A newly isolated strain of Stenotrophomonas sp. hydrolyzes acetamiprid, a synthetic insecticide

A newly isolated strain of Stenotrophomonas sp. hydrolyzes acetamiprid, a synthetic insecticide

Process Biochemistry 47 (2012) 1820–1825 Contents lists available at SciVerse ScienceDirect Process Biochemistry journal homepage: www.elsevier.com/...

645KB Sizes 0 Downloads 6 Views

Process Biochemistry 47 (2012) 1820–1825

Contents lists available at SciVerse ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

A newly isolated strain of Stenotrophomonas sp. hydrolyzes acetamiprid, a synthetic insecticide Hongzhi Tang a,b,∗ , Jian Li a,b , Haiyang Hu a,b , Ping Xu a,b a b

State Key Laboratory of Microbial Metabolism, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 4 April 2012 Received in revised form 8 June 2012 Accepted 11 June 2012 Available online 22 June 2012 Keywords: Acetamiprid Stenotrophomonas Biotransformation Nicotinic acetylcholine receptor

a b s t r a c t Acetamiprid is a chloropyridinyl neonicotinoid that is widely used in agricultural areas, but its contribution to environmental pollution has resulted in its restriction in many countries. Little information is known about whether bacteria can hydrolyze acetamiprid. A bacterial strain that could hydrolyze acetamiprid was newly isolated using enrichment culture techniques. The morphological, biochemical and phylogenetic analysis characterized the isolate as Stenotrophomonas sp. The maximum growth and acetamiprid-degrading ability of the bacterium were observed at 30 ◦ C at pH 7.0, in mineral medium supplemented with 1 g l−1 acetamiprid. A possibly important metabolite, N-methyl-(6chloro-3-pyridyl)-methylamine (ACE-3), was identified based on nuclear magnetic resonance and gas chromatography–mass spectrometry analyses. This paper demonstrates for the first time that a pure bacterium is able to hydrolyze acetamiprid by targeting the magic nitro or cyano substituent groups of the compound. The end product ACE-3 is known to be less toxic to mammals and bees. The hydrolytic mechanism is similar to the metabolic conversion of the compound in mammals and insects. Crown Copyright © 2012 Published by Elsevier Ltd. All rights reserved.

1. Introduction Chloropyridinyl neonicotinoids, the most important new class of synthetic insecticides of the past three decades, play a major role in crop protection [1]. They have binding affinity for and act as agonists of the postsynaptic nicotinic acetylcholine receptor (nAChR), which is a potential target of therapeutic agents for drug abuse and neurological dysfunction. Chloropyridinyl neonicotinoids are selectively toxic to insects but not to mammals, primarily because of this insecticide’s higher affinity for insect, rather than mammalian nAChRs. The single substituent difference between NCN and NH alters the selectivity for insect over mammalian nAChRs [2,3]. Acetamiprid, a chloropyridinyl neonicotinoid, was considered to be a favorable choice for controlling insects. On the basis of its effectiveness and perceived relative environmental safety, acetamiprid was extensively used in agricultural areas. Acetamiprid remains particularly stable, even under submerged conditions, and is not affected by field capacity nor levels of submerged moisture. The half-life values of acetamiprid varied from 15.7 to 17.4 d under a saturated field and 19.2 to 29.8 d under the submerged conditions [4]. The data suggests that aerobic

∗ Corresponding author at: School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China. Tel.: +86 21 34206647; fax: +86 21 34206723. E-mail address: [email protected] (H. Tang).

microbes are more efficient than anerobic microbes at degrading acetamiprid and that microbial degradation is the primary means of acetamiprid breakdown in soil [4,5]. Acetamprid is stable in methanol, acetonitrile and isopropyl alcohol and readily undergoes photolysis in water and acetone. The presence of oxygen and an increase in temperature could significantly enhance the photolysis of the compound [6]. Residual acetamiprid from soil and plants can also affect non-target species such as mammals and honeybees [7,8]. It is important to degrade the residual chloropyridinyl neonicotinoids. The effluents can be subsequently decontaminated using physicochemical treatments or by environmentally friendly biological methods. Microorganisms are known to degrade a variety of carbonaceous substances, including the accumulated pesticides and herbicides found in soil, to derive energy for cellular metabolism [9,10]. Bioremediation utilizes the metabolic versatility of such microorganisms to degrade hazardous pollutants. Stenotrophomonas sp. is widely used for degrading various aromatic and chloroaromatic organic compounds [10,11]. Stenotrophomonas maltophilia CGMCC 1.1788 can hydroxylate neonicotinoids, imidacloprid, and thiacloprid, as well as demethylate acetamiprid, at its key active sites [11]. Acetamiprid metabolism in microorganisms has been studied in Rhodotorula mucilaginosa IM-2, S. maltophilia CGMCC 1.1788, and Pseudomonas sp. FH2 [11–15]. R. mucilaginosa IM-2 can selectively degrade acetamiprid via hydrolysis to form IM1-3 [12]. S. maltophilia CGMCC 1.1788 can demethylate acetamiprid to form IM2-1, according to liquid chromatography/tandem mass spectrometry (LC–MS/MS) and nuclear magnetic

1359-5113/$ – see front matter. Crown Copyright © 2012 Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.procbio.2012.06.008

H. Tang et al. / Process Biochemistry 47 (2012) 1820–1825

resonance (NMR) analyses [14]. Biotransformation of the neonicotinoid pharmacophore moiety has been a particular focus in plant and mammalian systems. However, the metabolic mechanisms involved in degrading neonicotinoid insecticides by pure culture are still not well elucidated. In this study, a Stenotrophomonas sp. strain THZ-XP was isolated and a pathway for the degradation of acetamiprid was proposed. 2. Materials and methods 2.1. Chemicals Acetamiprid (>96% purity) was purchased from Jiangsu Ke Sheng Corporation, China. Acetamiprid (≥99% purity, high-performance liquid chromatography (HPLC) grade) was obtained from Sigma–Aldrich (St. Louis, MO, USA). All other chemicals were of the highest grade that was commercially available. 2.2. Microorganism medium and cultivation Stenotrophomonas sp. THZ-XP was isolated from the runoff sludge of an acetamiprid-producing factory from Jiangshu Province, China, by the enrichment culture techniques described. The bacterium was cultured in a liquid mineral medium containing (in 1 l distilled water), 0.2 g l−1 MgSO4 ·7H2 O, 1 g l−1 acetamiprid, and 0.5 ml of a trace elements solution, with shaking at 200 rpm at 30 ◦ C. The trace elements solution contained (per l of 0.1 mM HCl): 0.05 g CaCl2 ·2H2 O, 0.05 g CuCl2 ·2H2 O, 0.004 g FeSO4 ·7H2 O, 0.008 g MnSO4 ·H2 O, 0.1 g Na2 MoO4 ·2H2 O, 0.05 g Na2 WO4 ·2H2 O, and 0.1 g ZnSO4 . To accelerate degradation and microbial growth, 1 g l−1 yeast extract was added to the acetamiprid-mineral medium. 2.3. Identification of strain THZ-XP Genomic DNA was isolated by using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA). The partial 16S rRNA gene was amplified by polymerase chain reaction (PCR) using the universal primers for the 16S rRNA gene. The oligonucleotide primers used were the forward primer (CCGGATCCAGAGTTTGATCCTGGCTCAG) and the reverse primer (CGGGATCCTACGGCTACCTTGTTACGACT). PCR was performed with Pfu DNA polymerase (Tiangen, Beijing, China) using the following program: 5 min at 94 ◦ C followed by 25 cycles of 30 s at 94 ◦ C, 30 s at 55 ◦ C, and 1 min at 72 ◦ C. Homology searches were performed with the BLAST programs at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/BLAST.html). Phylogenetic trees of different strains were constructed using MEGA 4.1 [16]. The phylogenetic trees were constructed with the neighbor joining (NJ) method. 2.4. Cell growth and acetamiprid degradation To identify the optimal conditions for rapid growth and acetamiprid transformation, the effects of changes in culture temperature, pH, exogenous nitrogen, and the concentration of substrates were investigated. In the experiments regarding pH and culture temperature, respectively, the initial pH was changed from 3 to 11 in increments of 2 while the temperature was maintained at 30 ◦ C. In the experiments regarding culture temperature, cultures were incubated at temperatures of 24 ◦ C, 30 ◦ C, 37 ◦ C, and 42 ◦ C while the pH was fixed at 7.0. To investigate the effects of exogenous nitrogen sources on the activity of acetamiprid degradation, 1 g l−1

1821

acetamiprid was used with exogenous nitrogen of 2 g l−1 NH4 Cl, 2 g l−1 (NH4 )2 SO4 , or 1 g l−1 yeast extract. The bacterial culture was diluted by 10- or 20-fold with deionized water, and the bacterial growth was monitored by measuring the absorbance at 600 nm. The concentration of acetamiprid was determined by HPLC analysis. 2.5. Identification of the metabolite of acetamiprid degradation Cells were harvested in log phase at an OD600 0.8 by centrifugation at 8000 × g for 6 min at 4 ◦ C and then washed three times with 0.05 mM phosphate buffer (pH 7.0). The reaction was performed in a 500 ml flask containing resting cells with a OD600 reading of 5.0 and with 1 g l−1 acetamiprid at 30 ◦ C. After the resting cell reaction, the reaction mixture (1 ml) was evaporated until dry at 50 ◦ C under reduced pressure and was then dissolved in 200 ␮l acetonitrile. The resulting solution was transferred to a vial and dried under a stream of nitrogen. Samples were analyzed using a gas chromatography–mass spectrometry (GC–MS) system (GCD 1800C, HewlettPackard) equipped with a flame ionization detector and a 50 m J&W DB-5MS column (Folsom, CA, USA) at 140 ◦ C. The injection port and detector were set at 260 ◦ C and 280 ◦ C, respectively. The 13 C and 1 H NMR spectra of the biotransformation products were obtained using a Bruker Avance 400 MHz NMR spectrometer (Bruker, Switzerland). 2.6. Analytical techniques During the course of bacterial growth or the resting cell reaction, the aliquots of the culture or cell suspensions, respectively, were sampled and the cells were removed by centrifugation at 6000 × g for 15 min at 4 ◦ C. The supernatants were used for HPLC and thin layer chromatography (TLC) analyses. The TLC plates were developed using chloroform–methanol (20:1). Quantitative data of acetamiprid were obtained by HPLC analysis, comparing the retention times and peak areas with those of known standards. The HPLC analysis was performed on an Agilent 1200 series system equipped with an Eclipse XDB-C18 column (column size, 150 mm × 4.6 mm; particle size, 5 ␮m; Agilent) and a UV detector set at 215 nm. The mobile phase was a mixture of methanol–H2 O (70:30 [v v−1 ]) at a flow rate of 0.5 ml min−1 . 2.7. Nucleotide sequence accession number The nucleotide sequence reported in the present study has been deposited in the NCBI database under accession number HQ857579.

3. Results and discussion 3.1. Identification of the acetamiprid-degrading strain Acetamiprid is an insecticide that was introduced for pest control; it can also affect non-target species, such as honeybees [17,18]. The compound appears to be specifically harmful to the long-term memory of the honeybee [17]. The microbial activity of the soil could affect the technical profile of neonicotinoid insecticides [4,5], therefore, it is necessary to study the transformation of acetamiprid by microbes. A pure bacterial strain capable of degrading acetamiprid was isolated by classical selective enrichment from soil samples, which were obtained from

Fig. 1. (A) Transmission electron micrograph of Stenotrophomonas sp. THZ-XP. (B) Phylogenetic trees of 16S rDNA from different strains using MEGA 4.1. The bootstrap values were directly based on the branches.

1822

H. Tang et al. / Process Biochemistry 47 (2012) 1820–1825

Fig. 2. (A) Cell growth of Stenotrophomonas sp. THZ-XP at different temperatures. (B) Acetamiprid degradation by strain THZ-XP at different temperatures. (C) Cell growth by strain THZ-XP at different pH values. (D) Acetamiprid degradation by strain THZ-XP at different pH values. (E) Cell growth of strain THZ-XP with different initial acetamiprid contents. (F) Acetamiprid degradation by strain THZ-XP with different initial acetamiprid contents.

Jiangshu Province, China. The strain was deposited in the China Center for Type Culture Collection (CCTCC) under accession number CCTCC M2010375. The isolated strain was found to be aerobic, non-spore-forming, Gram-negative, and rod-shaped, and it produced small, circular, and white colonies on nutrient agar plates. The morphological photo of strain Stenotrophomonas sp. THZ-XP is shown in Fig. 1A. Cells of THZ-XP are rod-like with 2 or 3 flagella at one pole and are 0.5 ␮m × 1.5 ␮m in size. For molecular characterization, the 16S rRNA gene was amplified and sequenced. Multiple sequence alignments of the cloned 16S rDNA with the sequences in the NCBI GenBank revealed homology with members of the Stenotrophomonas and Pseudomonas genera. The 16S rRNA gene sequence of the THZ-XP strain exhibited a 99% identity with S. maltophilia ATCC 19861 (NR 040804), and that of the THZ-XP strain showed a 98% 16S rRNA gene identity with Pseudomonas hibiscicola ATCC 19867 (NR 024709.1). The phylogenetic trees as constructed with a neighbor joining (NJ) analysis, and

the bootstrap analysis resulted in relatively high values for the branching of Stenotrophomonas sp. THZ-XP within the S. maltophilia cluster (Fig. 1B). The freshly grown culture tested negative for oxidase and was presumptively identified as Stenotrophomonas sp. (data not shown). On the basis of phenotypic characteristics and phylogenetic relationships, the THZ-XP strain was determined to belong to the genus Stenotrophomonas. The strain was named as Stenotrophomonas sp. THZ-XP. 3.2. Growth of the THZ-XP strain under different conditions Cell growth and acetamiprid degradation by strain Stenotrophomonas sp. THZ-XP were investigated under different culture conditions. The growth of THZ-XP strain was optimal at 30 ◦ C from OD600 0 to 0.5, hindered at 37 ◦ C and 24 ◦ C, and effectively impaired at 42 ◦ C (Fig. 2A). Strain THZ-XP could degrade 1.0 g l−1 acetamiprid at 24 ◦ C, 30 ◦ C, 37 ◦ C and 42 ◦ C in 25 h (Fig. 2B).

H. Tang et al. / Process Biochemistry 47 (2012) 1820–1825

1823

Fig. 3. (A) TLC analysis of the transformation of ACE. (B) HPLC spectrum of ACE metabolism by strain THZ-XP. The peaks with retention times at 4.3 and 5.5 min represent the metabolites ACE-3 and ACE, respectively. (C) The peaks of ACE-3 by GC–MS analysis.

On the basis of these results, 30 ◦ C was identified as the best temperature for Stenotrophomonas sp. THZ-XP to grow and degrade acetamiprid. Strain THZ-XP grew well at different pH conditions (from pH 3 to pH 11), and it could fully transform 1 g l−1 acetamiprid in 26 h (Fig. 2C and D). It grew best with 1 g l−1 acetamiprid from OD600 readings of 0 to approximately 0.5. However, the difference in growth was quite small between acetamiprid concentrations of 1 and 0.5 g l−1 (Fig. 2E). In Fig. 2F, the cultures were supplemented with acetamiprid concentrations of 0.5 and 1 g l−1 , and the THZ-XP strain fully degraded acetamiprid in 14 h. With the other concentrations that were tested, Stenotrophomonas sp. THZ-XP could only partially degrade acetamiprid. Stenotrophomonas sp. THZ-XP exhibited the best growth and had the best degradation efficiency when an acetamiprid concentration of 1 g l−1 was used. Significantly faster growth was observed following the addition of 1 g l−1 yeast extract than was observed following the addition of 2 g l−1 NH4 Cl or 2 g l−1 (NH4 )2 SO4 . With the addition of 1 g l−1 yeast extract, the strain THZ-XP grew from an OD600 of 0 to approximately 0.9 in 12 h. However, with the addition of 2 g l−1 NH4 Cl and 2 g l−1 (NH4 )2 SO4 , the bacterium grew from an OD600 of 0 to approximately 0.1. The THZ-XP strain grew much better with the addition of 1 g l−1 yeast extract (Fig. S1). In addition, the THZ-XP strain could also use glucose (1 g l−1 ) as a carbon source, which yielded the same degrading ability as the cultures lacking additives (Fig. S2). The glucose-supplemented culture could degrade 1 g l−1 (4.5 mmol l−1 ) acetamiprid in 24 h (Fig. S2). However, the yeast R. mucilaginosa IM-2 could only degrade 2 mmol−1 acetamiprid after incubation a minimum of 14 d [12]. The Pseudomonas sp. FH2 strain could grow optimally in an acetamiprid-mineral medium and approximately 53.3% of the original acetamiprid was degraded after incubation for 14 d [15]. It showed that the Stenotrophomonas sp. THZ-XP strain exhibits a high activity for the degradation of acetamiprid.

ACE-3 and ACE, respectively (Fig. 3B). The compound ACE-3 was isolated and biodegraded by the resting cells of strain THZ-XP. However, it was not further degraded by resting cells of the bacterium, suggesting that ACE-3 may be the terminal product during the transformation (Fig. S3). Identification of the key metabolite ACE-3 was supported by the results of the GC–MS and NMR analyses. The GC–MS analysis showed that the ion mass of the metabolite is m/z 155 (M+H). The ion masses of the metabolite fragments are m/z 126 [Cl−C5 H3 N−CH2 ]+ , 113 [Cl−C5 H4 N]+ , 78 [C5 H4 ]+ , and 44 [CH2 −NH−CH3 ]+ (Fig. 3 C). The structure of the purified metabolite was further characterized by NMR. Table 1 lists the data of chemical-shift assignments for the metabolite ACE-3. The 13 C spectrum showed that there are only seven carbon atoms in the compound. According to the analysis, ACE-3 was identified as Nmethyl-(6-chloro-3-pyridyl)-methylamine, which was previously identified in mice and honeybees as IM1-4 [7,8,19]. The “magic nitro” or cyano substituents confers differential selectivity of neonicotinoids for insect versus mammalian nAChRs [7]. The single substituent change of replacing NCN with NH in thiacloprid dramatically alters the selectivity for insect versus mammalian nAChRs [7]. The evaluation of the microbial metabolic pathway is therefore important for elucidating this phenomenon. Dai et al. previously reported the isolation of S. maltophilia CGMCC 1.1788, but the transformation of either the magic nitro group or the cyano group was not implicated [14]. Strain S. maltophilia CGMCC 1.1788 could N-demethylate acetamiprid to form IM21 (Fig. 4) [14]. The nitro or cyano groups of neonicotinoids and the nitrogen atom of the 3-pyridine ring are important for the binding affinity of the insect nAChR. However, the magic nitro or cyano substituent groups are not important for the binding affinity to mammalian nAChR. There have been few reports of microbial

Table 1 13 C NMR and 1 H NMR chemical shift assignments for the generation of ACE-3.

3.3. Conversion of acetamiprid and identification of the metabolite Studies on resting cells of Stenotrophomonas sp. THZ-XP were performed to verify its acetamiprid degradation ability. After 12 h, the initial 1 g l−1 of ACE was broken down completely and the ACE-3 product was concentrated to a maximum, as shown by the TLC and HPLC analyses (Fig. 3A and B). The peaks with retention times of 4.3 min and 5.5 min correspond to the metabolite

Position

13

C2 C3 C4 C5 C6 C7 C8 NH

150 124 130 134 139 48 34 –

C NMR spectrum

1

H NMR spectrum

– 7.8 1 H 7.4 1 H – 8.3 1 H 3.73 2 H 1.9 3 H 3.05 1 H

1824

H. Tang et al. / Process Biochemistry 47 (2012) 1820–1825

Fig. 4. Proposed pathways for ACE degradation by strain Stenotrophomonas sp. THZ-XP, Stenotrophomonas maltophilia CGMCC1.1788, and Rhodotorula mucilaginosa IM-2. Compounds in brackets were not identified.

activity against the magic nitro or cyano substituent groups of acetamiprid. The product ACE-3 is missing the cyano substituent, which might play a role in binding mammalian nAChR. Therefore, the metabolite ACE-3 might be less harmful than ACE to mammals or insects exposed to the soil. While the yeast R. mucilaginosa IM-2 could selectively convert acetamiprid at the position of the cyanoguanidine pharmacophore to form IM1-3, the resulting compound did not exhibit insecticidal activity [12] (Fig. 4). It seems that soil microbes are diverse and complex in the transformation of acetamiprid. The proposed degradation pathway is similar to the metabolic conversion in mammals or insects (Fig. 4) [1,8,19]. Acetamiprid could be metabolized by primary oxidative cleavage of the cyanoimine group to form IM1-3, and IM1-3 could subsequently be N-deacetylated to ACE-3 (IM1-4). This study provides the basic knowledge for insights of the acetamiprid degradation in Stenotrophomonas. Further cloning of the genes involved in the degradation pathway may help us to understand the biochemical mechanism of acetamiprid biotransformation.

4. Conclusion A Stenotrophomonas sp. strain, which was capable of hydrolyzing acetamiprid, was isolated and characterized. A possible key intermediate, N-methyl-(6-chloro-3-pyridyl)-methylamine, was identified, and the proposed pathway is similar to the metabolic conversion of the compound in mammals and insects. Knowledge of the functional architecture, the molecular aspects of the insect and mammalian nAChRs, and the transformation of the cyano substituent group of acetamiprid will lay the foundation for the removal and detoxification of the pesticide from the soil and plants. This study may be of use in developing a new class of safe and effective insecticides.

Acknowledgments This work was supported in part by grants from the Doctoral Fund of the Ministry of Education of China (20090073120065), the Chinese National Natural Science Foundation (30821005 and 30900042), the “Chen Guang” project from the Shanghai Municipal Education Commission and Shanghai Education Development Foundation (10CG10), and the National Basic Research Program of China (2009CB118906). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.procbio.2012.06.008. References [1] Ford KA, Casida JE. Chloropyridinyl neonicotioid insecticides: diverse molecular substituents contribute to facile metabolism in mice. Chem Res Toxicol 2006;19:944–51. [2] Tomizawa M, Casida JE. Selective toxicity of neonicotinoids attributable to specificity of insect and mammalian nicotinic receptors. Annu Rev Entomol 2003;48:339–64. [3] Pandey G, Dorrian SJ, Russell RJ, Oakeshott JG. Biotransformation of the neonicotinoid insecticides imidacloprid and thiamethoxam by Pseudomonas sp. 1G. Biochem Biophys Res Commun 2009;380:710–4. [4] Gupta S, Gajbhiye VT. Persistence of acetamiprid in soil. Bull Environ Contam Toxicol 2007;78:349–52. [5] Liu ZH, Dai YJ, Huang GD, Gu YY, Ni JP, Wei H, et al. Soil microbial degradation of neonicotinoid insecticides imidacloprid, acetamiprid, thiacloprid and imidaclothiz and its effect on the persistence of bioefficacy against horsebean aphid Aphis craccivora Koch after soil application. Pest Manag Sci 2011;67:1245–52. [6] Xie GH, Liu GG, Sun DZ, Zheng LP. Kinetics of acetamiprid photolysis in solution. Bull Environ Contam Toxicol 2009;82:129–32. [7] Tomizawa M, Lee DL, Casida JE. Neonicotinoid insecticides: molecular features conferring selectivity for insect versus mammalian nicotinic receptors. J Agric Food Chem 2000;48:6016–24.

H. Tang et al. / Process Biochemistry 47 (2012) 1820–1825 [8] Brunet JL, Badiou A, Belzunces LP. In vivo metabolic fate of (14 C)-acetamiprid in six biological compartments of the honeybee, Apis mellifera L. Pest Manag Sci 2005;61:742–8. [9] Musarrat J, Bano N, Rao RAK. Isolation and characterization of 2,4dichlorophenoxyacetic acid-catabolizing bacteria and their biodegradation efficiency in soil. World J Microbiol Biotechnol 2000;16:495–7. [10] Dwivedi S, Singh BR, Al-khedhairy AA, Alarifi S, Musarrat J. Isolation and characterization of butachlor-catabolizing bacterial strain Stentrophomonas acidaminiphila JS-1 from siol and assessment of its biodegradation potential. Lett Appl Microbiol 2010;51:54–60. [11] Dai YJ, Zhao YJ, Zhang WJ, Yu CG, Ji WW, Xu WP, et al. Biotransformation of thianicotinyl neonicotinoid insecticides: diverse molecular substituents response to metabolism by bacterium Stenotrophomonas maltophilia CGMCC 1.1788. Bioresour Technol 2010;101:3838–43. [12] Dai YJ, Ji WW, Chen T, Zhang WJ, Liu ZH, Ge F, et al. Metabolism of the neonicotinoid insecticides acetamiprid and thiacloprid by the yeast Rhodotorula mucilaginosa strain IM-2. J Agric Food Chem 2010;58:2419–25. [13] Zhao YJ, Dai YJ, Yu CG, Luo J, Xu WP, Ni JP, et al. Hydroxylation of thiacloprid by bacterium Stenotrophomonas maltophilia CGMCC 1.1788. Biodegradation 2009;20:761–8.

1825

[14] Chen T, Dai YJ, Ding JF, Yuan S, Ni JP. N-demethylation of neonicotinoid insecticide acetamiprid by bacterium Stenotrophomonas maltophilia CGMCC 1.1788. Biodegradation 2008;19:651–8. [15] Yao XH, Min H. Isolation, characterization and phylogenetic analysis of a bacterial strain capable of degrading acetamiprid. J Environ Sci 2006;18: 141–6. [16] Kumar S, Nei M, Dudley J, Tamura K. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 2008;9:299–306. [17] Hassani AKE, Dacher M, Gary V, Lambin M, Gauthier M, Armengaud C. Effects of sublethal doses of acetamiprid and thiamethoxam on the behavior of the honeybee (Apis mellifera). Arch Environ Contam Toxicol 2008;54: 653–61. [18] Wiesner P, Kayser H. Characterization of nicotinic acetylcholine receptors from the insects Aphis craccivora, Myzus persicae, and Locusta migratoria by radioligand binding assays: relation to thiamethoxam action. J Biochem Mol Toxicol 2000;14:221–30. [19] Ford KA, Casida JE. Comparative metabolism and pharmacokinetics of seven neonicotinoid insecticides in spinach. J Agric Food Chem 2008;56: 10168–75.