Aberrant methylation of CDH13 gene in nasopharyngeal carcinoma could serve as a potential diagnostic biomarker

Aberrant methylation of CDH13 gene in nasopharyngeal carcinoma could serve as a potential diagnostic biomarker

Oral Oncology (2007) 43, 82– 87 available at www.sciencedirect.com journal homepage: http://intl.elsevierhealth.com/journals/oron/ Aberrant methyla...

388KB Sizes 0 Downloads 8 Views

Oral Oncology (2007) 43, 82– 87

available at www.sciencedirect.com

journal homepage: http://intl.elsevierhealth.com/journals/oron/

Aberrant methylation of CDH13 gene in nasopharyngeal carcinoma could serve as a potential diagnostic biomarker Di Sun a,1, Zhe Zhang a,b,1, Do Nguyen Van a, Guangwu Huang b, Ingemar Ernberg a, Lifu Hu a,* a b

Microbiology and Tumor Biology Center, Karolinska Institutet, Stockholm S-17177, Sweden Department of Otolaryngology, First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, China

Received 7 January 2006; accepted 13 January 2006 Available online 27 June 2006

KEYWORDS

Summary CDH13 encodes a cell adhesion molecule, H-cadherin. In this study, we examined CDH13 methylation in nasopharyngeal carcinoma (NPC). Methylation specific PCR results showed that CDH13 was methylated in 20% (1/5) NPC cell lines, 100% (2/2) NPC xenografts and 89.7% (52/58) of the NPC primary tumors, while only methylated in 10% (1/10) normal nasopharyngeal epithelia (P < 0.05). CDH13 expression in NPC cell lines and NPC xenografts analyzed by RT-PCR showed that expressions of CDH13 were reversely correlated with their methylation status. In CDH13-silenced cell line, demethylating agent 5-aza-deoxycytidine could dramatically restore CDH13 expression. Taken together, CDH13 promoter is aberrantly methylated in NPC both in vitro and in vivo, and promoter methylation plays a pivotal role in the silencing of H-cadherin expression. Furthermore, the high sensitivity (81%) and specificity (0% false positives) of detecting CDH13 methylation from nasopharyngeal swabs suggest it could be utilized as a tool for early diagnosis. c 2006 Elsevier Ltd. All rights reserved.

CDH13; Nasopharyngeal carcinoma; Methylation

 Introduction

Nasopharyngeal carcinoma (NPC) is one of the most common cancers affecting southern Chinese men. Radiotherapy is rather effective for early stage NPC patients and the sur-

* Corresponding author. Tel.: +46 8 52486285. E-mail address: [email protected] (L. Hu). 1 Authors contribute equally.



vival rate is 50–80%. Early diagnosis is a major factor adversely affecting the effect of treatment.1–3 Finding a biomarker detecting early stage NPC would help greatly in the diagnosis, choice of subsequent therapy and evaluation of survival probability. Much attention has been paid to cadherin adhesion molecules family, since the loss of intercellular adhesion may release individual tumor cell from the tumor mass, which is the first step of invasion and metastasis.4 The cadherins constitute a superfamily of cell surface glycoproteins and

1368-8375/$ - see front matter c 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.oraloncology.2006.01.007

Aberrant methylation of CDH13 in NPC

83 for 3 h at 56 C. High molecular weight genomic DNA was obtained by conventional phenol/chloroform and ethanol extraction.

consist of an extracellular domain, a transmembrane region and a cytoplasmic domain. Through the extracelluar domain, cadherins can specifically interact with other cell adhesion molecules on the surface of neighboring cells. Cadherins can also bind through the cytoplasmic domain to b-catenin or c-catenin which are linked to the actin cytoskeleton via a-catenin and thereby regulate cell mobility, growth and differentiation.5 Loss of E-cadherin expression, the most elaborately studied epithelial cadherin, is a common feature in various types of tumors. While germline mutation and loss of heterozygosity are the main mechanisms that silence E-cadherin in some forms of cancer, such as lobular breast cancer and familiar gastric cancer, 6–8 down regulation of E-cadherin by promoter methylation often occurs in many other types of cancer.9–12 The heart-cadherin (H-cadherin), encoded by CDH13, has also been found to be epigenetically silenced by promoter methylation in many types of tumors, e.g. lung cancer, breast cancer and colorectal cancer.13–16 In this study, we investigated the role of CDH13 methylation in NPC.

The bisulfite modification procedure was slightly modified according to the protocol of Alexander Olek et al.18 In brief, 500 ng of genomic DNA was denatured by incubating in 0.3 M NaOH for 15 min at 37 C, then mixed with two volumes of 2% low melting point agarose. Agarose/DNA mixtures were pipetted into chilled mineral oil to form agarose beads. Each bead was placed in an individual tube to which we added aliquots of 200 ll of 5 M bisulphate solution (2.5 M sodium metabisulphite, Sigma; 100 mM hydroquinone, Sigma; pH5.0). The reaction mixture was then incubated in darkness for 16 h at 50 C. Treatment was stopped by equilibration against 1 ml of TE buffer followed by desulphonation in 500 ll of 0.2 M NaOH. Finally, the beads were washed with 1 ml of H2O, and then used directly in PCRs.

Materials and methods

Bisulfite sequencing

NPC cell lines, NPC tumor specimens, normal nasopharyngeal epithelia and paired NP swabs

Bisulfite treated DNA was subjected to PCR with primers flanking the targeted methylation-specific PCR regions. The sequences of forward and reverse primers (BISEQ-F and BISEQ-R) are listed in Table 1. PCR products were purified using QIA quick Gel Extraction Kit (Qiagen, Chatsworth, CA). The purified PCR product was cloned using TA Cloning Kit (Invitrogen Corporation, Carlsbad, CA) following the manufacturer’s recommendations. Five clones were sequenced using M13 R primer with an ABI3100 DNA sequencer and a Big Dye Terminator v 3.0 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). The completion of bisulfite conversion was confirmed by the presence of substituted thymine for all cytosine residues at non-CpG sites.

CNE1, CNE2, TW03, C666-1, HONE1 NPC cell lines were cultured under the conditions specified. Xenografts, C15 and C17, were kind gifts from Dr. P. Busson, Institute Gustave Roussy, Paris.17 Fifty-eight NPC biopsies from pathologyverified NPC patients and ten normal nasopharyngeal epithelia from volunteers were obtained at First Affiliated Hospital of Guangxi Medical University (ethical approval: no. 00-312 Stockholm, Sweden and local committee in China). The paired NP swabs from 47 cases of 58 NPC patients and from 10 normal volunteers were collected under surface anesthesia with 1% cocaine solution. Cell pellets were stored in 400 ll TE buffer at 80 C until further use.

Bisulfite modification

Methylation specific PCR (MSP) DNA extraction and purification Homogenized biopsy tissues and swab cell pellets were treated with 50 lg/ml proteinase K (Invitrogen, Carlsbad, CA)

Table 1

Summary of the primers used in the present study

Primers

Sequences 0

RT-PCR-forward RT-PCR-reverse GAPDH-forward GAPDH-reverse MSP-forward MSP-reverse USP-forward USP-reverse BISEQ-forward BISEQ-reverse a

The sequences of PCR primers specific for methylated and unmethylated alleles of CDH13 and the sizes of expected PCR products are summarized in Table 1. For PCR reaction,

See reference

Product size 0

5 TTCAGCAGAAAGTGTTCCATAT 3 50 GTGCATGGACGAACAGAGT 30 50 CATGGGGTGTGAACCATGAGA 30 50 GTCTTCTGGGTGGCAGTGAT 30 50 TCGCGGGGTTCGTTTTTCGC 30 50 GACGTTTTCATTCATACACGCG 30 50 TTGTGGGGTTTGTTTTTTGT 30 50 AACATTTTCATTCATACACACA 30 50 TTGGAAAAGTGGAATTAGTTGG 30 5’ CCTCTTCCCTACCTAAAACA 30 13

.

203 bp

a

Annealing temperature (C) 55

166 bp

55

243 bpa

60

242 bpa

52

403 bpa

55

84 2 ll of bisulfite-modified DNA was added in a final volume of 25 ll of PCR mixture containing 1 · PCR buffer, 1.5 mM MgCl2, 100 pmol deoxynucleotide triphosphates, primers (100 pmol each per reaction) and one unit of AmpiTaq Gold (Applied Biosystems, Branchburg, NJ). PCR amplifications were performed at 95 C for 10 min, then followed by 34 cycles at 94 C for 30 s, specific annealing temperature for 45 s, and 72 C for 90 s. MSP products were analyzed by 2% agarose gel electrophoresis stained with ethidium bromide.

Reverse transcription-PCR Total RNA was extracted from NPC cell lines with TRIzol reagent (Invitrogen Corporation, Carlsbad, CA). The first strand of cDNAs was synthesized from 1 lg of total RNA with AMV reverse transcriptase (Invitrogen Corporation, Carlsbad, CA) following the manufacturer’s instructions. PCR reactions were prepared in a final volume of 25 ll of PCR mixture containing 1 · PCR buffer, 1.5 mM MgCl2, 100 pmol deoxynucleotide triphosphates, 100 pmol primers and 1 unit of AmpiTaq Gold (Applied Biosystems, Branchburg, NJ). PCR cycles were performed at 95 C for 10 min, and then follow by 34 cycles at 94 C for 30 s, at the specific annealing temperature for 45 s, and then at 72 C for 90 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification from the same cDNA samples served as internal controls. The sequences of PCR primers for CDH13 and GAPDH expression are summarized in Table 1.

5-Aza-dc treatment Cells (2 · 105) were seeded in a 6-well plate and cultured for 24 h, then incubated for 4 days with 10 lM 5-aza-dc. Both medium and drug were replaced every 24 h.

Statistical analysis All of the statistical analyses were performed with the statistical package SPSS11.5 (SPSS Inc Chicago, IL). Associations of clinical parameters were analyzed by Pearson ChiSquare test or Fisher’s exact test.

Results CDH13 gene expression was silenced in the C666-1 cell lines and xenografts C15 and C17 CDH13 expression was examined in five NPC cell lines (CNE1, CNE2, TW03, HONE1, C666-1), two xenografts (C15 and C17) and two normal nasopharyngeal epithelia by RT-PCR. In the C666-1 cell line and xenografts C15, C17, the expression of CDH13 is undetectable, while in normal nasopharyngeal epithelia and the other four cell lines CDH13 was expressed at the RNA level (Fig. 1). Exploring methylation of the promoter by MSP, we found that only methylation bands could be detected in C666-1 cell line and xenografts C15 and C17. While only unmethylation band could be detected in CNE2 and normal nasopharyngeal epithelia. Methylation was partial in CNE1, TW03 and HONE1 cell lines in that bands corresponding to both methylation and unmethylation could be detected.

D. Sun et al.

Figure 1 Detection of CDH13 expression in NPC cell lines, xenografts and normal nasopharyngeal epithelia (NNE) by RTPCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was used as internal control and water was included as blank control. Methylation specific PCR (MSP) was used to analyze CDH13 promoter methylation in NPC cell lines, xenografts and NNE. u: PCR by primers which specifically amplify unmethylated allele. m: PCR by primers which specifically amplify methylated allele.

Figure 2 Re-expression of CDH13 in C666-1 cell line after 5aza-dC treatment. GAPDH was amplified to show the integrity of the RNA. Normal nasopharyngeal epithelium (NNE) was used as positive control. Water was included as blank control.

5-Aza-dC restored CDH13 expression in NPC cell line In CDH13 expression silenced NPC cell line C666-1, CDH13 expression was restored by treatment with 10 lM of the demethylation reagent 5-aza-dC at 96 h as seen by RT-PCR (Fig. 2).

Detailed pattern of CpG methylation in the CDH13 promoter in NPC cell lines, NPC biopsies and normal nasopharyngeal epithelia The detailed methylation status of CDH13 promoter region (355 to +57 bp relative to the ATG translation initiation site) was investigated by bisulfite sequencing in three NPC cell lines (CNE2 TW03, C666-1), xenograft C15, two NPC biopsies (NPC1 and NPC2) and two normal nasopharyngeal epithelia (NNE1 and NNE2). Twenty-four CpG sites were included in this region. All 24 CpG sites were heavily methylated in the CDH13 expression silenced cell line C666-1 and xenograft NPC tumor C15 compared to CDH13 expressing cell lines CNE2 and TW03 (Fig. 3). In two NPC biopsies, CDH13 promoter was partially methylated, in contrast to two normal nasopharyngeal epithelia, which were totally free of methylation. The bisulfite sequencing results demonstrate that our bisulfite treatment of the DNA was complete and the MSP results were reproducible.

Methylation frequency of CDH 13 among NPC biopsies and normal nasopharyngeal epithelia The methylation status of CDH13 gene was examined by MSP in 58 NPC biopsies and 10 normal nasopharyngeal epithelia.

Aberrant methylation of CDH13 in NPC

85

Figure 3 Methylation status in CDH13 promoter: (A) a scheme of the CDH13 promoter region. 24 CpG sites within the CDH13 gene promoter were included for analysis by bisulfite sequencing. Vertical lines indicate the relative locations of CpG sites to the translation initiation site ATG, which was indicated as ‘‘+1’’. The sequences underlined by solid bars show the location of primers for MSP and (B) methylation status of 24 CpG sites within the CDH13 gene promoter was analyzed by bisulfite sequencing PCR. The PCR products were subsequently subcloned into sequencing vector and five clones were sequenced for each sample. Open and filled circles represent unmethylated and methylated CpG sites respectively. Circles were partially filled according to the percentage of methylation of the CpG site represented.

CDH13 was methylated in 52 of 58 (89.7%) NPC biopsies (Fig. 4). In contrast, only one of 10 normal nasopharyngeal epithelia was partially methylated, while the other nine were unmethylated (p < 0.05).

to the 100% incidence of the paired biopsies. Methylation was not detected in swab samples whose corresponding biopsies were CDH13-unmethylated (100%) (Fig. 4). No methylation was detected in swabs from 10 normal controls.

Detection of CDH13 methylation from NP swabs

Discussion

We further explored the feasibility of detecting CDH13 methylation in 47 paired nasopharyngeal swabs from NPC patients. NP swabs from normal volunteers were also included as control. If the results from corresponding NPC biopsies were a guide, one would have expected 42 cases out of 47 NPC swabs to be CDH13-methylated. However, 34 cases of these 42 methylated cases were found to be methylated in NP swabs. Thus the concurrent detection rate is 81% in contrast

Ectopic expression of CDH13 in breast cancer cell lines was capable of inhibiting tumor growth in nude mice, suggesting that CDH13 may act as a tumor suppressor gene. 19 In this study, we found that CDH13 expression correlated with promoter methylation both in cell lines and biopsies. In CDH13 expression-silenced cell line C666-1, its expression could be dramatically restored by demethylation with 5-aza-dC, inferring that DNA methylation is a major regulator of CDH13 expression. In NPC biopsies, there is a strikingly high frequency of CDH13 methylation (89.7%), while only one of the 10 (10%) normal nasopharyngeal epithelia detected is methylated (P < 0.05). This suggests that CDH13 is a common target for methylation and epigenetic gene silencing in NPC. The MSP primers we used cover the most frequently methylated CpG sites in other tumor types. We also confirmed this for NPC by bisulfite sequencing. Since CDH13 could convert the breast cancer cells from an invasive morphology to a normal-like morphology, 19 we explored whether CDH13 methylation status correlated with NPC metastasis features. However, we failed to see such a correlation with the TNM stages according to UICC in our samples (Table 2). CDH13 may have a role early in the pathogenesis of NPC, which would be consistent with the studies in colorectal cancer and adenomas which have shown that CDH13 methylation occurs at an early stage in the multistage tumorgenic process. 13 A lack of correlation of CDH13 methylation with metastasis in NPC in vivo is not

Figure 4 Analysis of CDH13 promoter region in NPC tumor biopsies by methylation-specific PCR, compared with paired swab and normal nasopharyngeal epithelia. In vitro methylated DNA was used as methylation positive control (MPC) and water was included as blank control. m: methylated alleles; u: unmethylated alleles.

86

D. Sun et al.

Table 2

Association between CDH13 methylation and clinicopathological parameters of NPC CDH13 methylation

Sex Male Female Age <60 P 60 T gradeb 1, 2 3, 4 N stageb 0 1, 2, 3, 4 Stageb I, II III, IV Histology Keratinizing squamous cell carcinoma Non-keratinizing carcinoma a b

Total no.

Positive

Negative

40 18

90.0% (36/40) 88.9% (16/18)

10.0% (4/40) 11.1% (2/18)

48 10

89.6% (43/48) 90.0% (9/10)

10.4% (5/48) 10.0% (1/10)

36 22

91.7% (33/36) 86.6% (19/22)

8.3% (3/36) 13.6% (3/22)

18 40

83.3% (15/18) 92.5% (37/40)

16.7% (3/18) 7.5% (3/40)

17 41

82.4% (14/17) 92.7% (38/41)

17.6% (3/17) 7.3% (3/41)

4 54

75% (3/4) 90.7% (49/54)

25% (1/4) 9.3% (5/54)

P valuea 1.00

1.00

0.66

0.36

0.35

0.36

Comparisons were made by Pearson Chi-square test or Fisher’s exact test (SPSS 11.5). Staging according to International Union Against Cancer (UICC).

paradoxical, since tumor metastasis in vivo is a complicated process and many genes functioning in diverse pathways are involved. Single gene may contribute only partially to the final step of metastasis. Detection of molecular alterations in body fluids of cancer patients is more and more used for early detection and diagnosis, e.g. detection of bladder cancer from urine, lung cancer by sputum or ovarian cancer by peritoneal fluid.20–22 Detection of tumor DNA from peripheral circulation and mouth washing fluids is not very sensitive according to our own experiments and reports from some other group.23 Nasopharyngeal swabs take the advantage of NPC as a surface mucosal tumor and its tangible location. Tumor cells can be released from the tumor mass more easily than normal epithelial cells, especially when the cell–cell adhesion is subverted. MSP is a powerful technique and could detect two copies of methylated alleles against the background of unmethylated alleles. MSP’s sensitivity further improved when combined with our modified protocol of Alexander Olek’s bisulfite treatment.18 The specificity of detecting CDH13 methylation from NP swabs was 81% and the rate of false positives was 0%. Such a high correlation of detecting CDH13 promoter methylation when comparing primary tumors and paired NP swabs further confirmed that NP swabs could be used to assist the detection and diagnosis of NPC.

Acknowledgements This study was supported by grants from Cancerfonden, Cancerfo ¨reningen i Stockholm, SIDA, STINT, SSMF and Karolinska Institutet.

References 1. Baker SR. Nasopharyngeal carcinoma: clinical course and results of therapy. Head Neck Surg 1980;3(1):8–14. 2. Sanguineti G, Geara FB, Garden AS, et al. Carcinoma of the nasopharynx treated by radiotherapy alone: determinants of local and regional control. Int J Radiat Oncol Biol Phys 1997;37(5):985–96. 3. Bailet JW, Mark RJ, Abemayor E, et al. Nasopharyngeal carcinoma: treatment results with primary radiation therapy. Laryngoscope 1992;102(9):965–72. 4. Goodsell DS. The molecular perspective: cadherin. Stem Cells 2002;20(6):583–4. 5. Conacci SM, Zhurinsky J, Ben ZA. The cadherin–catenin adhesion system in signaling and cancer. J Clin Invest 2002;109(8):987–91. 6. Berx G, Cleton AM, Nollet F, et al. E-cadherin is a tumor/ invasion suppressor gene mutated in human lobular breast cancers. EMBO J 1995;14(24):6107–15. 7. Suriano G, Oliveira C, Ferreira P, et al. Identification of CDH1 germline missense mutations associated with functional inactivation of the E-cadherin protein in young gastric cancer probands. Hum Mole Genet 2003;12(5):575–82. 8. Becker KF, Atkinson MJ, Reich U, et al. E-cadherin gene mutations provide clues to diffuse type gastric carcinomas. Cancer Res 1994;54(14):3845–52. 9. Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinomas. Proc Natl Acad Sci USA 1995;92(16):7416–9. 10. Saito Y, Takazawa H, Uzawa K, Tanzawa H, Sato K. Reduced expression of E-cadherin in oral squamous cell carcinoma: relationship with DNA methylation of 50 CpG island. Int J Oncol 1998;12(2):293–8. 11. Nojima D, Nakajima K, Li LC, et al. CpG methylation of promoter region inactivates E-cadherin gene in renal cell carcinoma. Mol Carcinog 2001;32(1):19–27.

Aberrant methylation of CDH13 in NPC 12. Machado JC, Oliveira C, Carvalho R, et al. E-cadherin gene (CDH1) promoter methylation as the second hit in sporadic diffuse gastric carcinoma. Oncogene 2001;20(12):1525–8. 13. Toyooka S, Toyooka KO, Harada K, et al. Aberrant methylation of the CDH13 (H-cadherin) promoter region in colorectal cancers and adenomas. Cancer Res 2002;62(12):3382–6. 14. Roman GJ, Castillejo JA, Jimenez A, et al. Cadherin-13, a mediator of calcium-dependent cell–cell adhesion, is silenced by methylation in chronic myeloid leukemia and correlates with pretreatment risk profile and cytogenetic response to interferon alfa. J Clin Oncol 2003;21(8):1472–9. 15. Sato M, Mori Y, Sakurada A, Fujimura S, Horii A. The H-cadherin (CDH13) gene is inactivated in human lung cancer. Human Genet 1998;103(1):96–101. 16. Toyooka KO, Toyooka S, Virmani AK, et al. Loss of expression and aberrant methylation of the CDH13 (H-cadherin) gene in breast and lung carcinomas. Cancer Res 2001;61(11): 4556–60. 17. Busson P, Ganem G, Flores P, et al. Establishment and characterization of three transplantable EBV-containing nasopharyngeal carcinomas. Int J Cancer 1988;42(4):599–606.

87 18. Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res 1996;24(24):5064–6. 19. Lee SW. H-cadherin, a novel cadherin with growth inhibitory functions and diminished expression in human breast cancer. Nat Med 1996;2(7):776–82. 20. Steven AB, William AP, Frank DG, et al. Aberrant promoter methylation in bronchial epithelium and sputum from current and former smokers. Cancer Res 2002;62(8):2370–7. 21. Cairns P, Esteller M, Herman JG, et al. Molecular detection of prostate cancer in urine by GSTP1 hypermethylation. Clin Cancer Res 2001;7(9):2727–30. 22. Hickey KP, Boyle KP, Jepps HM, Andrew AC, Buxton EJ, Burns PA. Molecular detection of tumour DNA in serum and peritoneal fluid from ovarian cancer patients. Br J Cancer 1999;80(11):1803–8. 23. Hsiao WC, Amy C, Dora LWK, William IW, Jonathan STS, Anthony PWY. Evaluation of hypermethylated tumor suppressor genes as tumor markers in mouth and throat rinsing fluid, nasopharyngeal swab and peripheral blood of nasopharyngeal carcinoma patient. Int J Cancer 2003;105(6):851–5.