL (Harr et al., 2015; Kind et al., 2013; Peric-Hupkes et al., 2010; Poleshko et al., 2017; Towbin et al., 2012; Wen et al., 2009). Our analysis of wildtype VL3-3M2 cells confirmed the correlation between DamID and H3K9me2 signals, both genome-wide and at the Tcrb locus. However, we were surprised that the deletion of usRC had no effect on Tcrb locus H3K9me2. Instead, we observed a propagation of H3K27ac from the RC into LAD chromatin, suggesting

that usRC protects the upstream LAD from invasion of non-LAD chromatin. Although H3K27ac spreads for hundreds of kilobases from the RC upon the deletion of usRC, it stops abruptly at a CBE located 8.5 kb upstream of Trbv29, skipping two other CBEs located more proximal to the RC. The mechanism by which H3K27ac disrupts NL association remains to be determined, as our results do not indicate a role for H3K27me3. H3K27me3 was shown to be essential for NL association at several other loci (Harr et al., 2015). A recent study described how noncoding RNA (ncRNA) transcription at the Bcl11b enhancer caused Bcl11b gene activation along with release of the surrounding 2 Mb of chromatin from the NL (Isoda et al., 2017). ncRNA transcription was shown to promote DNA demethylation, binding of CTCF and cohesin, and the formation of chromatin loops, which were hypothesized to sequester the Bcl11b locus in a transcriptionally active compartment away from the NL. By comparison, our study provides an example in which boundary deletion causes chromatin release from the NL due to the unrestrained influence of enhancer activity in neighboring chromatin. Similar to Bcl11b, dissociation of Tcrb from the NL is associated with increased enhancer looping. The spread of H3K27ac from the Tcrb RC to adjacent chromatin may link directly to the process of loop extrusion (Barrington et al., 2017; Merkenschlager and Nora, 2016), by which long-range Eb contacts may be established upon deletion of the usRC boundary. We suggest that loop extrusion, coupled with enhancer-dependent chromatin modifications, dissociates Tcrb chromatin from the NL and facilitates gene segment transcription within the dissociated region. As noted previously, we believe that increased gene segment transcription likely occurs after dissociation from the NL. Such transcription may function subsequently to reinforce and stabilize chromatin localization to the nuclear interior. We do not know whether there may be additional ncRNAs that serve critical roles in loop extrusion, chromatin modifications, and dissociation from the NL. It is intriguing that Tcrb locus transcription is completely dependent on Eb in VL3-3M2 cells, whereas in primary DN thymocytes, Eb deletion abrogates transcription within the RC but has only modest effects on the transcription of Vb gene segments (Bouvier et al., 1996; Majumder et al., 2015; Mathieu et al., 2000). Because VL3-3M2 is a DP thymocyte cell line, this result may reflect a natural transition from Eb-independent to Eb-dependent Cell Reports 25, 1729–1740, November 13, 2018 1737

transcription of Vb gene segments during thymocyte development. We note that usRC suppresses transcriptional effects of Eb on RC-proximal Vb gene segments and trypsinogen genes but fails to suppress Eb-dependent activation of more distal Vb gene segments. This suggests that Eb may influence the transcription of proximal and distal gene segments by different mechanisms. We propose that usRC poses no intrinsic barrier to Eb-mediated long-distance looping to upstream genes and gene segments, a conclusion that is consistent with our 3C studies. Instead, we suggest that usRC suppresses Eb contacts with more proximal sites that would otherwise be generated by loop extrusion. usRC bears structural and functional similarities to clusters of intergenic CBEs found proximal to the RCs in other antigen receptor loci, including IGCR1 in the Igh locus (Guo et al., 2011; Jain et al., 2018; Lin et al., 2015; Qiu et al., 2018), INT1-2 in the Tcra-Tcrd locus (Chen et al., 2015), and Cer-Sis in the Igk locus (Xiang et al., 2011, 2013). Deletion of these CBEs caused locus conformational changes and modified repertoires so that they were biased toward the usage of RC-proximal V gene segments. Such repertoire changes have been variously attributed to changes in long-distance interactions among rearranging gene segments, long-distance interactions among transcriptional regulatory elements, or RAG tracking from the RC (Hu et al., 2015; Jain et al., 2018). These mechanisms are equally applicable in the usRC-deleted Tcrb locus. However, the Tcrb locus is unique among antigen receptor loci in its high-level NL association, and usRC plays a unique role in maintaining LAD integrity. Therefore, it is likely that dissociation from the NL is a key upstream event for repertoire perturbation in DusRC VL3-3M2 cells. Vb-to-DJb recombination occurs in DN thymocytes but is then suppressed in DP thymocytes to enforce allelic exclusion. Prior three-dimensional fluorescence in situ hybridization (3D-FISH) analysis of the Tcrb locus indicated high NL association in primary DN and DP thymocytes (Schlimgen et al., 2008). This association appeared to be stochastic, with each Tcrb allele associating with the NL independently of the other allele. Because Vb-to-DJb rearrangement is suppressed on NL-associated alleles in DN thymocytes (Chan et al., 2013), we proposed that NL association reduces the efficiency of Vb-to-DJb recombination and diminishes the likelihood of both alleles attempting recombination in a similar time frame. Although we were unable to perform DamID in primary thymocytes developing in vivo due to the toxicity of the transduced Dam protein, our 3D-FISH studies (Chan et al., 2013; Schlimgen et al., 2008), together with the similar H3K9me2 profiles in VL3-3M2, DN and DP thymocytes, suggest that the Tcrb locus LAD organization of the VL3-3M2 cell line is likely to be applicable to DN and DP thymocytes in vivo. Nevertheless, we must remain cautious that chromatin regulation in VL33M2 may not perfectly mimic that in primary thymocytes. With this caveat in mind, we propose that the usRC LAD border functions in vivo to keep the proximal trypsinogen region anchored to the NL in a suppressed state, insulated from the RC. This in turn may limit the activation and rearrangement of Trbv29 and Trbv30, thereby suppressing their contribution to the Tcrb repertoire and enforcing their allelic exclusion.

1738 Cell Reports 25, 1729–1740, November 13, 2018

STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Mice B VL3-3M2 cell line METHOD DETAILS B Mice B Cell culture B Flow cytometry and cell sorting B CRISPR/Cas9 plasmid construction and transfection B Retroviral packaging and transduction B RNA isolation and analysis B DamID B DamID-seq analysis B ChIP B ChIP-seq B 3C B Tcrb repertoire analysis QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information includes four figures and two tables and can be found with this article online at https://doi.org/10.1016/j.celrep.2018.10.052. ACKNOWLEDGMENTS We thank the members of the Duke Cancer Institute Flow Cytometry Shared Resource Facility for help with cell sorting, Dr. Y. Zhuang for valuable suggestions, and Danielle Dauphars and Catherine Lewis for comments on the manuscript. This work was supported by the NIH (R01 AI49934 to M.S.K. and R21 AG050132 to K.L.R.). T.R.L. was partially supported by NIH grant T32 GM007445. K.R.C. was partially supported by the Duke Biostatistics Core, which is funded by the National Center for Advancing Translational Science (UL1TR001117). AUTHOR CONTRIBUTIONS S.C., K.L.R., and M.S.K. conceived and designed the experiments. S.C., E.B.D., A.T.B., T.R.L., and X.W. performed the experiments. S.C., T.R.L., K.R.C., and M.S.K. analyzed the experiments. S.C. and M.S.K. wrote the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. Received: July 12, 2018 Revised: October 2, 2018 Accepted: October 12, 2018 Published: November 13, 2018 REFERENCES Abarrategui, I., and Krangel, M.S. (2006). Regulation of T cell receptor-a gene recombination by transcription. Nat. Immunol. 7, 1109–1115.

Abarrategui, I., and Krangel, M.S. (2007). Noncoding transcription controls downstream promoters to regulate T-cell receptor a recombination. EMBO J. 26, 4380–4390. ek, K., Mason, C.E., and Schu €beler, D. (2015). Akalin, A., Franke, V., Vlahovic Genomation: a toolkit to summarize, annotate and visualize genomic intervals. Bioinformatics 31, 1127–1129. Barrington, C., Finn, R., and Hadjur, S. (2017). Cohesin biology meets the loop extrusion model. Chromosome Res. 25, 51–60. Bassing, C.H., Alt, F.W., Hughes, M.M., D’Auteuil, M., Wehrly, T.D., Woodman, B.B., Ga¨rtner, F., White, J.M., Davidson, L., and Sleckman, B.P. (2000). Recombination signal sequences restrict chromosomal V(D)J recombination beyond the 12/23 rule. Nature 405, 583–586. Bevington, S., and Boyes, J. (2013). Transcription-coupled eviction of histones H2A/H2B governs V(D)J recombination. EMBO J. 32, 1381–1392. Bian, Q., Khanna, N., Alvikas, J., and Belmont, A.S. (2013). b-Globin cis-elements determine differential nuclear targeting through epigenetic modifications. J. Cell Biol. 203, 767–783. Bossen, C., Mansson, R., and Murre, C. (2012). Chromatin topology and the regulation of antigen receptor assembly. Annu. Rev. Immunol. 30, 337–356. Bouvier, G., Watrin, F., Naspetti, M., Verthuy, C., Naquet, P., and Ferrier, P. (1996). Deletion of the mouse T-cell receptor b gene enhancer blocks alphabeta T-cell development. Proc. Natl. Acad. Sci. USA 93, 7877–7881. Brady, B.L., Steinel, N.C., and Bassing, C.H. (2010). Antigen receptor allelic exclusion: an update and reappraisal. J. Immunol. 185, 3801–3808. Callahan, B.J., McMurdie, P.J., Rosen, M.J., Han, A.W., Johnson, A.J., and Holmes, S.P. (2016). DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583. Chan, E.A., Teng, G., Corbett, E., Choudhury, K.R., Bassing, C.H., Schatz, D.G., and Krangel, M.S. (2013). Peripheral subnuclear positioning suppresses Tcrb recombination and segregates Tcrb alleles from RAG2. Proc. Natl. Acad. Sci. USA 110, E4628–E4637. Chen, L., Carico, Z., Shih, H.Y., and Krangel, M.S. (2015). A discrete chromatin loop in the mouse Tcra-Tcrd locus shapes the TCRd and TCRa repertoires. Nat. Immunol. 16, 1085–1093. Chung, D., Kuan, P.F., Welch, R., and Keles, S. (2018). MOSAiCS (modelbased one and two sample analysis and inference for ChIP-seq). R package, version 2.16.0. http://groups.google.com/d/forum/mosaics_user_group. Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. USA 107, 21931–21936. Dobrzynska, A., Gonzalo, S., Shanahan, C., and Askjaer, P. (2016). The nuclear lamina in health and disease. Nucleus 7, 233–248. Ebert, A., McManus, S., Tagoh, H., Medvedovic, J., Salvagiotto, G., Novatchkova, M., Tamir, I., Sommer, A., Jaritz, M., and Busslinger, M. (2011). The distal VH gene cluster of the Igh locus contains distinct regulatory elements with Pax5 transcription factor-dependent activity in pro-B cells. Immunity 34, 175–187. Finer, M.H., Dull, T.J., Qin, L., Farson, D., and Roberts, M.R. (1994). kat: a highefficiency retroviral transduction system for primary human T lymphocytes. Blood 83, 43–50. Gaidatzis, D., Lerch, A., Hahne, F., and Stadler, M.B. (2015). QuasR: quantification and annotation of short reads in R. Bioinformatics 31, 1130–1132. Gopalakrishnan, S., Majumder, K., Predeus, A., Huang, Y., Koues, O.I., VermaGaur, J., Loguercio, S., Su, A.I., Feeney, A.J., Artyomov, M.N., and Oltz, E.M. (2013). Unifying model for molecular determinants of the preselection Vb repertoire. Proc. Natl. Acad. Sci. USA 110, E3206–E3215.

Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature 453, 948–951. Guo, C., Yoon, H.S., Franklin, A., Jain, S., Ebert, A., Cheng, H.L., Hansen, E., Despo, O., Bossen, C., Vettermann, C., et al. (2011). CTCF-binding elements mediate control of V(D)J recombination. Nature 477, 424–430. Harr, J.C., Luperchio, T.R., Wong, X., Cohen, E., Wheelan, S.J., and Reddy, K.L. (2015). Directed targeting of chromatin to the nuclear lamina is mediated by chromatin state and A-type lamins. J. Cell Biol. 208, 33–52. Hu, J., Zhang, Y., Zhao, L., Frock, R.L., Du, Z., Meyers, R.M., Meng, F.L., Schatz, D.G., and Alt, F.W. (2015). Chromosomal Loop Domains Direct the Recombination of Antigen Receptor Genes. Cell 163, 947–959. Huber, W., Carey, V.J., Gentleman, R., Anders, S., Carlson, M., Carvalho, B.S., Bravo, H.C., Davis, S., Gatto, L., Girke, T., et al. (2015). Orchestrating highthroughput genomic analysis with Bioconductor. Nat. Methods 12, 115–121. Isoda, T., Moore, A.J., He, Z., Chandra, V., Aida, M., Denholtz, M., Piet van Hamburg, J., Fisch, K.M., Chang, A.N., Fahl, S.P., et al. (2017). Non-coding transcription instructs chromatin folding and compartmentalization to dictate enhancer-promoter communication and T cell fate. Cell 171, 103–119.e18. Jain, S., Ba, Z., Zhang, Y., Dai, H.Q., and Alt, F.W. (2018). CTCF-binding elements mediate accessibility of RAG substrates during chromatin scanning. Cell 174, 102–116.e14. Ji, Y., Resch, W., Corbett, E., Yamane, A., Casellas, R., and Schatz, D.G. (2010). The in vivo pattern of binding of RAG1 and RAG2 to antigen receptor loci. Cell 141, 419–431. Kind, J., Pagie, L., Ortabozkoyun, H., Boyle, S., de Vries, S.S., Janssen, H., Amendola, M., Nolen, L.D., Bickmore, W.A., and van Steensel, B. (2013). Single-cell dynamics of genome-nuclear lamina interactions. Cell 153, 178–192. Kind, J., Pagie, L., de Vries, S.S., Nahidiazar, L., Dey, S.S., Bienko, M., Zhan, Y., Lajoie, B., de Graaf, C.A., Amendola, M., et al. (2015). Genome-wide maps of nuclear lamina interactions in single human cells. Cell 163, 134–147. Kosak, S.T., Skok, J.A., Medina, K.L., Riblet, R., Le Beau, M.M., Fisher, A.G., and Singh, H. (2002). Subnuclear compartmentalization of immunoglobulin loci during lymphocyte development. Science 296, 158–162. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25. Lin, S.G., Guo, C., Su, A., Zhang, Y., and Alt, F.W. (2015). CTCF-binding elements 1 and 2 in the Igh intergenic control region cooperatively regulate V(D) J recombination. Proc. Natl. Acad. Sci. USA 112, 1815–1820. Majumder, K., Koues, O.I., Chan, E.A., Kyle, K.E., Horowitz, J.E., Yang-Iott, K., Bassing, C.H., Taniuchi, I., Krangel, M.S., and Oltz, E.M. (2015). Lineage-specific compaction of Tcrb requires a chromatin barrier to protect the function of a long-range tethering element. J. Exp. Med. 212, 107–120. Maman, Y., Teng, G., Seth, R., Kleinstein, S.H., and Schatz, D.G. (2016). RAG1 targeting in the genome is dominated by chromatin interactions mediated by the non-core regions of RAG1 and RAG2. Nucleic Acids Res. 44, 9624–9637. Mathieu, N., Hempel, W.M., Spicuglia, S., Verthuy, C., and Ferrier, P. (2000). Chromatin remodeling by the T cell receptor (TCR)-b gene enhancer during early T cell development: implications for the control of TCR-b locus recombination. J. Exp. Med. 192, 625–636. Medvedovic, J., Ebert, A., Tagoh, H., Tamir, I.M., Schwickert, T.A., Novatchkova, M., Sun, Q., Huis In ’t Veld, P.J., Guo, C., Yoon, H.S., et al. (2013). Flexible long-range loops in the VH gene region of the Igh locus facilitate the generation of a diverse antibody repertoire. Immunity 39, 229–244. Merkenschlager, M., and Nora, E.P. (2016). CTCF and cohesin in genome folding and transcriptional gene regulation. Annu. Rev. Genomics Hum. Genet. 17, 17–43.

Groves, T., Katis, P., Madden, Z., Manickam, K., Ramsden, D., Wu, G., and Guidos, C.J. (1995). In vitro maturation of clonal CD4+CD8+ cell lines in response to TCR engagement. J. Immunol. 154, 5011–5022.

Meuleman, W., Peric-Hupkes, D., Kind, J., Beaudry, J.B., Pagie, L., Kellis, M., Reinders, M., Wessels, L., and van Steensel, B. (2013). Constitutive nuclear lamina-genome interactions are highly conserved and associated with A/T-rich sequence. Genome Res. 23, 270–280.

Guelen, L., Pagie, L., Brasset, E., Meuleman, W., Faza, M.B., Talhout, W., Eussen, B.H., de Klein, A., Wessels, L., de Laat, W., and van Steensel, B. (2008).

Morgan, M., Page`s, H., Obenchain, V., and Hayden, N. (2018). Rsamtools: binary alignment (BAM), FASTA, variant call (BCF), and tabix file import. R

Cell Reports 25, 1729–1740, November 13, 2018 1739

package, version 1.30.0. http://bioconductor.org/packages/release/bioc/html/ Rsamtools.html. Pear, W.S., Nolan, G.P., Scott, M.L., and Baltimore, D. (1993). Production of high-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci. USA 90, 8392–8396. Peric-Hupkes, D., Meuleman, W., Pagie, L., Bruggeman, S.W., Solovei, I., Brugman, W., Gra¨f, S., Flicek, P., Kerkhoven, R.M., van Lohuizen, M., et al. (2010). Molecular maps of the reorganization of genome-nuclear lamina interactions during differentiation. Mol. Cell 38, 603–613. Poleshko, A., Shah, P.P., Gupta, M., Babu, A., Morley, M.P., Manderfield, L.J., Ifkovits, J.L., Calderon, D., Aghajanian, H., Sierra-Pagan, J.E., et al. (2017). Genome-nuclear lamina interactions regulate cardiac stem cell lineage restriction. Cell 171, 573–587.e14. Polioudaki, H., Kourmouli, N., Drosou, V., Bakou, A., Theodoropoulos, P.A., Singh, P.B., Giannakouros, T., and Georgatos, S.D. (2001). Histones H3/H4 form a tight complex with the inner nuclear membrane protein LBR and heterochromatin protein 1. EMBO Rep. 2, 920–925. Qiu, X., Kumari, G., Gerasimova, T., Du, H., Labaran, L., Singh, A., De, S., Wood, W.H., 3rd, Becker, K.G., Zhou, W., et al. (2018). Sequential enhancer sequestration dysregulates recombination center formation at the IgH locus. Mol. Cell 70, 21–33.e6.

Simon, M.D., Pinter, S.F., Fang, R., Sarma, K., Rutenberg-Schoenberg, M., Bowman, S.K., Kesner, B.A., Maier, V.K., Kingston, R.E., and Lee, J.T. (2013). High-resolution Xist binding maps reveal two-step spreading during X-chromosome inactivation. Nature 504, 465–469. Sleckman, B.P., Bassing, C.H., Hughes, M.M., Okada, A., D’Auteuil, M., Wehrly, T.D., Woodman, B.B., Davidson, L., Chen, J., and Alt, F.W. (2000). Mechanisms that direct ordered assembly of T cell receptor b locus V, D, and J gene segments. Proc. Natl. Acad. Sci. USA 97, 7975–7980. Somech, R., Shaklai, S., Geller, O., Amariglio, N., Simon, A.J., Rechavi, G., and Gal-Yam, E.N. (2005). The nuclear-envelope protein and transcriptional repressor LAP2b interacts with HDAC3 at the nuclear periphery, and induces histone H4 deacetylation. J. Cell Sci. 118, 4017–4025. Tie, F., Banerjee, R., Stratton, C.A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz, M.O., Scacheri, P.C., and Harte, P.J. (2009). CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 136, 3131–3141. Towbin, B.D., Gonza´lez-Aguilera, C., Sack, R., Gaidatzis, D., Kalck, V., Meister, P., Askjaer, P., and Gasser, S.M. (2012). Step-wise methylation of histone H3K9 positions heterochromatin at the nuclear periphery. Cell 150, 934–947.

R Core Team (2018). R: a language and environment for statistical computing (R Foundation for Statistical Computing). https://www.R-project.org/.

van Steensel, B., and Belmont, A.S. (2017). Lamina-associated domains: links with chromosome architecture, heterochromatin, and gene repression. Cell 169, 780–791.

Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281– 2308.

van Steensel, B., and Henikoff, S. (2000). Identification of in vivo DNA targets of chromatin proteins using tethered dam methyltransferase. Nat. Biotechnol. 18, 424–428.

Reddy, K.L., Zullo, J.M., Bertolino, E., and Singh, H. (2008). Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature 452, 243–247. Robson, M.I., de Las Heras, J.I., Czapiewski, R., Sivakumar, A., Kerr, A.R.W., and Schirmer, E.C. (2017). Constrained release of lamina-associated enhancers and genes from the nuclear envelope during T-cell activation facilitates their association in chromosome compartments. Genome Res. 27, 1126–1138. Schatz, D.G., and Ji, Y. (2011). Recombination centres and the orchestration of V(D)J recombination. Nat. Rev. Immunol. 11, 251–263. Schlimgen, R.J., Reddy, K.L., Singh, H., and Krangel, M.S. (2008). Initiation of allelic exclusion by stochastic interaction of Tcrb alleles with repressive nuclear compartments. Nat. Immunol. 9, 802–809. Seshan, V.E., and Olshen, A. (2018). DNAcopy: DNA copy number data analysis. R package, version 1.52.0. https://www.bioconductor.org/packages/ release/bioc/html/DNAcopy.html. Shih, H.Y., Verma-Gaur, J., Torkamani, A., Feeney, A.J., Galjart, N., and Krangel, M.S. (2012). Tcra gene recombination is supported by a Tcra enhancerand CTCF-dependent chromatin hub. Proc. Natl. Acad. Sci. USA 109, E3493–E3502. Shinkai, Y., Rathbun, G., Lam, K.P., Oltz, E.M., Stewart, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., Stall, A.M., et al. (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 855–867. Sikes, M.L., Gomez, R.J., Song, J., and Oltz, E.M. (1998). A developmental stage-specific promoter directs germline transcription of D b J b gene segments in precursor T lymphocytes. J. Immunol. 161, 1399–1405.

1740 Cell Reports 25, 1729–1740, November 13, 2018

Vogel, M.J., Peric-Hupkes, D., and van Steensel, B. (2007). Detection of in vivo protein-DNA interactions using DamID in mammalian cells. Nat. Protoc. 2, 1467–1478. Wen, B., Wu, H., Shinkai, Y., Irizarry, R.A., and Feinberg, A.P. (2009). Large histone H3 lysine 9 dimethylated chromatin blocks distinguish differentiated from embryonic stem cells. Nat. Genet. 41, 246–250. Williams, C.J., Grandal, I., Vesprini, D.J., Wojtyra, U., Danska, J.S., and Guidos, C.J. (2001). Irradiation promotes V(D)J joining and RAG-dependent neoplastic transformation in SCID T-cell precursors. Mol. Cell. Biol. 21, 400–413. Xiang, Y., Zhou, X., Hewitt, S.L., Skok, J.A., and Garrard, W.T. (2011). A multifunctional element in the mouse Igk locus that specifies repertoire and Ig loci subnuclear location. J. Immunol. 186, 5356–5366. Xiang, Y., Park, S.K., and Garrard, W.T. (2013). Vk gene repertoire and locus contraction are specified by critical DNase I hypersensitive sites within the Vk-Jk intervening region. J. Immunol. 190, 1819–1826. Yancopoulos, G.D., and Alt, F.W. (1985). Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40, 271–281. Yao, J., Fetter, R.D., Hu, P., Betzig, E., and Tjian, R. (2011). Subnuclear segregation of genes and core promoter factors in myogenesis. Genes Dev. 25, 569–580. Zullo, J.M., Demarco, I.A., Pique´-Regi, R., Gaffney, D.J., Epstein, C.B., Spooner, C.J., Luperchio, T.R., Bernstein, B.E., Pritchard, J.K., Reddy, K.L., and Singh, H. (2012). DNA sequence-dependent compartmentalization and silencing of chromatin at the nuclear lamina. Cell 149, 1474–1487.

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

LEAF-purified anti-mouse CD3ε (145-2C11)

Biolegend

Cat# 100331; RRID: AB_1877073

PE anti-mouse CD4 (GK1.5)

Biolegend

Cat# 100408; RRID: AB_312693

APC anti-mouse CD8a (53-6.7)

Biolegend

Cat# 100712; RRID: 100712 Cat# 109230; RRID: 2562562

Antibodies

Brilliant Violet 421 anti-mouse TCRb (H57-597)

Biolegend

Anti-mouse TCR Vb screening panel

BD Biosciences

Cat# 557004; RRID: AB_647180

Anti-H3K9me2

abcam

Cat# ab1220; RRID: AB_449854

Anti-H3K27ac

abcam

Cat# ab4729; RRID: AB_2118291

Anti-H3K27me3

Millipore

Cat# 07-449; RRID: AB_310624

Normal rabbit IgG control antibody

R&D Systems

Cat# AB-105-C; RRID: AB_354266

Chemicals, Peptides, and Recombinant Proteins 7-amino-actinomycin D

Biolegend

Cat# 420404

Trizol

Ambion

Cat# 15596-026

DNase I (RNase-free)

New England Biolabs

Cat# M0303

BglII

New England Biolabs

Cat# R0144

DpnI

New England Biolabs

Cat# R0176

DpnII

New England Biolabs

Cat# R0543

HindIII

New England Biolabs

Cat# R0104

T4 DNA ligase

New England Biolabs

Cat# M0202

T4 DNA ligase

Roche

Cat# 10481220001

Hexadimethrine bromide

Sigma-Aldrich

Cat# H9268

Benzamidine hydrochloride hydrate

Sigma-Aldrich

Cat# B6506

Phenylmethanesulfonyl fluoride

Sigma-Aldrich

Cat# P7626

Protein A agarose/salmon sperm DNA slurry

Millipore

Cat# 16-157

Micrococcal nuclease

New England Biolabs

Cat# M0247

Proteinase K, Biotechnology Grade

VWR

Cat# 0706

Sodium butyrate

Sigma-Aldrich

Cat# 303410

Paraformaldehyde aqueous solution, 16%

Electron Microscopy Sciences

Cat# 15710

Glycine

Sigma-Aldrich

Cat# G7126

iScript cDNA Synthesis Kit

Bio-Rad

Cat# 170-8891

QuantiFast SYBR Green PCR Kit

QIAGEN

Cat# 204057

Cell Line Nucleofector Kit V

Amaxa

Cat# VCA-1003

Critical Commercial Assays

Advantage 2 Polymerase Mix

Takara

Cat# 639201

QIAquick PCR Purification Kit

QIAGEN

Cat# 28106

LightCycler 480 Probes Master

Roche

Cat# 4902343001

NEBNext End Repair Module

New England Biolabs

Cat# E6050

NEBNext Ultra DNA Library Prep Kit for Illumina

New England Biolabs

Cat# E7370

DNA Clean and Concentrator 5

Zymo Research

Cat# D4003

immunoSEQ mouse TCRb sequencing

Adaptive Biotechnologies

N/A

DamID-seq

This paper

GEO: GSE116954

H3K27ac ChIP-seq

This paper

GEO: GSE116954

Deposited Data

(Continued on next page)

Cell Reports 25, 1729–1740.e1–e6, November 13, 2018 e1

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

H3K9me2 ChIP-seq

This paper

GEO: GSE116954

CTCF ChIP-seq

Shih et al., 2012

GEO: GSE41743

Experimental Models: Cell Lines M. musculus VL3-3M2 cell line

Groves et al., 1995

N/A

M. musculus VL3-3M2 derivative cell lines

This paper

Table S1

H. sapiens BOSC23 cell line

Pear et al., 1993

RRID: CVCL_4401

Shinkai et al., 1992

RRID: IMSR_TAC:rag2

Experimental Models: Organisms/Strains M. musculus 129 strain Rag2/ Oligonucleotides Primers and probes for qPCR (all assays)

This paper

Table S2

DamID adaptor AdRt CTAATACGACTCACTA TAGGGCAGCGTGGTCGCGGCCGAGGA

Vogel et al., 2007

N/A

DamID adaptor AdRb TCCTCGGCCG

Vogel et al., 2007

N/A

DamID primer AdR-PCR GGTCGCGGCCG AGGATC

Vogel et al., 2007

N/A

Recombinant DNA BAC: RP23-416M23

BACPAC Resources Center

Cat# RP23-416M23

BAC: RP23-31E15

BACPAC Resources Center

Cat# RP23-31E15

BAC: RP23-238C12

BACPAC Resources Center

Cat# RP23-238C12

pX458

Ran et al., 2013

Addgene plasmid #48138

pkat2ampac

Finer et al., 1994

N/A

pSMGV Dam-V5

Reddy et al., 2008

N/A

pSMGV Dam-V5-LMNB1

Reddy et al., 2008

N/A

Software and Algorithms CRISPR design tool

Ran et al., 2013

http://crispr.mit.edu/

LADetector

Harr et al., 2015 and this paper

https://github.com/thereddylab/pyLAD

Bowtie

Langmead et al., 2009

http://bowtie-bio.sourceforge.net/index.shtml

R

R Core Team, 2018

https://www.r-project.org/

Bioconductor in R

Huber et al., 2015

https://www.bioconductor.org/

R package: DNAcopy

Seshan and Olshen, 2018

https://bioconductor.org/packages/release/ bioc/html/DNAcopy.html

R package: dada2

Callahan et al., 2016

https://bioconductor.org/packages/release/ bioc/html/dada2.html

R package: QuasR

Gaidatzis et al., 2015

https://www.bioconductor.org/packages/ release/bioc/html/QuasR.html

R package: Rsamtools

Morgan et al., 2018

https://bioconductor.org/packages/release/ bioc/html/Rsamtools.html

R package: mosaics

Chung et al., 2018

https://bioconductor.org/packages/release/ bioc/html/mosaics.html

R package: genomation

Akalin et al., 2015

https://bioconductor.org/packages/release/ bioc/html/genomation.html

Graphpad Prism

GraphPad Software

https://www.graphpad.com/

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Michael S. Krangel ([email protected]).

e2 Cell Reports 25, 1729–1740.e1–e6, November 13, 2018

EXPERIMENTAL MODEL AND SUBJECT DETAILS Mice Rag2/ mice were of strain 129 background (Shinkai et al., 1992). Mice were housed in a specific-pathogen-free facility managed by the Duke University Division of Laboratory Animal Resources. Mice of both sexes were included in all experiments; no differences on the basis of sex were noted. All mice were handled in accordance with protocols approved by the Duke University Institutional Animal Care and Use Committee. VL3-3M2 cell line This study utilized the VL3-3M2 cell line (Groves et al., 1995), which was derived from a radiation leukemia virus-induced C57BL6/Ka thymic lymphoma. Derivative VL3-3M2 cell lines were generated by CRISPR/Cas9-mediated mutation. METHOD DETAILS Mice Mice were generally sacrificed at 4 weeks of age. DN thymocytes were obtained directly from Rag2/ mice, while DP thymocytes were obtained from Rag2/ mice that were injected intraperitoneally with 150 mg of anti-CD3ε antibody (145-2C11, Biolegend) 10 days prior to sacrifice. Cell culture VL3-3M2 cells were maintained in RPMI 1640 with L-glutamine (GIBCO) supplemented with 10% fetal bovine serum (FBS) (Gemini Bio-Products), 50 U/mL penicillin-streptomycin (GIBCO) and 55 mM 2-mercaptoethanol (GIBCO). BOSC23 cells were maintained in DMEM (GIBCO) supplemented with 10% FBS (Gemini Bio-Products) and 50 U/mL penicillin-streptomycin. Cells were cultured at 37 C in 5% CO2 in a humidified incubator. Flow cytometry and cell sorting VL3-3M2 cells were stained with the following mAbs and reagents from Biolegend: CD4-PE (GK1.5), CD8a-APC (53-6.7), BV421TCRb (H57-597) and 7-amino-actinomycin D (7AAD). Repertoire analysis was performed by staining with the following FITC-conjugated mAbs from the Mouse Vb TCR screening panel (BD Biosciences): Vb3 (JK25), Vb4 (KT4), Vb7 (TR310), Vb8.1/8.2 (MR5-2) and Vb14 (14-2). Flow cytometric data acquisition was performed on a FACSCanto II (Becton Dickinson). Cell sorting was performed on an Astrios (Beckman Coulter), MoFlo XDP (Beckman Coulter) or FACSDiVa (Becton Dickinson). CRISPR/Cas9 plasmid construction and transfection CRISPR/Cas9 guides were designed using the Zhang lab CRISPR design tool available at http://crispr.mit.edu/ (Ran et al., 2013). Guides were cloned into pX458 according to the Zhang lab general cloning protocol. For transient transfection into VL3-3M2 cells, 2 mg of plasmid was mixed with 106 cells in 100 mL of Cell Line Nucleofector Kit V solution (Amaxa) and electroporation was performed using program X-001. Transfected cells were allowed to expand for three days before single cell sorting into 96-well plates. Clones were expanded for nine days before gDNA was harvested for screening by PCR. Initial screening was performed on column and row pools, after which prospective clones were expanded for a second round of PCR screening followed by Sanger sequencing of the PCR product. Cell lines bearing compound deletions were generated by two rounds of this process. DusRC+DEb was created using DEb as a base, D50 PC+DPDb1CBE was created using DPDb1CBE as a base, and D50 PC+DPDb1 was created using DPDb1 as a base. Mutated sequences (with indicated guides) are listed in Table S1. Retroviral packaging and transduction The BOSC23 cell line (Pear et al., 1993), a derivative of the HEK293T cell line, was grown to 80%–90% confluency in 10 cm tissue culture-treated dishes and transfected with 10 mg of retroviral vector and 5 mg of packaging plasmid pkat2ampac (Finer et al., 1994) using calcium phosphate. Media was replaced one day later and viral supernatant harvested the following day. VL3-3M2 cells were transduced by spin-infection. In brief, 106 VL3-3M2 cells were resuspended in 1 mL of viral supernatant and 10 mg of hexadimethrine bromide (Sigma-Aldrich) and placed into a 48-well tissue culture-treated plate. Spin-infection was performed by centrifugation at 1500 g for 90 minutes at 32 C. Following spin-infection, the viral supernatant was removed and replaced with fresh culture medium. RNA isolation and analysis RNA was isolated using Trizol (Ambion). Following purification, RNA was treated with DNase I (New England Biolabs) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad). RT-qPCR was performed using the QuantiFast SYBR Green PCR kit (QIAGEN) on a Roche Lightcycler 480 using the following program: 5 min at 95 C, followed by 45 cycles of 10 s at 95 C and 30 s at 62 C. RT-qPCR primers detecting Vb gene segment transcription were designed to span the RSS to only detect transcripts originating from unrearranged gene segments. qPCR primers and probes (if applicable) for all qPCR-based assays are listed in Table S2. Experimental values were normalized to values for Actb in each sample.

Cell Reports 25, 1729–1740.e1–e6, November 13, 2018 e3

DamID VL3-3M2 cells were transduced with pSMGV Dam-V5 (unfused Dam control) or pSMGV Dam-V5-LMNB1 (Dam-Lamin B1) (Reddy et al., 2008) and grown for three days before sorting and expansion of GFP+ cells. gDNA was harvested and purified by phenol-chloroform extraction and isopropanol precipitation. Subsequent steps followed the protocol described in Vogel et al. (2007). In brief, 2.5 mg of gDNA was digested with 10 U of DpnI (New England Biolabs) in 10 mL overnight at 37 C, followed by heat inactivation at 80 C for 20 min. The DpnI-digested product was ligated to 40 pmol of double-stranded adaptor dsAdR, consisting of the annealed oligonucleotides AdRt: CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA and AdRb: TCCTCGGCCG, with 400 U of T4 DNA ligase (New England Biolabs) in 20 mL for 2 h at 16oC, followed by heat inactivation at 65 C for 10 min. Unmethylated fragments were digested with 10 U of DpnII (New England Biolabs) in 50 mL for 1 h at 37 C, followed by heat inactivation at 65 C for 20 min. 20% of the sample was utilized for PCR amplification using Advantage 2 polymerase mix (Takara) with 62.5 pmol of AdRPCR primer: GGTCGCGGCCGAGGATC using the following program: 68 C for 10 min, 94 C for 1 min, 65 C for 5 min, 68 C for 15 min, 3 cycles of 94 C for 1 min, 65 C for 1 min, 68 C for 10 min, and 18 cycles of 94 C for 1 min, 65 C for 1 min, 68 C for 2 min. The PCR product was purified using the QIAquick PCR Purification Kit (QIAGEN). For DamID-qPCR, qPCR analysis was performed by SYBR-based qPCR with conditions identical to those used for RT-qPCR. For DamID-seq, the DamID PCR product was randomized by sonication following end repair and ligation. Specifically, 1-2 mg DamID material was subjected to end repair using the NEBNext End Repair Module (New England Biolabs) and cleaned up using DNA Clean and Concentrator 5 (Zymo Research). Cleaned up DNA was ligated with 5U T4 DNA ligase (Roche) per 1 mg material in 20 mL to generate a library of large DNA fragments. This DNA library was diluted to 200 mL in H2O, sonicated for one hour in 1.5 mL DNA LoBind tubes (Eppendorf) using a Bioruptor (Diagenode), then transferred to 1.5 mL TPX tubes (Diagenode) for four rounds of 10 min sonication to yield fragments of 150-300 bp in size. Samples were transferred to new TPX tubes between each round of sonication to minimize loss of DNA fragments. The sonicated DNA was transferred to 1.5mL DNA LoBind tubes, ethanol precipitated and resuspended in 10 mL of 10 mM Tris-HCl pH 8.0. Samples were quantified using Qubit and sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs). In independent experiments, we obtained 100 bp single end reads using an Illumina HiSeq 2500 or 150 bp paired end reads (with one end discarded) using an Illumina HiSeq 4000. DamID-seq analysis DamID-seq reads were processed using LADetector (available at https://github.com/thereddylab/pyLAD), an updated Python implementation of LADetector described in Harr et al. (2015) with incorporated sequence mapping. pyLAD was run with the parameters ‘‘–multimapping–quality-trim –unalignable–count-overlaps –seed 5.’’ Reads were quality trimmed using a sliding window quality score average over 3 bases and a minimum score cutoff of 30. This was followed by trimming any matching overlap between read-ends and sequencing or DamID adaptor-primer sequence. Reads containing a DamID adaptor-primer sequence were split and adaptor-primer sequence removed. All resulting reads greater than 20 bp were aligned to mm9 using Bowtie (Langmead et al., 2009) with parameters ‘‘—tryhard –best–m 1.’’ Unaligned reads had 10 bases trimmed from the 50 end and remapped, and the resultant unmapped reads were trimmed 10 bases from the 30 end and remapped. Total aligned reads were assigned to DpnI bins, with reads straddling bin boundaries counting toward both. Prior to scoring, a value of 0.5 was added to bins with no reads. Bins falling in unaligned regions were removed prior to analysis. DamID scores were calculated for all non-zero bins as the log2 ratio of Dam-Lamin B1 over unfused Dam. Scores were partitioned using circular binary segmentation using the DNAcopy package in R (Seshan and Olshen, 2018). LADs were classified as regions > 100 kb in size of positive signal, allowing for smaller regions of negative signal < 10 kb in size. ChIP 107 VL3-3M2 cells or primary thymocytes were washed in phosphate buffered saline supplemented with 5 mM EDTA, 500 mM spermidine and 150 mM spermine, followed by the same solution lacking EDTA. Cells were lysed by incubation for 5 min on ice in 250 mM sucrose, 80 mM NaCl, 10 mM Tris-HCl pH 8.0, 6 mM MgCl2, 1 mM CaCl2, 500 mM spermidine, 150 mM spermine, containing either 0.2% v/v NP-40 (for VL3-3M2 cells) or 0.02% v/v NP-40 (for primary thymocytes). Samples were centrifuged at 750 g for 5 min at 4 C and the pellet was washed in 200 ml of digestion buffer (250 mM sucrose, 10 mM NaCl, 10 mM Tris-HCl pH 8.0, 3 mM MgCl2, 1 mM CaCl2). The pellet was then resuspended in 200 ml of digestion buffer and 200 gel units of micrococcal nuclease (New England Biolabs) was added for a 10 min incubation at 37 C. The reaction was terminated by addition of 300 ml 10 mM Tris-HCl pH 8.0, 5 mM EDTA. After centrifugation at 18000 g for 10 min at 4 C, supernatants were harvested and Triton X-100 added to a final concentration of 1% v/v. After checking digestion efficiency on a gel, chromatin was pre-cleared by addition of 50 ml protein A agarose/salmon sperm DNA slurry (Millipore) and mixing for 1 h at 4 C. Supernatant corresponding to 5 3 106 cells was incubated overnight at 4 C with 5 mg of antibody specific for H3K9me2 (Abcam), H3K27ac (Abcam), H3K27me3 (Millipore) or control IgG (R&D Systems). Pulldown was performed by adding 50 ml protein A agarose/salmon sperm DNA slurry (Millipore) and mixing for 1 h at 4 C. The slurry was washed twice with 1 mL of each of the following wash buffers: 167 mM NaCl, 16.7 mM Tris-HCl pH 8.0, 1.2 mM EDTA, 1.1% v/v Triton X-100, 0.01% w/v SDS; 300 mM NaCl, 20 mM Tris-HCl pH 8.0, 2 mM EDTA, 1% v/v Triton X-100, 0.1% w/v SDS; 50 mM Tris-HCl pH 8.0, 0.25 M LiCl, 0.5% v/v NP-40, 0.5% w/v sodium deoxycholate; 10 mM Tris-HCl pH 8.0, 1 mM EDTA. Elution was performed by resuspending the slurry in 100 ml of 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.3% w/v SDS and 1 mg/mL proteinase K (VWR) overnight at 65 C. Elution buffer was set aside and a second elution performed using 0.5 M NaCl, 10 mM Tris-HCl pH 8.0, 1 mM

e4 Cell Reports 25, 1729–1740.e1–e6, November 13, 2018

EDTA. Eluates were combined and volumes were adjusted to 500 ml with 10 mM Tris-HCl pH 8.0, 1 mM EDTA. DNA was purified by phenol-chloroform extraction and isopropanol precipitation and resuspended in H2O. In addition to the listed components, all buffers used before elution also contained 10 mM sodium butyrate (Sigma-Aldrich), 100 mM PMSF (Sigma-Aldrich) and 100 mM benzamidine (Sigma-Aldrich). qPCR analysis of H3K27me3 was performed by SYBR-based qPCR with conditions identical to those used for RT-qPCR. ChIP-seq Library preparation and high-throughput sequencing were performed by the Duke Center for Genomic and Computational Biology Core Facility. 50 bp single end reads were obtained using an Illumina HiSeq 4000. Analysis was primarily performed using the Bioconductor set of packages in R (Huber et al., 2015; R Core Team, 2018). Demultiplexed .fastq files were trimmed using the fastqFilter command in the dada2 package (Callahan et al., 2016) with the parameters ‘‘truncLen = 0, trimLeft = 0, maxN = 0, minQ = 0, rm.phix = TRUE.’’ The trimmed files were aligned to the mm9 genome using the qAlign command in the QuasR package (Gaidatzis et al., 2015; Langmead et al., 2009), a wrapper for Rbowtie with the parameters ‘‘aligner = ‘‘Rbowtie,’’ maxHits = 1, paired = NULL.’’ .bam files were merged using the mergeBam command in the Rsamtools package (Morgan et al., 2018). To generate ChIP-seq tracks, reads were placed into 200 bp bins using the constructBins command in the mosaics package (Chung et al., 2018) with the parameters ‘‘fragLen = 150, binSize = 200, capping = 50, PET = FALSE.’’ Reads that corresponded to chromosome Y, chromosome M or unmapped parts of the chromosome were excluded. Bins were assembled into tracks in the .bedgraph format using a custom script. For H3K27ac tracks, bins were normalized to reads per million. H3K9me2 tracks were normalized for read count relative to the input sample and a value of 1 was added to bins with no reads. Log2 ratios of the H3K9me2 sample over input were then plotted. Correlation graphs between DamID-seq and H3K9me2 ChIP-seq were constructed by placing reads into 10 kb bins using the constructBins command as described above, except changing ‘‘binSize = 10000.’’ Matching bins were plotted and the Pearson’s correlation coefficient obtained using the cor function in R. To align the features surrounding LAD borders, we first defined the regions extending 50 kb upstream and downstream of the 50 LAD borders. These regions were then aligned using the plotMeta command in the genomation package (Akalin et al., 2015). 3C 5 3 106 VL3-3M2 cells were crosslinked in 8 mL of RPMI 1640 (GIBCO) containing 10% v/v FBS (Gemini Bio-Products) and 2% w/v paraformaldehyde (Electron Microscopy Sciences) for 10 min at 20 C. Crosslinking was terminated by the addition of 1 mL 1.25M glycine (Sigma-Aldrich). Fixed cells were pelleted by centrifugation and cytoplasm removed by incubation in 5 mL 10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% v/v NP-40, 1 mM PMSF (Sigma-Aldrich) and 1 mM benzamidine (Sigma-Aldrich) for 10 min on ice. Nuclei were pelleted by centrifugation and resuspended in 450 mL 1.1x restriction enzyme buffer (buffer 2 for HindIII or buffer 3 for BglII) and 7.5 mL of 20% w/v SDS was added for 1 h incubation at 37 C. 50 mL of 20% v/v Triton X-100 was then added for 1 h at 37 C, and 200 U HindIII or BglII (New England Biolabs) was added for overnight digest at 37 C. Reactions were then supplemented with an additional 200 U of restriction enzyme for a 6 h incubation. After heat inactivation and sequential incubation with SDS and Triton X-100 as above, the samples were diluted to 7 mL in 1x T4 DNA ligase buffer, and 4000 U T4 DNA ligase (New England Biolabs) was added for overnight incubation at 16 C. Reactions were then supplemented with an additional 4000 U T4 DNA ligase for a 6 h incubation. Samples were then digested by addition of proteinase K (VWR) to 1 mg/mL for overnight incubation at 65 C, and DNA was purified by phenol/chloroform extraction followed by isopropanol precipitation. 3C products were quantified by a Taqmanbased qPCR strategy using the LightCycler 480 probes master mix (Roche) on a Roche Lightcycler 480 using the following program: 5 min at 95 C, followed by 48 cycles of 10 s at 95 C and 30 s at 62 C. Values were normalized to a bacterial artificial chromosome (BAC) standard generated from RP23-416M23, RP23-31E15 and RP23-238C12 (BACPAC Resources Center, Children’s Hospital Oakland Research Institute) and a second normalization step was performed by normalizing values to the nearest neighbor fragment. Tcrb repertoire analysis Initial assessment was performed by Taqman-based qPCR of gDNA isolated from unsynchronized cells using PCR conditions identical to those for 3C. Readings were normalized to Cd14. For the timed recombination system, each VL3-3M2 line was transfected with a pX458 derivative targeting the VDJb junction on the rearranged allele and three days later, TCRbGFP+ cells were single cell sorted into 96-well plates. For each cell line, twelve clones were cultured for 21 days and recombination was scored by flow cytometry to quantify TCRb+ cells. To enrich for cells with functional rearrangements, we chose three clones from each line which displayed recombination frequencies closest to the median and sorted TCRb+ cells. The Tcrb repertoire was assessed by flow cytometric staining using Vb-specific mAbs (BD Biosciences) and by high-throughput sequencing of rearrangement events using the immunoSEQ service (Adaptive Biotechnologies). Verification of the direct Vb-to-Jb rearrangements was performed by SYBR-based qPCR with conditions identical to those used in measuring transcription. Readings were normalized to Cd14. QUANTIFICATION AND STATISTICAL ANALYSIS Unless otherwise specified, statistical analysis was carried out by two-way ANOVA with adjustment for multiple comparisons using GraphPad Prism software. Differences with adjusted p values of < 0.05 were considered significant. The number of biological

Cell Reports 25, 1729–1740.e1–e6, November 13, 2018 e5

replicates (n) is listed in the legend of each figure. For DamID-qPCR, effect sizes and significance were calculated by fitting a model of the form: yijk = m + ai + bj + bk + εijk Where yijk is the DamID signal for the i-th locus, j-th VL3-3M2 line and k-th run. The model explains variation in expression levels relative to a baseline m, which represents the average expression level at the Tp4 locus in wild-type cells. The terms ai show the difference in expression at other loci (relative to baseline) in wild-type cells. The terms bj show the effect (average difference in expression) for other lines relative to wild-type. The assumption is that this effect is constant across all loci. The terms bk represent the random effect of run/batch, assumed to have a zero mean Gaussian distribution. Finally εijk is unexplained/measurement error, also assumed to have a zero mean Gaussian distribution but independent of the batch effect. The model was fit to observed data for all runs but restricted to loci lying between Trbv30 and Tp4, both inclusive, using the method of restricted maximum likelihood (REML). DATA AND SOFTWARE AVAILABILITY The accession number for DamID-seq and ChIP-seq reported in this paper is GEO: GSE116954.

e6 Cell Reports 25, 1729–1740.e1–e6, November 13, 2018