Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxia-induced apoptosis by modulating oxidative stress

Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxia-induced apoptosis by modulating oxidative stress

Biochemical and Biophysical Research Communications xxx (2018) 1e7 Contents lists available at ScienceDirect Biochemical and Biophysical Research Co...

1MB Sizes 0 Downloads 0 Views

Biochemical and Biophysical Research Communications xxx (2018) 1e7

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxia-induced apoptosis by modulating oxidative stress Yousef Faridvand a, b, c, Samira Nozari b, d, Simin Atashkhoei e, Mohammad Nouri a, b, **, Ahmadreza Jodati b, f, * a

Department of Biochemistry and Clinical Laboratories, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran Stem Cell and Regenerative Medicine (SCARM), Tabriz University of Medical Sciences, Tabriz, Iran Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran d Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran e Professor of Anesthesiology, Al-Zahra Hospital, Tabriz University of Medical Sciences, Tabriz, Iran f Cardiovascular Research Center, Tabriz University of Medical Sciences, Tabriz, Iran b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 July 2018 Accepted 9 July 2018 Available online xxx

Protection of the cardiac cell against hypoxia-induced cell damage is one of the main approaches to preventing cardiovascular disease. Earlier studies have shown the cardioprotective effect of the human Amniotic Membrane (hAM) in animal model of cardiac injury. However, the effect of Amniotic Membrane Proteins (AMPs), extracted from hAM, on myocardial hypoxia injury remains unclear. So, our study aimed to investigate the protective effect of AMPs against hypoxia-induced cardiomyocytes apoptosis. H9c2 cardiomyocytes were pre-treated with AMPs followed by 24 h in hypoxia condition. Cell viability and apoptotic induction were detected by MTT and PI staining assay. Furthermore, the reactive oxygen species (ROS) generation, caspase-3 activity and malondialdehyde (MDA) were measured using the relevant kits. Moreover, apoptosis associated molecules and NF-kB p65 subunit, the master regulator of inflammation; expression was measured by western blotting. Our results indicated that AMPs increased the cellular viability of H9c2 cells during hypoxia and attenuated apoptotic induction. AMPs reduced hypoxia-induced ROS generation and as indicated by decreased MDA content. Moreover, AMPs decreased Bax/Bcl-2 ratios followed by reduction the caspase-3 activity; and further repressed the phosphorylated NF-kB p65. Altogether, suggesting that AMPs offers cardioprotective effects to H9c2 cell in hypoxia condition by modulating the gene involved in apoptosis and reducing oxidative stress and inflammatory response. © 2018 Elsevier Inc. All rights reserved.

Keywords: Amniotic Membrane Proteins Apoptosis Hypoxia Oxidative stress H9c2 cardiomyoblasts

1. Introduction Protecting the heart cells and controlling the pathway associated with heart damage are one of the main strategies to treat cardiovascular disease. Hypoxia is known as major problems in the treatment of ischemic heart disease. Studies have indicated that ischemic disease has adverse effects on myocardial cells [1,2]. A number of studies have shown that the mitochondrial dysfunction

* Corresponding author. Cardiovascular Research Center, Tabriz University of Medical Sciences, Tabriz, Iran. ** Corresponding author. Stem Cell and Regenerative Medicine (SCARM), Tabriz University of Medical Sciences, Tabriz, Iran. E-mail addresses: [email protected] (M. Nouri), [email protected] (A. Jodati).

is associated with the intrinsic pathway of apoptosis under hypoxic condition in H9c2 cells [3,4]. Thus, focusing on a pathway to inhibit apoptosis is a promising therapeutic target for hypoxia injury. Furthermore, it has been revealed that hypoxia mediated inflammation and induced cardiomyocytes death through modulation of nuclear factor kappa B (NF-kB) p65 subunit. So, regulation of inflammatory response plays an important role against hypoxiainduced cardiomyocytes damage [5]. The human Amniotic Membrane (hAM), also known as amnion, is identified as the inner layer of the fetal surrounding the amniotic fluid. For a long time, the amniotic membrane patches have been applied as a propitious source to heal infections, as well as burning and ophthalmological disorders. Studies have demonstrated the immunomodulatory, anti-inflammatory, anti-fibrotic and antitumorigenic characteristics of this layer [6]. More studies are

https://doi.org/10.1016/j.bbrc.2018.07.045 0006-291X/© 2018 Elsevier Inc. All rights reserved.

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

2

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

conducted on stem cell repair of cardiac cells, leading to significant progress in this field. Additionally, in the applied regenerative medicine, studies have proven the stem cell characteristics of epithelial cells in amniotic membrane. The studies have revealed the high expression of the OCT4 gene by the cells derived from the hAM [7,8]. However, the differentiation potential of cell derived from the hAM into the cells of cardiomyocytes is not completely clear [9]. Furthermore, Vojdani et al. showed that the amniotic membrane extracts exerted the proliferative effects on the human umbilical cord blood cells [10]. Ventura et al. reported that applying amniotic membrane-derived cell into the left ventricular of the infarcted area had improved cardiac performance [11]. Experimental studies on hAM have indicated the expression of growth factor mRNA and protein such as keratinocyte growth factor (KGF), epithelial growth factor (EGF), hepatocyte growth factor (HGF), and basic-fibroblast growth factor (bFGF) by hAM cells [12]. The secretion and presence of growth factor can be effective in repairing cardiomyocyte cells by involving the induction of cardioprotective pathway [13]. Considering the ability of hAM for regeneration and repair, we aimed to underline the molecular mechanisms of anti-apoptotic and anti-inflammatory response regulation of Amniotic Membrane Proteins (AMPs) in hypoxicinduced cardiomyocytes dysfunction. Therefore, we assessed the hypothesis that AMPs could protect H9c2 cells against hypoxiainduced cardiomyocytes injury. 2. Materials and methods 2.1. Preparation and extraction of AMPs hAM was obtained from selected 9 healthy women at the time of cesarean sections. All women filled the written consent before the study was performed according to the guidelines of the Ethical Committee of Tabriz University of Medical Sciences. For proteins extraction, hAM was minced and homogenized and one part of the homogenate was prepared in NP40 (50 mM Tris-HCl, 150 mM NaCl, 1% NP-40 and 5 mM EDTA, pH 8.0) cell-lysis buffer supplemented with complete protease inhibitor and the other part was prepared in PBS. Then, the samples were sonicated on ice and finally centrifuged at 14 000 g for 30 min at 4  C. The supernatant was collected and filtered through a 0.22-mm filter for sterilization. The proteins quantification was measured by NanoDrop (ND-1000 Spectrophotometer, USA). 2.2. Cell culture and viability assay The cardiomyocyte cell lines, H9c2, purchased from the Cell Bank of the Pasteur Institute of Iran (Tehran, Iran) and were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum, and 1% penicillin/streptomycin. Cells were grown at 37  C in a humidified atmosphere incubator with 95% air and 5% CO2. For cell viability, H9c2 cells at a density of 104 cells/well were pre-treated with AMPs at the concentrations (0, 100, 250, 500, 1000, 1500 and 2000 mg/ml) for 2 h, followed by hypoxia exposure in incubator with 2% O2 and 5% CO2 for 24 h. Control cells were cultured for 24 h in normoxic condition. Cells viability was then quantified by adding MTT solution (0.5 mg/ml in medium) for 3 h. Finally, the DMSO solution was added and absorbance was detected at 570 nm with a microplate reader (Model 550, Bio-Rad Laboratories, Inc).

dark. Then, the ROS levels of fluorescence intensity was determined by using of a flow cytometer (FACScan, Becton Dickinson, USA) at 488 nm excitation and 525 nm emission wavelength. The MDA levels were measurement according to the manufacturer's protocol of colorimetric assay kit (Cayman Chemicals, Ann Arbor, MI, USA). 2.4. Apoptosis and caspase-3 activity assay PI staining was used for detection of apoptotic cells which is represented as a sub-G1 peak in flow cytometry histogram. Briefly, cells were cultured in a 6-well plate and then treated with AMPs for 24 h under hypoxia. After treatment, cells were harvested and incubated in 500 ml of PI-Hypotonic Lysis Buffer (50 mg/ml PI in 0.1% sodium citrate with 100 mg/ml RNase and 0.1% Triton X-100) at 4  C in the dark. Also, the activity of capasee-3 was measured by the colorimetric method according to the manufacturer's instructions (Sigma-Aldrich). So, capasee-3 substrate (Acetyl-Asp-Glu-Val-Asp p-nitroanilide) was added to the 50 ml of the cell lysate (50 mg total protein) in each well, and absorbance was measured at 405 nm. 2.5. RNA extraction and quantitative real-time PCR (qRT-PCR) Total RNA was isolated by RNAX-Plus solution kit (Cinnagen, Tehran, Iran). Then, RNA samples were put in a PCR instrument and reverse transcribed to cDNA using a Revert Aid TM first strand synthesis kit (Thermo Fisher Scientific, Vilnius, Lietuva) and cDNA was quantified on a LightCycler® 96 real-time PCR detection system (Roche Molecular Systems, Inc) using an SYBR Green PCR Master Mix (Yekta Tajhiz, Tehran, Iran). Data were analyzed by 2 D Ct method. The following shows the sequence of primers used for the Q-PCR: Bax forward 50 - CCACCAGCTCTGAACAGATCA-30 , reverse 50 - GCTCCATGTTGTTGTCCAGT -3; Bcl-2 forward 50 - ATAACCGGGAGATCGTGATGA-30 , reverse 50 - CTCTCAGGCTGGAAGGAGAAG-3; b-actin forward 50 - TGACAGGATGCAGAAGGAGA -3 reverse 5– TAGAGCCACCAATCCACACA 3.

2.6. Protein preparation and western blotting H9c2 cells were lysed with NP-40 lysis buffer containing protease inhibitor on ice for 30 min with every 10 min vortexing, and centrifuged at 13 000  g for 30 min. The supernatant was collected and protein concentration was measured with the PicoDrop (ND1000 Spectrophotometer, USA). Proteins were separated by 12% sodium dodecyl sulfate (SDS)epolyacrylamide gel electrophoresis and transferred onto PVDF membranes (Millipore, Billerica, MA, USA), blocked by 5% nonfat dry milk/TBS-T for 1 h at room temperature. Then, PVDF membranes incubation with primary antibodies, GAPDH, Bax and Bcl-2 (Santa Cruz Biotechnology) and P65, p-P65 (Sigma-Aldrich, St. Louis, MO, USA) were performed overnight at 4  C. The membrane was then washed and incubated with secondary HRP-conjugated antibodies (Santa Cruz Biotechnology) for 2 h at room temperature. Flowing detection by ECL Western detection reagent (Thermo Fisher Scientific, USA) blots were exposed to a Kodak X-ray film for 5e20 s and developed by standard processing solution. 2.7. Statistical analysis

2.3. Detection of ROS and MDA level After treatment, cells were incubated with 10 mM of 20 , 70 dichlorofluorescein diacetate (DCFH-DA) for 30 min at 37  C in the

GraphPad Prism 5.01 (GraphPad Software) was used to analyze data. The statistical parametric tests were performed using an unpaired two-tailed t-test or one-way analysis of variance (ANOVA)

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

3

Fig. 1. Effect of prepared AMPs in cell-lysis buffer and PBS on H9c2 cells viability. (A) H9c2 cells were treated variable concentrations of AMPs for 24 h without hypoxia. (B) Pretreatment of H9c2 cells with a variable concentration of AMPs in hypoxia condition for 24 h. Data are the mean ± SEM (n ¼ 3). (*p < 0.05, ***p < 0.001 vs. normoxia; ##p < 0.01, ###p < 0.001 vs. hypoxia).

for normal distribution of variables. On the other hand, KruskaleWallis nonparametric test was used followed by post hoc Tukey's HSD test for multiple comparisons. Data are presented as

mean ± SEM significant.

(n ¼ 3).

P < 0.05

was

considered

statistically

Fig. 2. AMPs reduce hypoxia-induced intracellular ROS levels in H9c2 cells after 24 h. (A) The intracellular ROS production was measured by a fluorescent dye DCFH-DA after 24 h of exposure to 1 mg/ml of AMPs concentrations and hypoxia by photofluorography. (B) Bar graphs showing Quantitative analysis of cell percentage of DCFH-DA uptake of ROS among groups for 24 h (C) representative flow cytometry histogram showing the intensity of DCFH-DA signals. (D) MDA concentration among the group. Data are the mean ± SEM (n ¼ 3). (*P < 0.05, ***P < 0.001 vs. normoxia; ## P < 0.01, ###P < 0.001 vs. hypoxia).

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

4

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

3. Results 3.1. Effect of AMPs on cell viability The results showed that AMPs elevated the cell viability of H9c2 cells in a concentration of 1 mg/ml of AMPs prepared in PBS (P < 0.05; Fig. 1A). Moreover, no cytoprotective effect was observed in higher concentration of AMPs that was prepared by cell-lysis buffer and PBS. In hypoxia condition, pretreatment with AMPs prepared in PBS showed the statistically significant difference in cell viability as compared with the hypoxia group (P < 0.001; Fig. 1B). However, a significant increase in the cell viability of cardiomyocytes was observed in hemogenate of AMPs preraped in cell-lysis compared with the hypoxia group (P < 0.01; Fig. 1). Nevertheless, based on this results, 1 mg/ml of AMPs prepared in PBS was used for following experiments to exclude detergents that could affect the results of study. 3.2. Inhibition of ROS generation and MDA content As shown in Fig. 2, the exposure of H9c2 cells with hypoxia resulted in a significant increase in the level of ROS in H9c2 cells. Cell images by DCFH-DA indicated the increased fluorescence intensity in hypoxia group (P < 0.001, Fig. 2). Flow cytometry analysis showed that ROS level (DCF fluorescence) was increased in hypoxia group by 41.17% as compared with normoxia group (18.23 ± 2.46% % of normoxia, p < 0.001). The extract was able to decrease intracellular ROS level to 30.83 ± 2.46% in hypoxia pretreatment group as compared to the hypoxia group (p < 0.001). The pretreatment control group showed the reduction in ROS level by 13.33% as compared with normoxia group (p < 0.05; Fig. 2). Lipid peroxidation levels were assessed by determining of MDA level, which is known as the end product of lipid peroxidation. Results showed that exposing to hypoxia resulted in a significant increase of MDA

level in H9c2 cells (12.67 ± 3.2) as compared to control (3.14 ± 0.75) cells cultured in the normoxia (p < 0.001). However, the value of MDA levels was considerably diminished by 2-fold in the cells pretreated with 1 mg/ml of AMPs (6.18 ± 0.92, p < 0.01; Fig. 2). 3.3. Effects of AMPs on cell apoptosis The apoptotic cells ratio in H9c2 cell lines was measured by flow cytometry using PI staining. The subG1 peak (reliable markers of apoptosis) analysis in flow cytometry histograms revealed that hypoxia-induced an increase in a sub-G1 peak in flow cytometry histogram. Pretreatment by AMPs caused a significant reduction in cell death ratio compared to the hypoxia (Fig. 3). 3.4. Effects of AMPs on Bax and Bcl-2 expression and NF-kB p65 phosphorylation To examine anti-apoptosis and anti-inflammatory effects on H9c2 cells under hypoxia we assessed Bax and Bcl-2 with NF-kB p65 and NF-kB p65 phosphorylation expression levels. The results indicated that hypoxia increased mRNA and protein expression of Bax by decreasing the protein and mRNA expression of Bcl-2. Meanwhile, Pretreatment of H9c2 with AMPs down-regulated the expression of Bax and up-regulated the Bcl-2 expression as compared with hypoxia (Fig. 4A and C). Hypoxia-induced elevations in levels of phosphorylated NF-kB p65 were also obviated by pre-treated AMPs. (Fig. 4A and B). As Comparing with the normoxia group, hypoxia caused the significantly elevated the Bax/Bcl-2 ratio and the activity of caspase-3. However, AMPs significantly decreased the Bax/Bcl-2 ratio and the activity of caspase-3, respectively (Fig. 4B and D). These results indicated that AMPs protects the H9c2 cell against hypoxia via anti-apoptosis and antiinflammatory effects.

Fig. 3. AMPs exhibited an anti-apoptotic effect on the H9c2 cell. The effect of the AMPs on apoptosis in H9c2 cells using PI staining and flow cytometry under hypoxia condition. Data are the mean ± SEM (n ¼ 3) (**P < 0.01, ***P < 0.001 vs. normoxia; ##P < 0.01 vs. hypoxia).

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

5

Fig. 4. AMPs inhibited hypoxia-induced apoptosis of H9c2 cells. (A) Bax and Bcl-2 mRNA expression. (B) Western blotting image and Bax/Bcl-2 ratio in the pretreatment of H9c2 cells for 24 h. (C) Effects of AMPs on caspase3 activity under hypoxia condition. Caspase3 activity of H9c2 cells was measured after treatment with AMPs for 24 h. Data are the mean ± SEM (n ¼ 3) (***P < 0.001 vs. normoxia; ##p < 0.01, ###P < 0.001 vs. hypoxia).

4. Discussion In this study, we found that hypoxia caused the changes in H9c2 cells viability, apoptosis, oxidative stress and inflammation. These changes include the decreased in cell viability, the increased ROS production and MDA levels, the increased number of apoptotic cells and the up-regulated activity of caspase-3 and phosphorylated NFkB p65 subunit. However, AMPs treatment significantly protected cell survival against hypoxia condition and decreased the Bax/Bcl-2 ratio. We demonstrated the ameliorative effects of AMPs on reactive oxygen species (ROS) production and MDA levels under hypoxia condition, and meanwhile AMPs effectively decreased phosphorylated NF-kB p65 expression. In addition, the main crucial factors in determining cell apoptosis are caspases cascade. Consistent with the decrease in Bax/Bcl-2 ratio in the AMPs pre-treated group, AMPs also decreased caspase-3 activity by 1.5-fold as compared to the hypoxia group, suggesting it may play a protective role in cardiomyocytes submitted to hypoxia. The present study, based on our findings, is the first evidence to evaluate the

molecular effects of AMPs on inhibiting apoptosis under hypoxia conditions in H9c2 cells. The results of the present study are consistent with those of previous studies indicating the mitochondria apoptosis induction in H9c2 cells under hypoxia [14]. Moreover, In rat model of myocardial ischemia inhibition of caspase-3 activity has been revealed to be associated with reduce in infarct size [15]. A number of studies have showed that hypoxia-induced cardiomyocytes apoptosis through oxidative stress and inflammatory responses [16,17]. Hypoxia induction leads to major changes in anti-apoptotic/pro-apoptotic protein balance toward pro-apoptotic and causes induction of mitochondria apoptosis pathway [18]. Additionally, Transcription factor NF-kB has been involved in cardiac pathological processes such as inflammation, oxidative stress and apoptosis via modulation of gene associated with stress responses [19]. However, there are insufficient related studies investigating the AMPs against cardiomyocyte cell injury under hypoxia condition. A novel approach focusing on regenerating the cardiomyocyte has been explored, including gene therapy, cell

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

6

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

therapy, and the use of growth factors. hAM transplantation made the important recent advances in the treatment of heart disease. Studies have shown the clinical efficiency of the amniotic membrane as important potential, revealing the feasibility of myocardial regeneration by an amniotic membrane for the treatment of heart injuries. Cargnoni et al. showed that application of hAM could enhance the dimensional alterations and contractile dysfunction in the rat model of myocardial infarction. They reported that this beneficial effect was related to release of a soluble factor from human amniotic cells and played a protective role in myocardial ischemia of rats in vivo [20]. For the first time, Khalpey used the hAM patch graft in two patients after cardiac surgery and he confirmed that hAM was able to reduce the arterial fibrillation in patients receiving the patch [21]. Roy applied the Decellularized hAM in myocardial infarction model of 6e8 week old male BALB/c mice, and showed that Decellularized hAM prevented the postischemic dysfunction [22]. Moreover, amniotic membrane has emerged as a promising source of stem cell and growth factors for regenerative medicine [6]. Growth factor therapy has prompted interest in regeneration mechanisms due to cardioprotective effect by the mechanism of action on the cardiomyocyte cell through proliferation, anti-apoptotic and angiogenesis effects [23]. Studies have indicated the presence of growth factors in hAM extraction. Dudok found that AME had supportive beneficiary effects on mechanical cell injuries and suppression of oxidative stress [24]. In the study of Hao et al., anti-inflammatory effects of amniotic membrane transplantation have been confirmed [25]. Meanwhile, Shao et al. showed the presence of pigment epithelium-derived factor (PEDF) in hAM proteins. They measured and confirmed the expression of PEDF in hAM protein by molecular technique [26]. Moreover, Choi et al. clarified mitogenic growth factors such as EGF, KGF, HGF, and bFGF in prepared hAM suspension [27]. Furthermore, Koizumi et al. demonstrated the expression of mRNA growth factors and their content levels by ELISA in hAM [28]. In addition, Stachon determined the protein concentration in hAM by comparing the two-protein extraction method in PBS and lysis buffer, confirming existing of growth factors, including EGF, bFGF, and HGF in homogenate by enzyme-linked immunosorbent assay [29]. Thus, the present study reveals the protective role of AMPs in hypoxia-induced cardiomyocytes injure and might serve as a potent cardioprotective agent. Altogether, the current finding unveils that the benefits conferred by hAM treatment in myocardial infarction model seem to be associated with AMPs, which contains growth factors and may modulate the apoptotic and inflammatory pathway under an ischemic condition.

5. Conclusions The current study findings conclude the efficacy of AMPs on amelioration of H9c2 cell viability, primarily by regulating the apoptosis pathway, Bax and Bcl-2 expression and caspase-3 activity under hypoxia condition in vitro. Furthermore, the protective effect of AMPs against hypoxia was studied by PI staining, implying the efficacy of AMPs. However, it was also perceived that AMPs mainly inhibited the ROS generation, phosphorylated NF-kB p65 and MDA production, which is under cellular redox state in hypoxia. A number of limitations of this research need to be stated since the hAM contain various growth factors, cytokines and bioactive molecule which likely associated with cardiac repair, further investigation is needed to be clarified the responsible component for the observed protection. Furthermore, H9c2 cardiomyocyte does not completely mimic the human cardiomyocyte model. However, H9c2 cell line is derived from embryonic rat heart and has been broadly used as an in vitro model of ischemic injury.

Conflicts of interest Authors declare no competing interests. Acknowledgment This study was supported by a grant from University of Tabriz University of Medical Sciences (No: IR.TBZMED.REC.1394.1063). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.07.045. References [1] L.M. Buja, Myocardial ischemia and reperfusion injury, Cardiovasc. Pathol. 14 (2005) 170e175. [2] X. Wu, W. Huang, G. Luo, L.A. Alain, Hypoxia induces connexin 43 dysregulation by modulating matrix metalloproteinases via MAPK signaling, Mol. Cell. Biochem. 384 (2013) 155e162. [3] H. Cao, H. Xu, G. Zhu, S. Liu, Isoquercetin ameliorated hypoxia/reoxygenationinduced H9C2 cardiomyocyte apoptosis via a mitochondrial-dependent pathway, Biomed. Pharmacother. 95 (2017) 938e943. [4] Y. He, C. Li, Q. Ma, S. Chen, Esculetin inhibits oxidative stress and apoptosis in H9c2 cardiomyocytes following hypoxia/reoxygenation injury, Biochem. Biophys. Res. Commun. 501 (2018) 139e144. [5] J. Yu, Y. Lu, Y. Li, L. Xiao, Y. Xing, Y. Li, L. Wu, Role of S100A1 in hypoxiainduced inflammatory response in cardiomyocytes via TLR4/ROS/NF-kappaB pathway, J. Pharm. Pharmacol. 67 (2015) 1240e1250. [6] O. Parolini, M. Soncini, M. Evangelista, D. Schmidt, Amniotic membrane and amniotic fluid-derived cells: potential tools for regenerative medicine? Regen. Med. 4 (2009) 275e291. [7] T. Miki, T. Lehmann, H. Cai, D.B. Stolz, S.C. Strom, Stem cell characteristics of amniotic epithelial cells, Stem Cell. 23 (2005) 1549e1559. [8] J. Wang, L. Peng, G.X. Lu, Stem cell characteristics and islet differentiation potential of human amniotic epithelial cells, Nan Fang Yi Ke Da Xue Xue Bao 31 (2011) 1484e1487. [9] H. Tsuji, S. Miyoshi, Y. Ikegami, N. Hida, H. Asada, I. Togashi, J. Suzuki, M. Satake, H. Nakamizo, M. Tanaka, T. Mori, K. Segawa, N. Nishiyama, J. Inoue, H. Makino, K. Miyado, S. Ogawa, Y. Yoshimura, A. Umezawa, Xenografted human amniotic membrane-derived mesenchymal stem cells are immunologically tolerated and transdifferentiated into cardiomyocytes, Circ. Res. 106 (2010) 1613e1623. [10] Z. Vojdani, A. Babaei, A. Vasaghi, M. Habibagahi, T. Talaei-Khozani, The effect of amniotic membrane extract on umbilical cord blood mesenchymal stem cell expansion: is there any need to save the amniotic membrane besides the umbilical cord blood? Iran. J. Basic Med. Sci. 19 (2016) 89e96. [11] C. Ventura, S. Cantoni, F. Bianchi, V. Lionetti, C. Cavallini, I. Scarlata, L. Foroni, M. Maioli, L. Bonsi, F. Alviano, V. Fossati, G.P. Bagnara, G. Pasquinelli, F.A. Recchia, A. Perbellini, Hyaluronan mixed esters of butyric and retinoic Acid drive cardiac and endothelial fate in term placenta human mesenchymal stem cells and enhance cardiac repair in infarcted rat hearts, J. Biol. Chem. 282 (2007) 14243e14252. [12] M.J. Lopez-Valladares, M. Teresa Rodriguez-Ares, R. Tourino, F. Gude, M. Teresa Silva, J. Couceiro, Donor age and gestational age influence on growth factor levels in human amniotic membrane, Acta Ophthalmol. 88 (2010) e211ee216. [13] D. Torella, G.M. Ellison, I. Karakikes, B. Nadal-Ginard, Growth-factor-mediated cardiac stem cell activation in myocardial regeneration, Nat. Clin. Pract. Cardiovasc. Med. 4 (Suppl 1) (2007) S46eS51. [14] L. Jing, Q. Li, L. He, W. Sun, Z. Jia, H. Ma, Protective effect of tempol against hypoxia-induced oxidative stress and apoptosis in H9c2 cells, Med. Sci. Monit. Basic Res. 23 (2017) 159e165. [15] J. Fang, X.W. Song, J. Tian, H.Y. Chen, D.F. Li, J.F. Wang, A.J. Ren, W.J. Yuan, L. Lin, Overexpression of microRNA-378 attenuates ischemia-induced apoptosis by inhibiting caspase-3 expression in cardiac myocytes, Apoptosis 17 (2012) 410e423. [16] G. Heusch, P. Libby, B. Gersh, D. Yellon, M. Bohm, G. Lopaschuk, L. Opie, Cardiovascular remodelling in coronary artery disease and heart failure, Lancet 383 (2014) 1933e1943. [17] L. Duan, H. Lei, Y. Zhang, B. Wan, J. Chang, Q. Feng, W. Huang, Calcitonin generelated peptide improves hypoxia-induced inflammation and apoptosis via nitric oxide in H9c2 cardiomyoblast cells, Cardiology 133 (2016) 44e53. [18] Y. Su, H. Tian, L. Wei, G. Fu, T. Sun, Integrin Beta3 Inhibits Hypoxia-induced Apoptosis in Cardiomyocytes, Acta Biochim Biophys Sin (Shanghai) (2018). [19] R.P. Wang, Q. Yao, Y.B. Xiao, S.B. Zhu, L. Yang, J.M. Feng, D.Z. Li, X.L. Li, J.J. Wu, J. Chen, Toll-like receptor 4/nuclear factor-kappa B pathway is involved in myocardial injury in a rat chronic stress model, Stress 14 (2011) 567e575. [20] A. Cargnoni, M. Di Marcello, M. Campagnol, C. Nassuato, A. Albertini,

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045

Y. Faridvand et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7

[21]

[22]

[23]

[24]

O. Parolini, Amniotic membrane patching promotes ischemic rat heart repair, Cell Transplant. 18 (2009) 1147e1159. Z. Khalpey, K.M. Marsh, A. Ferng, I.B. Riaz, M. Friedman, J. Indik, R. Avery, C. Jokerst, I. Oliva, First in man: amniotic patch reduces postoperative inflammation, Am. J. Med. 128 (2015) e5ee6. R. Roy, T. Haase, N. Ma, A. Bader, M. Becker, M. Seifert, Y.H. Choi, V. Falk, C. Stamm, Decellularized amniotic membrane attenuates postinfarct left ventricular remodeling, J. Surg. Res. 200 (2016) 409e419. J.S. Reboucas, N.S. Santos-Magalhaes, F.R. Formiga, Cardiac regeneration using growth factors: advances and challenges, Arq. Bras. Cardiol. 107 (2016) 271e275. D.V. Dudok, I. Nagdee, K. Cheung, H. Liu, L. Vedovelli, E. Ghinelli, K. Kenyon, S. Parapuram, C.M. Hutnik, Effects of amniotic membrane extract on primary human corneal epithelial and limbal cells, Clin. Exp. Ophthalmol. 43 (2015) 443e448.

7

[25] Y. Hao, D.H. Ma, D.G. Hwang, W.S. Kim, F. Zhang, Identification of antiangiogenic and antiinflammatory proteins in human amniotic membrane, Cornea 19 (2000) 348e352. [26] C. Shao, J. Sima, S.X. Zhang, J. Jin, P. Reinach, Z. Wang, J.X. Ma, Suppression of corneal neovascularization by PEDF release from human amniotic membranes, Invest. Ophthalmol. Vis. Sci. 45 (2004) 1758e1762. [27] J.A. Choi, H.J. Jin, S. Jung, E. Yang, J.S. Choi, S.H. Chung, C.K. Joo, Effects of amniotic membrane suspension in human corneal wound healing in vitro, Mol. Vis. 15 (2009) 2230e2238. [28] N.J. Koizumi, T.J. Inatomi, C.J. Sotozono, N.J. Fullwood, A.J. Quantock, S. Kinoshita, Growth factor mRNA and protein in preserved human amniotic membrane, Curr. Eye Res. 20 (2000) 173e177. [29] T. Stachon, M. Bischoff, B. Seitz, M. Huber, M. Zawada, A. Langenbucher, N. Szentmary, Growth factors and interleukins in amniotic membrane tissue homogenate, Klin. Monbl. Augenheilkd. 232 (2015) 858e862.

Please cite this article in press as: Y. Faridvand, et al., Amniotic membrane extracted proteins protect H9c2 cardiomyoblasts against hypoxiainduced apoptosis by modulating oxidative stress, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.07.045