Angiogenesis induced by novel peptides selected from a phage display library by screening human vascular endothelial cells under different physiological conditions

Angiogenesis induced by novel peptides selected from a phage display library by screening human vascular endothelial cells under different physiological conditions

peptides 28 (2007) 691–701 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/peptides Angiogenesis induced by novel pept...

1MB Sizes 0 Downloads 5 Views

peptides 28 (2007) 691–701

available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/peptides

Angiogenesis induced by novel peptides selected from a phage display library by screening human vascular endothelial cells under different physiological conditions Britta Hardy a,*, Annat Raiter a, Chana Weiss a, Boris Kaplan b, Ariel Tenenbaum c, Alexander Battler a,d a

Felsenstein Medical Research Center, Rabin Medical Center, Beilinson Campus, Petah-Tikva 49100, Israel Tel-Aviv University School of Medicine, Gynecology Department, Rabin Medical Center, Beilinson Campus, Petah-Tikva 49100, Israel c Schneider Children’s Medical Center, Rabin Medical Center, Beilinson Campus, Petah-Tikva 49100, Israel d Cardiology Department, Rabin Medical Center, Beilinson Campus, Petah-Tikva 49100, Israel b

article info

abstract

Article history:

Angiogenesis is a process modulated by several endogenous vascular growth factors as well

Received 17 September 2006

as by oxygen conditions. For example VEGF failed to induce useful therapeutic angiogenesis

Received in revised form

in clinical trials. We used a combinatory phage display peptide library screening on human

12 November 2006

umbilical endothelial cells under normoxia and hypoxia conditions in order to identify novel

Accepted 13 November 2006

peptides that bind endothelial cells. The identified peptides induced angiogenesis as

Published on line 21 December 2006

demonstrated by endothelial cell proliferation, migration and tube formation. Injection of peptides into the ears of mice resulted in increased numbers of blood vessels. Peptides did

Keywords:

not induce VEGF receptor gene expression indicating a possible VEGF unrelated mechanism. # 2006 Elsevier Inc. All rights reserved.

Endothelial cell Angiogenesis Peptides Phage-display library VEGF receptors

1.

Introduction

The epidemic of ischemic diseases requires innovative treatments [3]. Therapeutic angiogenesis has emerged as a non-invasive approach aimed at promoting revascularization in underperfused tissues [27]. Angiogenesis, or new blood vessel formation, involves endothelial cell proliferation and migration, followed by capillary tube formation [6,9,44]. Each stage in this process can be modulated by a number of endogenous vascular growth factors to improve the perfusion of chronically ischemic tissues [52]. It was suggested that the shortage of endogenous growth factors is the reason for the pathogenesis of chronic ischemia; consequently, the problem

might be resolved by exogenous supplementation of growth factors, which induce angiogenesis [10]. A number of endogenous vascular growth factors provided as recombinant proteins or genes in clinical trials, have not induced useful therapeutic angiogenesis [24,47]. The soluble factors include vascular endothelium growth factor (VEGF) [5,37], basic fibroblast growth factor (bFGF), acidic FGF/FGF-1 [4,12], hypoxia inducible factor 1-alfa [42] and others [20,29,52]. Recent reports on the delivery of VEGF for therapeutic angiogenesis suggested some possible side effects [43]. There is evidence that over-expression of VEGF resulted in formation of non-functional leaky vessels in experimental animal models [41,48] while VEGF gene transfer has led to transient

* Corresponding author. Tel.: +972 3 9376782; fax: +972 3 9216979. E-mail address: [email protected] (B. Hardy). 0196-9781/$ – see front matter # 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2006.11.008

692

peptides 28 (2007) 691–701

edema in human [45]. These findings showed that VEGF administration stimulated sprouting of immature leaky blood conduits that lack encasing vascular smooth muscle cells [21]. The challenge remains in identifying factors that stimulate functional neovascularization. We postulated that non-endogenic, synthetic molecules, such as randomized short peptides selected from a randomized phage display peptide library, would have a better potential for therapeutic angiogenesis. Phage display libraries represent a powerful technology, which enables identification of novel peptides that were primarily used for preparation of vaccines [18]. Furthermore, phage display antibodies or peptide libraries were used to identify molecules that promote angiogenesis or anti angiogenesis. For example, a synthetic single-chain antibody fragment library was used for the identification of synthetic antibody fragments that bind microvascular endothelial cells for generation of vascular or tumor targeting agents [50]. Also, a synthetic peptide library was used to screen human vascular endothelial cells stimulated with vascular endothelial growth factor (VEGF), to construct a peptide-based ligandreceptor map of the VEGF family [16]. Our aim was to target the peptide library on endothelial cells. Endothelial cells express a wide spectrum of surface molecules involved in multiple vascular functions. Some molecules are constitutively expressed, while others are negatively expressed. Modulations of surface molecule expression on endothelial cells might be induced by hypoxia [35]. Hypoxia induces endogenous endothelial growth factors and receptors, which play interacting roles in angiogenesis [30]. For example, under hypoxic conditions, VEGF gene expression is induced to secrete VEGF, which binds VEGF receptors expressed on endothelial cells, thereby causing proliferation of endothelial cells which may lead to angiogenesis [36,39,40]. In this study we describe the identification of synthetic peptides from a phage display peptide library by screening human endothelial cells under different physiological conditions such as normoxia, short and long-term hypoxia, and demonstrate the role of these peptides in induction of angiogenesis.

2.

Materials and methods

2.1.

Isolation of cells and maintenance conditions of cells

2.2.

Screening random phage display peptide library

The random phage display peptide library employed in this study is based on a combinatorial library of random 12-mer peptides fused to a minor coat protein (pIII) of M13 phage (New England Biolabs, Inc. MA, USA), following the methods recommended by the manufacturer. The displayed 12-mer peptides are expressed at the N-terminus of pIII. The library consists of about 2.7  109 electroporated sequences amplified once to yield 20 copies of each sequence in 10 ml of the supplied phage. The peptide library was subjected to four rounds of affinity positive selection, (biopanning), performed in parallel on three different groups of endothelial cells: (a) cells incubated under normal oxygen conditions; (b) after 3 h of hypoxia; (c) after 24 h of hypoxia. Screening was performed on endothelial cells derived from different cords on 60 mm Petri dishes (105 cells/dish). Each screening round was composed of four Petri dishes for each group of endothelial cells. Unbound phages from the first dish were plated on a second dish successively to reach a total of four dishes. Phages of the three eluted dishes were pooled for the second round of biopanning. Phages obtained from round 2 were subjected to one round of negative selection on peripheral blood lymphocytes (PBL). PBL 105 cells/dish were immobilized on Petri dishes by overnight incubation in a 37 8C drying oven to attach the cells to the dishes [17]. The unbound phages were further subjected to the next rounds of positive selection. After the last round of biopanning 40 individual clones of phages eluted from each group of cells were isolated and cloned.

2.3.

Identification of DNA sequences from selected phages

DNA from all isolated selected clones was purified by incubation with iodide buffer and ethanol (according to manual instructions, NEB, MA, USA). The 96 gIII (NEB, MA, USA) sequencing primer was utilized for automated sequencing by the Sequencing Unit of Tel-Aviv University. Sequences of the 120 positive selected clones were compared by multiple alignment using GCG PileUp software (Accelrys Software Inc., San Diego, CA, USA), resulting in a total of 15 non-identical sequences.

2.4.

Screening of positive clones by ELISA

Human umbilical vascular endothelial cells (HUVEC) were isolated by collagenase digestion [22]. PBL were isolated by Ficoll Hypaque density centrifugation. In order to provide a diverse base of cells, we employed at least three different umbilical cords for preparation of endothelial cells in each experiment. HUVEC were maintained in cultures with M199 medium supplemented with 20% FCS, 25 mg/ml endothelial cell growth supplement (Biomedical Technologies, MA, USA) and 5 U/ml Heparin (SIGMA, Rehovot, Israel). For in vitro experiments, HUVEC from passages 3–5 incubated in endothelial cell basal medium (Promocell, Heidelberg, Germany) were used.

In order to compare the binding activity of the different peptide sequences, ELISA was performed on duplicates, using 96 well plates coated with endothelial cells derived from three different cords (20,000 cells/well). Phages at 1010 or 109 phages per well were added for two hours at room temperature, followed by anti-M13-HRP antibody (Amersham Pharmacia Biotech, Buckinghamshire, UK) for 2 h. Binding was detected by tetramethyl benzidine liquid substrate (DAKO TMB substrate chromogen, DAKO Corporation, CA, USA). Plates were read at 450 nm in an ELISA reader.

2.1.1.

2.5.

Hypoxia conditions

HUVEC were subjected to hypoxia for 3 or 24 h with a gas mix of 94% nitrogen + 5% CO2 + 1% O2 in a hypoxia chamber (Billups-Rothenberg, CA, USA).

Peptide synthesis

Six peptides were synthesized according to their sequences by SynPep (Dublin, CA, USA) at purity higher than 97%.

peptides 28 (2007) 691–701

2.6.

FACS analysis of peptide binding to HUVEC

Endothelial cells (1  105) were stained with 0.5, 1, 2, 4 and 6 mg of Fluorescein Isothiocyanate (FITC)-labeled peptides for 2 h, on ice, in dark, and then washed twice with PBS. Cell samples were analyzed by Fluorescence Activated Cell Sorter (FACScan, Beckton Dickinson, CA, USA). Mouse IgG1-FITC was used as an isotype control.

with the synthetic peptides, or VEGF as positive control, at 10 ng/ml (concentration determined by several preliminary assays). Plates were incubated at 37 8C for 20 h. Pictures were taken under a light microscope. The tubular length of cellular net was measured in five different areas of each slide and quantified with Image-Pro Plus software (Media Cybernetics, MD, USA).

2.11. 2.7.

Aortic ring sprouting

Human mammary or radial artery was cut into 1 mm long rings and each was placed on fibronectin coated 96 well plate filled with Dulbecco’s modified Eagle’s medium containing 10% FCS, according to a previously published method [34]. Phage-bound peptides at 106 per well or their corresponding synthetic peptides at 10 ng/ml were added in triplicates. Plates were incubated for 7 days at 37 8C with 5% CO2. Arterial rings were removed and cell proliferation was estimated by XTT assay according to manufacturer instructions (Biological Industries, Kibbutz Beit HaHemek, Israel). Both FGF and VEGF were equally used and proved as positive controls.

2.9.

Endothelial cell migration

Migration was evaluated by the Chemicon QCM 96-well Migration Assay kit (Chemicon International, CA, USA), according to manufacturer instructions. In brief, endothelial cells (from three different cords) after 24 h incubation on gelatin-coated plates in starvation conditions, were transferred (2  104 cells per well) to each of the 96 wells of the migration chamber. 5  105 peptide-bound phages (number determined optimal in preliminary assay) or 20 ng/ml of the synthetic peptides (concentration chosen after several preliminary experiments), were added to the feeder tray for 5 h. Migrating cells were detached, stained and lysed. The relative fluorescent units were determined by fluorescent ELISA reader at 480/520 nm.

2.10.

In vivo ear angiogenesis

Proliferation of endothelial cells

Endothelial cells (40,000 cells/well), in triplicates, from three different cords were seeded on 24-well gelatin (1%)-coated plates. Cells were incubated for 24 h in medium without serum and growth factors (starvation conditions). We than added either 5  105 phages bound peptides per well (found to be the optimal number in a preliminary assay) or the corresponding synthetic peptides at 1 and 10 ng/ml (per well) to the cells for an additional 24 h. [H]3 Thymidine uptake was measured 6 h after addition of 2 mCi/well in a b-counter (Packard Bioscience, Meriden, USA).

2.8.

693

Tube formation assay

Endothelial cells from different cords were harvested with trypsin and incubated in starvation conditions for 24 h before assay. Plates (24-well) were pre-coated with 250 ml cultrex basement membrane extract-reduced growth factors-(R&D Systems, Abingdon, Great Britain). Endothelial cells (105/ 0.5 ml) were transferred to the coated wells and incubated

The ear angiogenesis model is a modification of an approach described previously [34]. Synthetic peptides in a concentration of 10 mg/per mouse were injected sub-cutaneously into the base of BALB/C mouse ears. Contra-lateral ears were injected with PBS. Each peptide was injected into 10 mice in two separate experiments. Digital photographs were obtained 7 days after injection. Blood vessels were counted by doubleblind method.

2.12.

VEGF receptors Flt1 and Kdr gene expression

Human umbilical vein endothelial cells were plated on 60 mm Gelatin (1%) coated Petri dishes for 24 h in starvation medium. Synthetic peptides (10 ng/ml) were added for different times. Total RNA was extracted with Trisol reagent (Invitrogene Life Technologies). cDNA was synthesized using Super Script III First Strand Synthesis System. Thirty nanograms of cDNA were used for Real Time PCR. We used the following primers: The primers of Flt1: forward 50 TCAGCGCATGGCAATAATAGA, reverse 50 ACCAAGGTGCTAGCCATCTTATTC. The primers of Kdr forward 50 TCAGGCAGCTCACAGTCCTAGAG. Reverse 50 ACTTGTCGTCTGATTCTCCAGGTT and the primers of GAPDH as the reference gene: forward 50 CACCAGGGCTGCTTTTAACTCT. Reverse 50 GAATCATATTGGAACATGTAAACC. The reaction mixture consisted of 20 ml of distilled water, primers, cDNA and SYBR Green master kit (Applied Biosystem, CA, USA). Amplification reactions were carried out by 40 cycles of 95 8C for 15 s and 60 8C for 60 s. All results were normalized with GAPDH. Results were analyzed using the Sequence Detector Software Version 1 (Applied Biosystem, CA, USA).

2.13.

Statistical and graphical methods

Statistical analysis employed analysis of variance (ANOVA), with either Dunnett’s test for comparison to a control or Tukey–Kramer HSD test for multiple comparisons. Fisher Exact tests were employed to examine categorical differences. Results were considered statistically significant at P  0.05.

3.

Results

3.1. Screening of phage display peptide library of endothelial cells under different physiological conditions Four rounds of affinity positive selections from the peptide library were performed on three separate groups of endothelial cells, in order to select and enrich the phages that encode peptides, which bind endothelial cells under different physiological conditions. The first group consisted of endothelial

694

peptides 28 (2007) 691–701

Table 1 – Analysis of phage display peptide library screening EC

EC after 3 h hypoxia

EC after 24 h hypoxia

Panning 1 Number of phages Number eluted Percent eluted

1  10 12 7  10 5 7  105

1  10 12 7  10 5 7  105

1  10 12 2  10 6 2  104

Panning 2 Number of phages Number eluted Percent eluted

1  10 11 1.9  10 7 1.9  102

1  10 11 1.1  10 7 1.1  102

1  10 11 3.5  10 6 3.5  103

Panning 3 Number of phages after PBL negative selection Number eluted Percent eluted

1  10 9 3.5  10 6 0.35

1  10 9 1  10 9 0.5

1  10 9 1  10 9 0.06

Panning 4 Number of phages Number eluted Percent eluted

3.5  10 6 1  10 5 2.85

5.1  10 6 8  10 4 1.56

6.5  10 5 5  10 3 0.77

cells cultured under normoxic conditions. As can be seen in Table 1 the first round of positive selection resulted in 7  105 binding phages out of 1012 phages plated on 100,000 endothelial cells. The eluted phages were enriched to 1011, and the second round of panning resulted in 1.9  107 positivebinding phages. On the third round, phages were first subjected to negative binding on PBL, and the unbound phages were used for a third positive panning. At that stage we

obtained 3.5  106 of eluted phages, which are 0.35% of the plated phages. Since this was a relatively high number we did not amplify the phages and so used them directly for the fourth round of positive selection that resulted in 2.8% enrichment (Table 1). Similar results were obtained by screening endothelial cells subjected to 3 h of hypoxia. Phage-bound peptide selection on 24 h hypoxia-cultured endothelial cells resulted in a lower number of eluted phages.

Fig. 1 – Phages encoding peptide binding to endothelial cells under different physiological conditions: Binding to endothelial cells of 109 (A) and 1010 (B) phages encoding peptides, using ELISA assay on three different groups of endothelial cells. Cells under normoxia conditions and cells cultured for 3 and 24 h under hypoxia conditions. Binding was detected by anti-M13 antibody and expressed as the optical density (480 nm).

peptides 28 (2007) 691–701

3.2.

Selected phage binding to endothelial cells

We have isolated 40 individual phage clones from each group of endothelial cell screenings. A total of 15 non-identical sequences were obtained. Each sequence was named by the letter of the first and last amino acid. All phages bearing the peptides were further compared by Elisa binding to endothelial cells under normoxic and hypoxic conditions. As can be seen in Fig. 1, two different phage concentrations were used. An insertless phage served as a negative control (NO). A similar pattern of binding was obtained with 1010 phages and 109 phages. There were no significant differences in binding of each peptide to the different groups of endothelial cells. We have selected the highest binding representative from each endothelial group.

3.3.

695

Peptide sequences

In order to minimize the number of synthetic peptides for further studies, we selected six peptides; one unique to each group (normoxia, hypoxia 3 h, and hypoxia 24 h), and three that were common to two groups. Peptide QF (QPWLEQAYYSTF) originated from endothelial cells under normoxia. Peptide YR (YPHIDSLGHWRR) originated from cells under 3 h of hypoxia. Peptide LT (LLADTTHHRPWT) originated from cells that were subjected to 24 h of hypoxia. Peptide SP (SAHGTSTGVPWP) was identified on cells under 3 and 24 h of hypoxia. Peptide VL (VPWMEPAYQRFL) has a sequence that was found in both normoxia and 24 h hypoxia cell groups. Peptide TR (TLPWLEESYWRP) is another peptide common to endothelial cells that were under normoxic and hypoxic conditions.

Fig. 2 – FACS analysis of peptide binding to endothelial cells. Binding of synthetic peptides to 105 PBL and 105 endothelial cells is presented by FACS analysis. As can be seen (left side of the figure), the six peptides in optimal concentration (6 mg/ 105 cells) did not bind PBL, while increasing amounts of the FITC-labeled peptides bound increasing percentage of endothelial cells. Differences in intensity of binding among the peptides are noted. Different concentrations are presented using different colored lines, namely 0.5 mg (blue line), 2 mg (pink line), 4 mg (green line) and 6 mg (red line). The black line represents the isotype control (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article).

696

3.4.

peptides 28 (2007) 691–701

FACS analysis of peptide binding to EC

The six novel synthetic peptides were synthesized according to their sequences, and their specificity of binding to endothelial cells was evaluated by FACS analysis of FITClabeled peptide. Endothelial cells and PBL were used to compare the percent binding of increasing concentrations of the peptides. Fig. 2 demonstrates that increasing concentrations of the peptides did not induce an increase in binding to PBL, such that the percent binding is similar to the isotope control (black line), while they did induce an increase in percent binding to endothelial cells. However, the intensity of binding differed among the six peptides.

3.5.

Peptides induce proliferation of EC

In order to assess the angiogenic properties of the selected phage-bound peptides and their derived synthesized peptides, we studied their ability to induce proliferation of endothelial cells under starvation conditions. The effect of phageencoding peptides or synthetic peptides on proliferation of endothelial cells was tested under normoxic conditions. Cells were seeded on 24-well plates in serum-free media for 24 h, and then phages or synthetic peptides were added in various

Fig. 4 – Sprouting of aortic rings induced by phage presenting peptides and synthetic peptides. Human mammary aortic rings were incubated with 106 selected phage encoding peptides (A) or 10n g/ml of synthetic peptides (B). Proliferation of cells derived from the aortic rings was estimated by an XTT assay. Phage encoding VL peptide induced significant sprouting of the human aortic ring compared to an empty phage (NO) (P = 0.003) and similar to the growth factor FGF (A). A significant sprouting of human aortic ring was induced by synthetic peptide LT at 10 ng/ml (P < 0.05) even higher than VEGF.

Fig. 3 – Endothelial cell proliferation induced by phage display peptides (A) and the derived synthetic peptides (B). Endothelial cells incubated for 24 h with 5 T 105 phages encoding peptides YR, VL and TR induce significantly (P < 0.05) increased proliferation as compared to empty phages (NO) (A). Endothelial cells incubated with YR, TR and VL peptides at 1 or 10 ng/ml induced significantly increased proliferation (P < 0.01). [H]3 Thymidine uptake relative to controls of peptides QF and SP induced significantly (P < 0.05) increased proliferation at 1 and 10 ng/ml, whereas peptide LT, was significant only at 1 ng/ml.

concentrations for an additional 24 h. Fig. 3A demonstrates increased proliferation by Thymidine incorporation of endothelial cells incubated for 6 h with 5  105 phage-bound selected peptides as compared to empty phages (NO). Phage displaying peptides YR, VL and TR showed a significant increase in proliferation (P < 0.05). Similar significant increase in proliferation at 1 and 10 ng/ ml (P < 0.05) as compared to control cultures was obtained by the same synthetic peptides incubated with endothelial cells. Fig. 3B demonstrates Thymidine uptake above control by YR, TR and VL which induced 3.5, 3 and 2.7-fold increase, respectively; peptides LT, QF and SP induced a two-fold increase.

3.6. cells

Peptides induce proliferation of aortic ring-derived

In order to assess the angiogenic properties of the selected phage-bound peptides and their derived synthesized peptides, we studied their ability to induce sprouting of aortic rings. Selected phage-encoding peptides or their derived synthetic

peptides 28 (2007) 691–701

697

we studied their ability to induce migration of endothelial cells under starvation conditions. 5  105 phages encoding peptides, LT and QF induced significant migration as chemo attractants to endothelial cells (P < 0.05) (Fig. 5A). Synthetic peptides added to the feeder tray of a chemotaxis migration chamber for 5 h induced migration at 20 ng/ml. Peptides LT and SP induced 2.6 and 2.2-fold increase in migration respectively (P < 0.01) compared to a 1.9-fold increase by VEGF (Fig. 5B).

3.8.

Fig. 5 – Migration of endothelial cells induced by selected peptides: Phage display selected peptides and their derived synthetic peptides were added to the feeder tray of migration chambers containing endothelial cells. Phage bound peptides at 5 T 105 YR, LT and QF induced significant migration as chemoattractants (P < 0.05) in comparison to the empty phage (NO) (A). Synthetic peptides LT and SP induced a significant migration of endothelial cells (*P < 0.01) similar to VEGF. Peptides YR, TR, VL and QF also induced migration of endothelial cells (**P < 0.05) as expressed by relative fluorescent units (B).

peptides, cultured with human mammary aortic rings, induced proliferation of aortic ring-derived cells. Fig. 4A illustrates proliferation of cells originating from the aortic rings, induced by phage-presenting peptides compared to the positive control FGF. ANOVA comparing the different phage display peptides indicated an overall clear difference among them (P = 0.0003) and statistically significant differences between phage encoding peptide VL, FGF, and the NO empty phage control. Fig. 4B illustrates significant proliferation of cells originating from the aortic rings by LT peptide at 10 ng/ml compared to VEGF as a positive control (P < 0.05). Both FGF and VEGF equally enhanced sprouting of aortic rings and therefore we used both growth factors as positive controls.

3.7.

Peptides induce migration of endothelial cells

In order to assess the angiogenic properties of the selected phage-bound peptides and their derived synthesized peptides,

Peptides induce tube formation of endothelial cells

Endothelial cells were incubated on Matrigel in the presence of peptides, and array formation was analyzed. Peptides YR, QF and VL added to endothelial cells at concentration of 10 ng/ml resulted in a significant increase in tube formation as compared to untreated cells. Fig. 6 shows a picture illustrating tube formation of endothelial cells without addition of peptides (left), and after incubation with peptide YR (right). Measurement of tube length in cultures with the peptides in comparison to control cultures without the addition of peptides are summarized. Tube formation was measured as the increase in the length of endothelial cells in comparison to control. The tube length obtained by incubation with YR (197  39 mm), QF (136  20 mm) and VL (149  7 mm) peptides significantly increased in comparison to control (37.1  3.5 mm) and was similar to FGF (242  39 mm). SP was found to induce tube formation at the same concentration, but only under hypoxic conditions (results not shown). Peptides LT and TR did not induce tube formation.

3.9. Peptides increased the number of blood vessels in a mouse ear model A mouse ear was used as a model for in vivo angiogenesis of normal tissue. Injection of several synthetic peptides into the ears of BALB/C mice resulted in increased numbers of blood vessels. Fig. 7 contains a photograph illustrating the contrast between the ears of a mouse injected with YR in the right ear and PBS in the left ear. The mean number of blood vessels in the ears of mice injected with peptides is presented in Fig. 7. For the sake of analysis we regarded a 50% increase in the number of blood vessels in the treated ear (either peptide or PBS) versus the control (PBS) ear as clinically significant. We then did pair-wise comparisons, employing Fisher exact tests, to determine whether the number of mice with clinically significant increases in number of blood vessels over PBS in the treated ear was greater for the peptide treatments than for the PBStreated control ear. Injection with 10 mg of VL (8/10 versus 0/ 10), YR (6/10 versus 0/10), and TR (6/8 versus 0/10) resulted in the most significant (P < 0.05) increases.

3.10. Flt1 and Kdr gene expression in endothelial cells cultured with peptides In order to elucidate a correlation between the identified angiogenesis-inducing synthetic peptides and VEGF, we analyzed their ability to induce VEGF-receptor gene expression. Synthetic peptides were added to endothelial cells using

698

peptides 28 (2007) 691–701

Fig. 6 – Synthetic peptides induce endothelial cell tube formation: 10 ng/ml of peptides added to 105 endothelial cells induced tube formation. The right picture illustrates tube formation 20 h after incubation of cells with YR compared to control on the left (100T). Tubular length of the cellular net induced by the different peptides, is presented in the figure.

Fig. 7 – Peptides induce in vivo angiogenesis in a mouse ear model: Peptides injected to ears of BALB/C mice at a concentration of 10 mg/per mouse, induced increase in the number of blood vessels that were seen and counted from digital photographs. Summary of results, obtained from 10 mice per group, are presented in the figure. An illustrating photograph of the ears of a mouse injected with YR (right) compared to control (left) is presented.

peptides 28 (2007) 691–701

699

Fig. 8 – Flt1 and Kdr gene expression in endothelial cells cultured with peptides. Endothelial cells were cultured with 10 ng/ ml peptides in starvation conditions for up to 3 h and control cultures were incubated under the same conditions without peptides. Real-time PCR was performed to evaluate gene expression using GAPDH as a reference gene. The results of Flt1 (A) and Kdr (B) gene expression are presented as the ratio obtained from cultures with peptides over controls.

different concentrations of peptides (ranging from 1 to 100 ng/ ml) at different times ranging from 1 to 24 h incubation. Gene expression of VEGF receptors I and II, (Flt1 and Kdr) did not change significantly at any time or concentration. Fig. 8A and B represents one of several experiments in which 10 ng/ml of the peptides were incubated with the endothelial cells for 1 to 3 h.

4.

Discussion

The phage display peptide library represents a powerful technology, which can be used to identify peptides screened by panning on a target protein [18] or on target intact cells [31,38]. Previous studies demonstrated screening of peptide libraries on blood vessels in vivo for development of antiangiogenic therapies for cancers [2,26,53]. Vascular endothelial cells, which cover the inner surface of blood vessels, regulate important physiological and pathological reactions such as homeostasis/thrombosis, inflammation, blood vessel tonus and angiogenesis [14]. Endothelial cells express numerous cell surface-signaling molecules, such as VEGF, and VEGF receptors associated with developing tissues and the physiological environment [15,28,51]. Peptide libraries were used to screen vascular endothelial cells stimulated with endothelial cell growth factor (VEGF) in order to construct a peptide-based ligand receptor map of the VEGF family [38] and VEGF-receptor protein [11]. Since a hypoxic environment has important implications for physiological and pathological processes, we assumed that endothelial cells under different physiological conditions (such as normoxia and hypoxia) might reveal different surface molecules, which might be triggered by ligands (such as peptides) to initiate angiogenic processes. We therefore screened the peptide library under different physiological conditions. In order to eliminate the donor specificity of endothelial cells we used different endothelial-cell-derived cords in each of the screening stages. Furthermore, we used negative selection on peripheral blood lymphocytes to eliminate binding to common receptors on lymphoid cells. The final purified clones with non-identical sequences selected from the phage-display peptide library were further

compared by ELISA binding to the endothelial cell groups. In order to minimize the number of synthetic peptides for further studies, we selected six peptides; one unique to each group (normoxia, hypoxia 3 h, and hypoxia 24 h), and three that were common to two groups. Both phages and their derived peptides exhibited in vitro angiogenic properties such as proliferation of endothelial cell, sprouting of aortic rings, induction of migration and tube formation. A mouse ear model was used to demonstrate in vivo angiogenic activity. In most cases similar results were obtained by comparing the phages and their related synthetic peptides. However, in the aortic ring-sprouting assay, a phage encoding-VL and a different synthetic peptide (LT) induced significant sprouting. Differences were also observed with some peptides in different assays. TR and YR phage display peptides did not induce sprouting of aortic rings in contrast to their ability to increase proliferation of endothelial cells. Sprouting of aortic rings involves proteolysis of basement membrane components controlled by matrix metalloproteinases (MMPs), which are produced by the endothelial cells. [32]. It is possible that phage display peptide TR and YR did not trigger endothelial cells to produce MMPs in the aortic ring assay while the direct binding of the synthetic peptides promoted aortic rings sprouting. The ability to induce tube formation differed among the six peptides. We have found that only three out of the six peptides (YR, QF and VL) induced tube formation on Matrigel. LT peptide did not induce tube formation while it significantly increased the migration of endothelial cells. Tube formation is a step in completion of the angiogenic process that exhibits a critical role for Integrin a2b1 and MAPKs activation [7–33]. It is possible that LT peptide does not induce the process that involves integrins and activation of thyrosine kinase receptors on endothelial cells necessary for tube formation. Peptide SP which originated from the selection of peptides on endothelial cells under hypoxia, induced tube formation only under hypoxic conditions, similar to FGF-2 that induces capillary tube formation in hypoxic but not in normoxic conditions [25]. The amino acid composition of the six-angiogenic peptides (presented in the Results) was analyzed using a BLAST (NCBI) search against the SWISSPROT database. No identical sequences were found. We compared the amino-acid

700

peptides 28 (2007) 691–701

composition of the six peptides and found a consensus motif WLE_AY in the peptides VL, QF and TR. BLAST search of the motif WLE_AY resulted in a novel member of the RHOGAP family composed of small GTPases that has multiple functions such as cell cycle, cell migration and regulation of cytoskeletal organization [23]. In this family a GTPase-activating protein p73 is a key regulator of angiogenesis that is expressed in endothelial cells only during angiogenic processes [49]. Another GTPase activating protein, p68, is a multifunctional regulatory protein that regulates endothelial cell capillary tube formation during angiogenesis [1]. However peptides VL, TR and QF sequences were not identified on these two proteins. Peptides LT, SP and YR do not share the consensus motif. Therefore it is possible that they activate endothelial cell in a different mechanism. Increased VEGF has been observed in response to EGF, bFGF, Interleukins 1 and 6, TGF-b and HGF. The mechanism by which these and other growth factors promote angiogenesis may be to increase VEGF synthesis [8,13]. In order to find out whether these peptides induce angiogenesis via a VEGF related mechanism, we analyzed VEGF receptor gene expression. It was previously shown that VEGF stimulates endothelial cell proliferation and migration in vitro, and up-regulates the expression of the mRNA for Flk-1/Kdr in human umbilical vein endothelial cells [19]. One of the downstream molecular targets of VEGF action is the Flk-1/Kdr receptor; its expression is increased by VEGF [19,46]. However we did not obtain any change in VEGF receptor gene expression by the peptides incubated for 3 or 20 h (Data not shown). It is possible that the angiogenic activity of the peptides is not related to VEGF mechanism and further identification of the peptide receptors will be more informative. The selection of these synthetic peptides that induce angiogenesis might be the basis for development of targeted novel angiogenic therapy.

[9]

[10]

[11]

[12]

[13] [14] [15]

[16]

[17]

[18]

[19]

[20]

references [21] [1] Aitsebaomo J, Wennerberg K, Der CJ, Zhang C, Kedar V, Moser M, et al. P68RacGAP is a novel GTPases-activationg protein that interacts with vascular endothelial zinc-finger1 and modulates endothelial cell capillary formation. J Biol Chem 2004;279:17963–7. [2] Arap W, Kolonin G, Trepel M, Lahderanta J, Cardo-Vila M, Giordano J, et al. Steps toward mapping the human vasculature by phage display. Nat Med 2002;8:121–7. [3] Bouis D, Kusumanto Y, Meijer C, Mulder NH, Hospers GA. A review on pro- and anti-angiogenic factors as targets of clinical intervention. Pharmacol Res 2006;53(2):89–103. [4] Carmeliet P. Fibroblast growth factor-1 stimulates branching and survival of myocardial arteries: a goal for therapeutic angiogenesis? Cir Res 2000;87:176–8. [5] Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat Med 2000;6:389–95. [6] Conway E, Collen D, Carmeliet P. Molecular mechanisms of blood vessel growth. Cardiovasc Res 2001;40:507–21. [7] Davis GE, Bayless KJ, Mavila A. Molecular basis of endothelial cell morphogenesis in three-dimensional extracellular matrices. Anat Rec 2002;268:252–75. [8] De Bandt M, Ben Mahdi M, Ollivier V, Grossin M, Dupuis M, Gaudry M, et al. Blockade of vascular endothelial growth

[22]

[23]

[24]

[25]

[26]

[27]

factor receptor I (VEGF-RI), but not VEGF-RII, suppresses joint destruction in the K/BxN Model of rheumatoid arthritis. J Immunol 2003;171:4853–9. Distler J, Hirth A, Kurowska-Stolarska M, Gay RE, Gay S, Distler O. Angiogenic and angiostatic factors. Q J Nucl Med 2003;47:149–61. Emanueli C, Maddedu P. Changing the logic of therapeutic angiogenesis for ischemic disease. Trends Mol Med 2005;11:207–15. El-Mousawi M, Tchistiakova L, Yurchenko L, Pietrzynki G, Moreno M, Stanimirovic D, et al. A vascular endothelial growth factor high affinity receptor 1-specific peptide with antiangiogenic activity identified using a phage display peptide library. J Biol Chem 2003;278:46681–9. Fernandez B, Buehler A, Wolfram S, Kostin S, Espanion G, Franz WN, et al. Transgenic myocardial overexpression of fibroblast growth factor-1 increases coronary artery density and branching. Circ Res 2000;87(3):207–13. Ferrara N. Vascular endothelial growth factor. Eur J Ca 1996;32A:2413–22. Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endoc Rev 1997;18:4–25. Gerber HP, Condorelli F, Park J, Ferrara N. Differential transcriptional regulation of the two vascular growth factor receptor genes. J Biol Chem 1997;272:23659–67. Giordano R, Cardo-Vila M, Lahderanta J, Pasqualini R, Arap W. Biopanning and rapid analysis of selective interactive ligands. Nat Med 2001;7:1249–53. Glassy MC, Handley HH, Cleveland PH, Royston I. An enzyme immunofiltration assay useful for detecting human monoclonal antibody. J Immunol Meth 1985;81: 115–22. Hardy B, Raiter A. A mimotope peptide-based anti-cancer vaccine selected by BAT monoclonal antibody. Vaccine 2005;23:4283–91. Herve MA, Buteau-Lozanoa H, Mourahb S, Calvob F, PerrotApplanata M. VEGF189 stimulates endothelial cells proliferation and migration in vitro and up-regulates the expression of Flk-1/KDR mRNA. Exp Cell Res 2005;309: 24–31. Huang LE, Ho V, Arany Z, Kraine D, Galson D, Tendler D, et al. Erytropoietin gene regulation depends on hemedependent oxygen sensing and assembly of interacting transcription factors. Kidney Int 1997;51:548–52. Idris NM, Haider HKH, Goh MWK, Sim EKW. Therapeutic angiogenesis for treatment of peripheral vascular disease. Growth Factors 2004;22(4):269–79. Jaffe EA, Hoyer LW, Nachman RL. Synthesis of antihemophilic factor antigen by cultured human endothelial cells. J Clin Invest 1973;52(11):2757–64. Johnstone CN, Castellvi-Bel S, Chang LM, Bessa X, Nakagawa H, Harada H, et al. ARHGAP8 is a novel member of the RHOGAP family related to ARHGAP1/CDC42GAP/ p50RHOGAP: mutation and expression analyses in colorectal and breast cancers. Gene 2004;336:59–71. Khurana R, Simons M, Martin JF, Zachary IC. Role of angiogenesis in cardiovascular disease: a critical appraisal. Circulation 2005;112:1813–24. Kroon M, Koolwijk P, van der Vecht R, van Hinsbergh M. Hypoxia in combination with FGF-2 induces tube formation by human microvascular endothelial cells in a fibrin matrix: involvement of at least signal transduction pathways. J Cell Sci 2001;114:825–33. Laakkonen K, Porkka K, Hoffman J, Rioslahti E. A tumorhoming peptide with a targeting specificity related to lymphatic vessels. Nat Med 2002;8:751–5. Losordo DW, Dimmeler S. Therapeutic angiogenesis and vasculogenesis for ischemic disease. Circulation 2004;109:2487–91.

peptides 28 (2007) 691–701

[28] Luttun A, Tjwa M, Carmaliet P. Placental growth factor (PIGF) and its receptor Flt-1 (VEGFR-1). Novel therapeutic target for angiogenic disorders. Ann N Y Acad Sci 2002;979:80–93. [29] Mandriota SJ, Pyke C, Di S, Quinodoz P, Pittet P, Pepper MS. Hypoxia inducible angiopoietin2 expression is mimicked by iodonium compounds and occurs in the rat brain and skin in response to systemic hypoxia and tissue ischemia. Am J Pathol 2000;156:2077–89. [30] Marti HJ, Bernaudin M, Bellail A, Euler M, Petit E, Risau W. Hypoxia- Induced vascular endothelial growth factor expression precedes neovascularization after cerebral ischemia. Am J Pathol 2000;156:965–76. [31] Mazzucchelli L, Birritt JB, Jesaitis AJ, Nusrat A, Liang TW, Gerwitz AT, et al. Cell specific peptide binding by human neutrophils. Blood 1999;93:1738–48. [32] Milkiewicz M, Haas TL. Effect of mechanical stretch on HIF1 {alpha} and MMP-2 expression in capillaries isolated from overloaded skeletal muscles: laser capture microdissection study. Am J Physiol Heart Circ Physiol 2005;289:1315–20. [33] Milkiewicz M, Ispanovic E, Doyle JL, Haas TL. Regulators of angiogenesis and strategies for their therapeutic manipulation. Int J Biochem Cell Biol 2006;38:333–57. [34] Montesano R, Orci L, Vassalli P. In vitro rapid organization of endothelial cells into capillary like networks is promoted by collagen matrices. J Cell Biol 1983;97:1648–52. [35] Mutin M, Dignat F, Sampol J. Immunologic phenotype of cultured endothelial cells: quantitative analysis of cell surface molecules. Tissue Antigens 1997;50:449–58. [36] Namiki A, Brogi E, Kearney M, Kim E, Wu T, Couffinhal T, et al. Hypoxia induces vascular endothelial growth factor in cultured human endothelial cells. J Biol Chem 1995;270:31189–95. [37] Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial growth factor and its receptors. FASEB J 1999;13:9–22. [38] Nicklin SA, White SJ, Watkins SJ, Hawkins RE, Baker AH. Selective targeting of gene transfer to vascular endothelial cells by use of peptides isolated by phage display. Circulation 2000;102:231–7. [39] Nilsson I, Rolny C, Wu Y, Pitowski B, Hicklin D, Alitalo K, et al. Vascular endothelial growth factor receptor 3 in hypoxia induced vascular development. FASEB J 2004;18(13):1507–15. [40] Nomura M, Yamagishi S, Harada S, Hayashi Y, Yamashima T, Yamashita J, et al. Possible participation of autocrine and paracrine vascular endothelial growth factors in hypoxia

[41]

[42] [43]

[44] [45]

[46]

[47]

[48]

[49]

[50]

[51]

[52] [53]

701

induced proliferation of endothelial cells and pericytes. J Biol Chem 1995;270:28316–24. Pettersson A, Nagy JA, Brown LF, Sundberg C, Morgan E, Jungles S, et al. Heterogeneity of the angiogenic response induced in different normal adult tissues by vascular permeability factor/vascular endothelial growth factor. Lab Invest 2000;80:99–115. Pugh CW, Ratcliffe P. Regulation of angiogenesis by hypoxia: role of HIF system. Nat Med 2003;9:677–84. Ribatti D. The crucial role of vascular permeability factor/ vascular endothelial growth factor in angiogenesis: a historical review. Br J Hematol 2005;128:303–9. Risau W. Mechanisms of angiogenesis. Nature 1997;386:671–4. Rissanen TT, Rutanen J, Yla-Herttuala S. Gene transfer for therapeutic vascular growth in myocardial and peripheral ischemia. Adv Genet 2004;52:117–24. Shen BQ, Lee DY, Gerber HP, Keyt BA, Ferrara N, Zioncheck TF. Homologous up-regulation of KDR/Flk-1 receptor expression by vascular endothelial growth factor in vitro. J Biol Chem 1998;273:29979–85. Simons M, Bonow R, Chronos N, Cohen DJ, Giordano FJ, Hammond HK, et al. Clinical trials in coronary angiogenesis: issues, problems, consensus: an expert panel summary. Circulation 2000;102:73–86. Spilsbury I, Garret KL, Shen WY, Constable I, Rakoczy PE. Over expression of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the development of choroidal neovascularization. Am J Pathol 2000;157:135–44. Su SZ, Hahn CN, Goodall GJ, Reck NM, Leske AF, Davy A, et al. A vascular cell-restricted RhoGAP, p37RhoGAP, is a key regulator of angiogenesis. Proc Natl Acad Sci 2004;101:12212–7. Volkel T, Muller R, Kontermann RE. Isolation of endothelial cell specific human antibodies from a novel fully synthetic scFv library. Biochem Biophys Res Commun 2004;317:515– 21. Willam A, Koehne P, Jurgensen JS, Grafe M, Wagner KD, Bachman S, et al. Tie2 expression is stimulated by hypoxia and proinflammatory cytokines in human endothelial cells. Circ Res 2000;87:370–7. Ziche M, Donnini S, Morbidelli L. Development of new drugs in angiogenesis. Curr Drug Targets 2004;5:485–94. Zurita AJ, Arap W, Pasqualini R. Mapping tumor vascular diversity by screening phage display libraries. J Control Release 2003;91:183–6.