Blocking peptides against HBV: PreS1 protein selected from a phage display library

Blocking peptides against HBV: PreS1 protein selected from a phage display library

Biochemical and Biophysical Research Communications 412 (2011) 633–637 Contents lists available at SciVerse ScienceDirect Biochemical and Biophysica...

447KB Sizes 0 Downloads 7 Views

Biochemical and Biophysical Research Communications 412 (2011) 633–637

Contents lists available at SciVerse ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Blocking peptides against HBV: PreS1 protein selected from a phage display library Wei Wang, Yang Liu, Xiangyang Zu, Rui Jin, Gengfu Xiao ⇑ State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, PR China

a r t i c l e

i n f o

Article history: Received 1 August 2011 Available online 11 August 2011 Keywords: Hepatitis B virus (HBV) PreS1 Phage display Peptide Blocking

a b s t r a c t The PreS1 protein is present on the outermost part of the hepatitis B virus (HBV) surface and has been shown to have a pivotal function in viral infectivity and assembly. The development of reagents with high affinity and specificity for PreS1 is of great significance for early diagnosis and treatment of HBV infection. A phage display library of dodecapeptide was screened for interactions with purified PreS1 protein. Alignment of the positive phage clones revealed a putative consensus PreS1 binding motif of HXnHXmHP/R. Moreover, a peptide named P7 (KHMHWHPPALNT) was highly enriched and occurred with a surprisingly high frequency of 72%. A thermodynamic study revealed that P7 has a higher binding affinity to PreS1 than the other peptides. Furthermore, P7 was able to abrogate the binding of HBV virions to the PreS1 antibody, suggesting that P7 covers key functional sites on the native PreS1 protein. This newly isolated peptide may, therefore, be a new therapeutic candidate for the treatment of HBV. The consensus motif could be modified to deliver imaging, diagnostic, and therapeutic agents to tissues affected by HBV. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Hepatitis B, which is caused by a small DNA virus known as the hepatitis B virus (HBV), is a serious health threat, with chronic and acute forms that affect more than 350 million people worldwide and result in approximately 600,000 deaths annually [1–3]. The most commonly used drugs, interferon-a and nucleoside analogs, are not HBV-specific, and none of these drugs are capable of completely eradicating the virus [4–6]. Therefore, the investigation and identification of targets and inhibitors of HBV is highly desirable. The attachment of virions to the human hepatocyte membrane via the interaction of the viral envelope protein with cell surface receptors is considered to be the initial step of HBV infection [7]. The envelope of the HBV virion is formed by virally encoded small (SHBs), middle (MHBs), and large (LHBs) surface proteins, together with host-derived phospholipids [8]. These proteins are translated from distinct initiation codons but share a common reading frame and stop codon [9]. The SHBs protein contains 226 amino acids and is the major component of the viral envelope. The MHBs protein has 55 extra amino acids (PreS2) located at the N-terminus of the SHBs, and the LHBs protein carries an additional 119-amino acid (or 109-amino acid, depending on the viral subtype, PreS1) N-terminal extension with respect to the MHBs protein. L-protein contains the PreS1, PreS2, and S regions, which are preferentially localized on infectious viral particles. The PreS1 region is the outermost part of HBV and has been shown to have a pivotal function in viral infectivity and assembly [10–15]. Therefore, a specific ⇑ Corresponding author. Fax: +86 27 87198685. E-mail address: [email protected] (G. Xiao). 0006-291X/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2011.08.014

PreS1-interacting peptide would be both a valuable tool for the study of these processes and a potential therapeutic agent against viral infection. In the present study, a commercial phage display (Ph.D.)-12 peptide library (NEB, Beverly, MA, USA), in which a library of peptide variants is expressed on the phage surface as fusions to coat proteins III [16–18], was used to screen for peptides that bind to PreS1. This screening system allows for rapid partitioning based on binding affinity to a given target molecule by an in vitro selection process called panning [19]. A major clone named P7 was selected, and specific binding was confirmed by an inhibition assay. Moreover, the scaffold of the binding peptides was determined to be HXnHXmHP/R. The information obtained in this study may support the design of drugs against HBV.

2. Materials and methods 2.1. Preparation of PreS1 protein The sequence coding for the PreS1 protein was amplified by PCR from pBluescript HBV plasmid [20] using a PreS1-specific forward primer with an NdeI site (50 - GGAATTCCATATGGGAGGTTGGTCTTCCAAACCT -30 ) and a reverse primer with an XhoI site (50 CCGCTCGAGGGCCTGAGGATGAGTGTC -30 ). The amplified DNA fragment was inserted upstream of the His6-Tag sequence in the pET30a(+) expression vector (Novagen, Madison, WI) under the control of the T7 promoter. The sequence of the constructed plasmid was confirmed by restriction digestion and sequencing. The PreS1 protein was purified with Ni-NTA agarose affinity chroma-

634

W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637

tography (Qiagen, Valencia, CA) and desalted with a Waters C18 column. 2.2. Library screening The (Ph.D.)-12 peptide library was used to screen for PreS1 binding peptides by the biopanning procedure according to the manufacturer’s protocol. In short, biopanning was carried out by incubating the phage display library (1011 phages/ml), which expressed random peptides that were 12 amino acids in length with the target protein. After washing away the unbound phage, a bound phage was eluted in Tris-buffered saline (TBS) and amplified in Escherichia coli ER2738. The amplified phage was titered to determine the concentration and then subjected to the next round. After five rounds of biopanning, all 39 plaques from the optimal titering plate (plate have < 100 plaques) were picked and amplified. 2.3. DNA sequencing Single-stranded DNA from selected amplified phage clones was isolated by denaturing the coat proteins with iodide buffer (10 mM Tris–HCl, 1 mM EDTA, and 4 M NaI, pH 8.0) and precipitating with ethanol. DNA was sequenced by Sangon Sequencing (Shanghai, China) using the -96 gIII sequencing primer CCCTCATAGTTAGCGTAACG provided by NEB. 2.4. Phage enzyme-linked immunosorbent assay (ELISA) ELISA plate wells (Greiner, Germany) were coated with the PreS1 solution (100 lg/ml) in 0.1 M NaHCO3, pH 8.6, overnight at 4 °C and blocked with 250 ll of blocking buffer (5% BSA) for 2 h at 4 °C. An uncoated plate was also blocked to distinguish true target binding from binding to BSA or the plastic support. Four-fold serial dilutions of the selected phages were added to both coated and uncoated plates starting with 1012 phages in the first well. Plates were incubated for 2 h at room temperature and then washed 6 times with TBST (TBS containing 0.5% Tween-20). Bound phage was then detected with a horseradish peroxidase (HRP)-conjugated anti-M13 antibody (GE Healthcare). Finally, the peroxidase activity was developed with substrate solution (0.22 mg/ml azinobis (3-ethylbenzthiazoline sulfonic acid) diammonium salt (ABTS) in 50 mM citric acid, 0.05% H2O2, pH 4.0). The absorbance of the reaction was determined at 405 nm with a Thermo Multiskan ELISA reader (MA, USA). 2.5. Peptide synthesis The selected peptides were synthesized as the C-terminus amidated form by HD Biosciences (Shanghai, China). C-amidation was used because the C-terminal residue of the displayed sequence was fused to the phage during panning. A synthetic peptide with a free charged carboxy terminus would introduce a negative charge, which would likely completely abolish binding; therefore, the Cterminal carboxylates of the synthetic peptides were amidated. The final purity of the peptide was 98%. The peptides were dissolved in PBS to obtain a 50 mM stock solution. The stock solution was stored at 70 °C.

mined by a reference run were subtracted from the experimental values. Calorimetric data were analyzed using MicroCal ORIGIN software 5.0. The amount of heat evolved upon the addition of ligand can be represented by the equation Q ¼ V 0 DHb ½Mt K a ½L=ðl þ K a ½LÞ, where V0 is the volume of the chamber, DHb is the enthalpy of binding per mole of ligand, [M]t is the total macromolecule concentration including bound and free fractions, Ka is the binding constant, and [L] is the free ligand concentration. The enthalpy change for each injection series was calculated by integrating the area under the recorded peaks for the enthalpy changes and then subtracting the value for the control titration. 2.7. Inhibitory activity of synthetic peptides The inhibition activity of the synthetic peptides was evaluated via ELISA (Fig 4A). The detection of PreS1 using a commercial diagnostic kit for HBV PreS1 antigen (Kehua Biotech, Shanghai, China) was performed according to the manufacturer’s instructions. Two-fold serial dilutions of the peptides were incubated with the equivalent volume of positive control solution that contained HBV virions at 37 °C for 1 h. The mixture was transferred to microtiter wells coated with an anti-PreS1 monoclonal antibody and incubated for 30 min at 37 °C. The wells were washed and incubated with HRP-labeled anti-HBs for 30 min at 37 °C. Color was developed and measured as described above. 3. Results 3.1. Expression and purification of PreS1 PreS1 was found predominantly in the supernatant of the bacterial lysate, which indicated that PreS1 was soluble. As shown in Fig. 1A, PreS1 could be successfully separated from the lysate mixture, and a few contaminants were detected by SDS–PAGE analysis. HPLC was used to desalt the protein and improve the purity. As shown in Fig. 1B, a major peak eluted at approximately 34 min; this peak was identified as PreS1 using SDS–PAGE (data not shown). Peaks eluted at the beginning (4 min) and retention times greater than that of PreS1 (37–43 min) were identified as salt and contaminants, respectively. The concentration of purified PreS1, estimated by the absorbance at 280 nm, was 2 mg/ml. 3.2. Phage ELISA After the 5th panning round, a total of 39 phage clones were selected and amplified as described above. As shown in Fig. 2, the absorbance obtained from each phage combined with the target protein was significantly higher than that of the control (i.e., BSA), and the binding efficiency was concentration-dependent (data not shown). Because it was hard to obtain a precisely uniform phage titer, all of the phages were assayed in the concentration range of 1012–1013; therefore, the absorbance values did not correlate with the phage binding affinity. All of the positive clones specifically bound to PreS1, but the higher absorbance values might not be indicative of stronger binding. 3.3. Sequences analysis of selected phages

2.6. Isothermal titration calorimetry (ITC) ITC measurements were carried out at 25 °C using a VP-ITC titration calorimeter (MicroCal, Northampton, MA). Degassed peptide solutions were added at a concentration of 1 mM into the reaction chamber containing PreS1 at a concentration of 20 lM. To account for the thermal effects of dilution and mixing, heats deter-

The coding sequences of all 39 positive clones were determined, and the corresponding peptide sequences were deduced. A total of seven distinct sequences were found (Table 1), and among the 39 positive clones, P7 occurred, remarkably, 28 times. An interesting feature of these peptides was the frequent presence of histidine residues, implying that histidine is a common feature required

635

W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637

A

15

M

B

1

Table 1 Enrichment and analysis of PreS1-specific phages by biopanning.

*

10 Fig. 1. Expression and purification of PreS1. (A) SDS–PAGE analysis of PreS1. Lane M: protein marker (the molecular weight is indicated on the left); Lane 1: PreS1 (13.4 kDa) is indicated with an asterisk. (B) HPLC analysis: fragments were eluted using a linear water/acetonitrile/0.1% TFA gradient ranging from 5% to 95% acetonitrile in 60 min.

for PreS1 binding among these peptides. Alignment of the peptides revealed a putative PreS1 binding consensus motif: HXnHXmHP/R (X represents a random amino acid, and n and m may be 1, 2, or 3). The three histidine residues were highly conserved among the seven sequences except in P4. Neutral amino acids, such as tryptophan/serine/methionine, were observed next to the first and second histidines. In contrast, the position adjacent to the last histidine showed a preference for the basic amino acid arginine or the amide acid proline. 3.4. Thermodynamic characterization of synthetic peptides ITC is the most quantitative means available for measuring the thermodynamic properties of a protein–protein interaction. This method detects the heat absorbed or released during the binding reaction (i.e., the binding enthalpy) [21,22]. In our study, binding equilibrium data were confirmed directly by measuring the heat evolved upon the association of a ligand peptide with its target binding protein. As the ligand concentration increased, the association reaction became saturated, and subsequently, less heat was evolved or absorbed upon further addition of the material under titration. ITC is a universal method that has been applied to a wide range of chemical and biochemical binding interactions [23–25]. Numerous examples of antibody–antigen binding have been characterized by ITC. Very tight binding complexes, such as antibody–antigen interactions, yield Ka values in the range of 109– 1010 M 1, while complexes of strong-to-medium strength give Ka values in the range of 104–106 M 1, and complexes with low binding affinities yield Ka values of less than 102 M 1 [22]. We

Abs 2.5

No.

Phage clones

Frequency

Deduced amino acid sequences

P1 P2

52, 57, 518

3/39

HWGNHSKSHPQR

56, 58

2/39

HTLHRQVPKHWL

P3

515, 521

2/39

HYQHNTHHPSRW

P4

53

1/39

HSSSASDRSRPL

P5

522

1/39

STHHRHYHDTLA

P6

59, 67

2/39

GHIHSMRHHRPT

P7

51, 54, 55, 510, 511, 512, 513, 514, 516, 517, 519, 520, 523, 524, 525, 526, 527, 528, 529, 530, 61, 62, 63, 64, 65, 66, 68, 69

28/39

KHMHWHPPALNT

Consensus motif

HXnHXmHP/R

determined the binding abilities of seven peptides for PreS1 (Fig. 3). The value of Ka obtained from P7 was the highest, indicating that P7 has the highest affinity for PreS1 among the seven peptides. Our experimental results provide evidence of a strong binding interaction between P7 and the PreS1 protein. 3.5. P7 blocking HBV attachment As the most enriched peptide and having the tightest binding abilities, P7 was hypothesized to block the attachment of HBV effectively. This attachment was analyzed by ELISA. As shown in Fig. 4A, when preincubated with HBV virions, P7 shielded the key sites of PreS1 and prevented HBV from binding with the PreS1 antibody. With higher concentrations of P7, more virus was blocked and absorbance values were lower. As shown in Fig. 4B, treatment with 0.02–25 mM peptide clearly inhibited the binding of HBV to the PreS1 antibody in a dose-dependent manner, which indicated that this peptide could effectively block the relevant epitope of PreS1. 4. Discussion Inhibition of HBV infection of hepatocytes is a rational target for the treatment of hepatitis B. Molecules or ligands that specifically bind to HBV will likely interfere with viral attachment and hence reduce or block infection. It has been reported that several preS1-derived lipo-peptides exhibit great inhibitory activity against HBV infection [10,26–30]. However, the lipo-peptides interfere with HBV infection via interacting with hepatocyte receptors, whereas the phage-display-derived peptides interact with the virus directly. Meanwhile, these lipo-peptides, analogs of the preS1 fragment, generally contain approximately 40 amino residues with

PreS1 BSA

2 1.5 1 0.5 0 c1

c3

c5

c7

c9 c11 c13 c15 c17 c19 c21 c23 c25 c27 c29 c31 c33 c35 c37 c39

Fig. 2. Binding capacity of the selected phage against PreS1. Data are expressed as means ± SD.

636

W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637

A

B Ka P1

7081±1693

P2

1433±542.8

P3

532.2±1030

P4

1527 ±1344

P5

3121±117

P6

6437±1342

P7

7.21×104±4.15×104

Fig. 3. ITC profiles of the binding of peptides to PreS1. (A) Ka values of seven peptides, among which the values for P7 was the highest. (B) Top: data obtained from 28 automatic injections of sequential 10 ll aliquots of a 1 mM P7 solution injected into a 20 lM PreS1 solution. Bottom: the integrated curve of enthalpy generation showing points (squares) and the best fit (line). Plot of the heat evolved per mole of P7 added against the molar ratio of peptide to PreS1.

A

Abs (% of positive control)

B 120 100 80 60 40 20 0

25.00 12.50 6.25

3.13

1.56

0.78 0.39 P7, mM

0.20

0.10

0.05

0.02

Fig. 4. P7 prevents PreS1 from binding to antibody. (A) Schematic of the inhibition ELISA. (B) P7 blocked HBV attachment in a dose-dependent manner.

a molecular weight of approximately 4.5 kDa, making these peptides more likely to promote an immune response. A group of HBV PreS1 binding peptides were identified in this study by screening a phage display library of random peptides. All of the selected phages showed PreS1 binding activity in phage ELISA. A remarkable feature of these peptides was the high frequency of histidine residues, which may mediate the interaction of proteins with lipid/water interfaces due to this residue’s positive charge. Alignment of the peptides led to the discovery of a short consensus motif, HXnHXmHP/R. The backbone motif structure contained

three histidine residues. The amino acid following the first histidine was most commonly methionine (M). In some cases, this position was occupied by amino acids containing a hydroxyl group (threonine (T), tyrosine (Y) and serine (S)). In the position next to the second histidine, tryptophan (W) was most frequently observed. Proline was also conserved among the selected peptides, although a preference for the basic amino acids arginine (R) was also observed. Proline is more conformationally restricted than other amino acids. Because its cyclically bonded structure fixes its conformational degrees of freedom, proline-containing peptides possess the ability to turn and reorient to produce the required compact structure in a relatively stable manner [31]. Among the 39 positive phages, 28 (72%) contained a consensus sequence, KHMHWHPPALNT, which implies that this sequence was highly enriched. Another feature of P7 was its ability to block HBV virions in addition to blocking the single recombinant protein. The viral particle bears natural and intact conformational immunogenic determinants. Thus, viral particles are better for the identification of neutralizing inhibitors rather than a single PreS1 protein. The blocking ELISA showed that P7 was able to abrogate the binding of HBV PreS1-positive sera to the antibody of PreS1 suggesting that P7 covered key functional sites of native HBV virions. Our data showed that P7 could successfully recognize and block the PreS1 attachment. Furthermore, the conserved motif HXnHXmHP/R, which was preferentially selected in the screen, was identified. Additional modification of this scaffold to facilitate even higher affinity should allow it to serve as a delivery vehicle for imaging, diagnostics, and therapeutic agents to tissues affected by HBV. Acknowledgments This study was supported by National Key Scientific Program (the 973 program, 2010CB530100), the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-YW-R-147), and China Mega-Project for Infectious Diseases grants (2008ZX10002009).

W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637

References [1] D. Ganem, A.M. Prince, Hepatitis B virus infection-natural history and clinical consequences, New England Journal of Medicine 350 (2004) 1118–1129. [2] B. Rehermann, M. Nascimbeni, Immunology of hepatitis B virus and hepatitis C virus infection, Nature Reviews Immunology 5 (2005) 215–229. [3] T.L. Wright, Introduction to chronic hepatitis B infection, American Journal of Gastroenterology 101 (2006) S1–6. [4] E. Cholongitas, J. Goulis, E. Akriviadis, G.V. Papatheodoridis, Hepatitis B immunoglobulin and/or nucleos(t)ide analog(s) for prophylaxis from hepatitis B virus recurrence after liver transplantation: a systematic review, Liver Transplantation (2011). doi: 10.1002/lt.22354. [5] M. Viganò, P. Lampertico, Antiviral drugs for HBV liver disease, Expert Opinion on Biological Therapy 11 (2011) 285–300. [6] P. Marcellin, T. Asselah, N. Boyer, Treatment of chronic hepatitis B, Journal of Viral Hepatitis 12 (2005) 333–345. [7] Q. Deng, J.W. Zhai, M.L. Michel, J. Zhang, J. Qin, Y.Y. Kong, X.X. Zhang, A. Budkowska, P. Tiollais, Y. Wang, Y.H. Xie, Identification and characterization of peptides that interact with hepatitis B virus via the putative receptor binding site, Journal of Virology 81 (2007) 4244–4254. [8] V. Bruss, D. Ganem, The role of envelope proteins in hepatitis B virus assembly, Proceedings of the National Academy of Sciences of the United States of America 88 (1991) 1059–1063. [9] V. Bruss, Hepatitis B virus morphogenesis, World Journal of Gastroenterology 13 (2007) 65–73. [10] J. Petersen, M. Dandri, W. Mier, M. Lütgehetmann, T. Volz, F. von Weizsäcker, U. Haberkorn, L. Fischer, J.M. Pollok, B. Erbes, S. Seitz, S. Urban, Prevention of hepatitis B virus infection in vivo by entry inhibitors derived from the large envelope protein, Nature Biotechnology 26 (2007) 335–341. [11] P. Gripon, J. Le Seyec, S. Rumin, C. Guguen-Guillouzo, Myristylation of the hepatitis B virus large surface protein is essential for viral infectivity, Virology 213 (1995) 292–299. [12] J. Le Seyec, P. Chouteau, I. Cannie, C. Guguen-Guillouzo, P. Gripon, Infection process of the hepatitis B virus depends on the presence of a defined sequence in the preS1 domain, Journal of Virology 73 (1999) 2052–2057. [13] A. Barrera, B. Guerra, L. Notvall, R.E. Lanford, Mapping of the hepatitis B virus pre-S1 domain involved in receptor recognition, Journal of Virology 79 (2005) 9786–9798. [14] D. Glebe, S. Urban, E.V. Knoop, N. Cag, P. Krass, S. Grün, A. Bulavaite, K. Sasnauskas, W.H. Gerlich, Mapping of the hepatitis B virus attachment site by use of infection-inhibiting preS1 lipopeptides and tupaia hepatocytes, Gastroenterology 129 (2005) 234–245. [15] M. Engelke, K. Mills, S. Seitz, P. Simon, P. Gripon, M. Schnölzer, S. Urban, Characterization of a hepatitis B and hepatitis delta virus receptor binding site, Hepatology 43 (2006) 750–760. [16] S.S. Sidhu, Phage display in pharmaceutical biotechnology, Current Opinion in Biotechnology 11 (2000) 610–616.

637

[17] J.K. Scott, G.P. Smith, Searching for peptide ligands with an epitope library, Science 249 (1990) 386–390. [18] G. Castel, M. Chtéoui, B. Heyd, N. Tordo, Phage display of combinatorial peptide libraries: application to antiviral research, Molecules 16 (2011) 3499–3518. [19] S.F. Parmley, G.P. Smith, Antibody-selectable filamentous fd phage vectors: affinity purification of target genes, Gene 73 (1988) 305–318. [20] K.L. Wu, X. Zhang, J. Zhang, Y. Yang, Y.X. Mu, M. Liu, L. Lu, Y. Li, Y. Zhu, J. Wu, Inhibition of Hepatitis B virus gene expression by single and dual small interfering RNA treatment, Virus Research 112 (2005) 100–107. [21] S. Majumdar, A. Hajduczki, R. Vithayathil, T.J. Olsen, R.M. Spitler, A.S. Mendez, T.D. Thompson, G.A. Weiss, In vitro evolution of ligands to the membrane protein caveolin, Journal of the American Chemical Society 133 (2011) 9855– 9862. [22] G. Zolotnitsky, U. Cogan, N. Adir, V. Solomon, G. Shoham, Y. Shoham, Mapping glycoside hydrolase substrate subsites by isothermal titration calorimetry, Proceedings of the National Academy of Sciences of the United States of America 101 (2004) 11275–11280. [23] H.Y. Wu, X.L. Zhang, Q. Pan, J. Wu, Functional selection of a type IV pili-binding peptide that specifically inhibits Salmonella Typhi adhesion to/invasion of human monocytic cells, Peptides 26 (2005) 2057–2063. [24] J. Tao, J.J. Xiang, D. Li, N. Deng, H. Wang, Y.P. Gong, Selection and characterization of a human neutralizing antibody to human fibroblast growth factor-2, Biochemical and Biophysical Research Communications 394 (2010) 767–773. [25] X. Zhou, R.M. Kini, J. Sivaraman, Application of isothermal titration calorimetry and column chromatography for identification of biomolecular targets, Nature Protocols 6 (2011) 158–165. [26] P. Gripon, S.J. Le, S. Rumin, C. Guguen-Guillouzo, Myristylation of the hepatitis B virus large surface protein is essential for viral infectivity, Virology 213 (1995) 292–299. [27] J. LeSeyec, P. Chouteau, I. Cannie, C. Guguen-Guillouzo, P. Gripon, Infection process of the hepatitis B virus depends on the presence of a defined sequence in the pre-S1 domain, Journal of Virology 73 (1999) 2052–2057. [28] A. Barrera, B. Guerra, L. Notvall, R.E. Lanford, Mapping of the hepatitis B virus pre-S1 domain involved in receptor recognition, Journal of Virology 79 (2005) 9786–9798. [29] D. Glebe, S. Urban, E.V. Knoop, N. Cag, P. Krass, S. Grun, A. Bulavaite, K. Sasnauskas, W.H. Gerlich, Mapping of the hepatitis B virus attachment site by use of infection-inhibiting preS1 lipopeptides and tupaia hepatocytes, Gastroenterology 129 (2005) 234–245. [30] D.H. Kim, Y. Ni, S.H. Lee, S. Urban, K.H. Han, An anti-viral peptide derived from the preS1 surface protein of hepatitis B virus, BMB Reports 41 (2008) 640–644. [31] H.B. Lowman, Y.M. Chen, N.J. Skelton, D.L. Mortensen, E.E. Tomlinson, M.D. Sadick, I.C. Robinson, R.G. Clark, Molecular mimics of insulin-like growth factor 1 (IGF-1) for inhibiting IGF-1: IGF-binding protein interactions, Biochemistry 37 (1998) 8870–8878.