Cloning and sequencing of the aculeacin A acylase-encoding gene from Actinoplanes utahensis and expression in Streptomyces lividans

Cloning and sequencing of the aculeacin A acylase-encoding gene from Actinoplanes utahensis and expression in Streptomyces lividans

Gene, 119 (1992) 29-35 Q 1992 Elsevier Science Publishers GENE B.V. All rights reserved. 29 0378-l 119/92~$05.00 06637 Cloning and sequencing of...

1MB Sizes 0 Downloads 4 Views

Gene, 119 (1992) 29-35 Q 1992 Elsevier Science Publishers

GENE

B.V. All rights reserved.

29

0378-l 119/92~$05.00

06637

Cloning and sequencing of the aculeacin A acylase-encoding gene from Act inoplanes u t ahensis and expression in St reptomyces lividans (Recombinant

DNA;

oligodeoxyribonucleotide;

protein

secretion;

gene dosage effect; precursor;

amino acid sequence

ho-

mology)

Junji Inokoshi a, Hideo Takeshima”,

Haruo Ikedab

uResearch Center for Biological Function, The Kitasato Institute, Minato-ku, Minato-ku, Received

and Satoshi

Gmuraa

Tokyo, Japan: and ’ School of Pharmaceutical

Sciences, Kitasato

Univemity,

Tokyo, Japan by K.F. Chater:

20 January

1992; Accepted:

6 March

1992; Received

at publishers:

1 June 1992

SUMMARY

Aculeacin A acylase (AAC), produced by Acti~o~la~es utahensis, catalyzes the hydrolysis of the palmitoyl moiety of the antifungal antibiotic, aculeacin A. Using mixed oligodeoxyribonucleotide probes based on the N-terminal amino acid faa) sequences of the two subunits of AAC, overlapping clones were identified in a cosmid library of A. utuhensis DNA. After the sub-cloning of a 3.0-kb fragment into Streptomyces Zividans,the recombinant produced AAC extracellularly. The nucleotide sequence of this fragment predicted an open reading frame of 2358 bp with GTG start and TGA stop codons. The deduced 786-aa sequence should correspond to a single polypeptide chain, indicating that this polypeptide is processed to the active form which is composed of the two subunits. Threefold more AAC was obtained from the S. Zividansrecombinant carrying the cloned gene than the original A. utahensis strain.

~tahens~s NRRL12052

INTRODUCTION

Aculeacin A (AcuA) was isolated and characterized as an anti-yeast and anti-fungal antibiotic (Mizuno et al., 1977). AAC catalyses the deacylation of AcuA and related compounds to give a hexapeptide moiety (peptide nucleus) and a long chain fatty acid (Debono, 1981). The enzyme has been isolated from culture filtrates of Actinoplanes

C~~e~~ndence tion, Kitasato

to: Dr. S. amum, Institute,

Tel. (81-3)34&t-6161; Abbreviations:

Shirokane

performance cleotide(s);

Center for Biological Minato-ku,

Tokyo

Func-

108, Japan.

Fax (81-3)3444-6316.

A., Actinoplanes;

acylase; sac, gene encoding base pair(s); err&,

Research S-9-1,

aa, amino

acid(s);

AAC; AcuA, aculeacin

gene encoding

liquid chromatography;

erythromycin

resistance;

kb, kilobase

oligo, oligodeoxyribonucleotide;

AAC,

ORF,

aculeacin

A; Ap, ampicillin; HPLC,

A bp,

or 1000 bp; nt, nuopen reading

tsr, gene encoding Th resistance:

[ 1, denotes

RESULTS

AND DISCUSSION

highframe;

PAGE, polyacrylamide-gel electrophoresis; S., Streptomyces; SDS, sodium dodecyl sulfate; Th, thiostrepton; TSB, trypticase soy broth (BBL Inc.); state.

and shown to consist of two dissimilar subunits of 55 kDa and 19 kDa (Takeshima et al., 1989). Both subunits are needed for deacylation activity. The enzyme is useful in producing peptide nuclei for creating new antifungal agents by introducing different acyl moieties. A. utuhensis NRRL12052 secretes 1.5 pg AAC/ml culture medium. However, it is difficult to purify AAC with high yields from these cultures since AAC is complexed with pigments in the culture filtrate. To solve this problem, and to investigate the genetic dete~ination of the enzyme, we have cloned the DNA encoding AAC and examined its expression in Streptomyces iividans.

the plasmid-carrier

(a) Determination of aa sequence of AAC and preparation of oligo probes The aa sequences of the N-termini of the two subunits of AAC, 20 and 21 aa residues for A and B subunit, respectively (Fig. 1), were determined. Two 29-nt oligo probes

30 A

probes. Plasmid DNAs from these clones were digested with BarnHI, &I, or BgZII, and analyzed by Southern blot hybridization using both probes. Hybridizing 7.5kb, 6.0kb, and 4.0-kb fragments obtained with BglII, BarnHI, and PstI, respectively, were found for 12 of the 16 clones. The other four clones probably contained only a part of the sac genes. Bands of the same size were detected in genomic Southern hybridization analysis, and presumptively contained both genes for the A and B subunits of AAC. The restriction cleavage map of one of these clones, designated pKAA1, is shown in Fig. 2. The 7.5kb ~g~II-fragment was further analyzed by Southern hybridization. A 1S-kb_XhoIBamHI fragment gave a positive response with both probes.

NW1-Srr-&e-1LI&-Tyr-G~y-~~-G~y-~a-G~~-~8-

subunit

au2

GCO TAC GGC CTG GGC alza C&G GCG C C c C

-Thr-Val-Am-lily-SW-Gly-blot-Val-La,-AlaAC

B subunit

MHz-Gly-Gly-Tyr-~~-Alr-Iru-~llr-&g-~-~8GCG C -Ser-or-Oly-Val-Pro-Eia-ale-Thr-lllrTOO TAC GGC GM CC0 C&C ATC ACC GC cc c c

Fig. 1. N-terminal probe sequences.

aa sequences

of the AAC

The two dissimilar

oligo

of AAC were initially pu-

rified from

the culture

(Takeshima

et al., 1989), and then further purified by HPLC programmed

for a linear gradient

filtrate

and corresponding

subunits

of A. ~~u~e~~j~ as reported

of 5 to 75% acetonitrile

fluoroacetic

acid. The peak fractions

fied subunit

(0.5 to 1.9 nmol) was applied

protein

sequencer

derivatives Zorbax

470A

for Edman

of aa were analyzed

CN column,

containing

were pooled

0.1% (v/v) tri-

and dried. Each puri-

to the Applied

degradation.

qu~titatively

using the Spectra

previously

by HPLC

Physics

Biosystems

SP8100

of sac gene in Streptomyces lividans

(c) Expression

Phenyhhiohydantoin

To confirm whether the cloned fragment in pKAA1 contained sac, the 7%kb BglII fragment in pKAA1 was subcloned into S. Zividans JT46 (Tsai and Chen, 1987), and transformants were examined for AAC production. (Actinoplanes and Streptomyces are both genera of actinomycetes and have high G+C contents, thus, it was assumed that sac might be expressed in S. ljvidans.) The 7.5-kb BglII fragment of pKAA1 was inserted into a Streptomyces multicopy vector, pKU109 [tsr, pIJlO1 (Kieser et al., 1982) derivative, constructed by H. Ikeda]. The recombinant plasmid (pKAA103) was introduced into S. lividans JT46. The transfo~~t was grown at 30°C for 4 days in TSB me-

on a DuPont

system.

corresponding to the two subunits were then designed utilizing preferred codons from Streptomyces genes which have a typically high third-position codon bias for G or C within the coding region (Fig. 1). (b) Cloning of sac gene from Actinoplanes utahensis

A cosmid library of A. utahensis DNA was screened using the 32P-labeled oligos as probes. Out of 32000 colonies screened, 16 showed a positive response against both A

*.

4

1

me

j

i

ii

:-:

lkb

i

Fig. 2. Restriction acylase-encoding

endonuclease

map of pKAA1

gene and its transcriptional

;’

:



AACPmducGon

(A) and location of uuc gene (B). Vector DNA is shown as a thinner iine. An arrow represents

orientation.

Methods. For the preparation

of genomic

DNA, A.

utuhensis

the putative

was grown in TSB medium

sup-

plemented with 0.4% (w/v) glycine. The genomic DNA of A. u6ahe~~ was prepared (Hopwood et al., 1985) and digested partially with Mbol to achieve an average fragment size of40 kb. The restriction fragments were ligated with the 3.8kb BgiII fragment of cosmid pKU400 [pUCl8::uphII (2.9-kb Hind111 fragment phages

of TnS)::cos,

constructed

by H. I.] and the ligated DNA was packaged

were used to infect E. coli JMl08

(Yanisch-Perron

50 pg Ap/ml. Two 29-nt mixed oligo probes were labeled with library of A. utahensis. Transductants 123 were constructed by inserting

dialyzed against 10 mM Na.phosphate aration of plasmid from E. coli and S. were as in Sambrook

[ y-s’P]ATP

pKUl09.

in vitro (Horn

and Murray,

were selected on SOB agar (Ham&an,

using T4 polynucleotide screen TM for hybridization

were transferred to colony/plaque various regions from pKAA1 in BgtII digested

Stre~zonzJxes, and antibiotic concentrations tivity of AAC was measured as previously

cedures

into i, phage particles

et al., 1985) and the transductants

1977). The mature 1983) containing

kinase, and were used as probe to screen the cosmid (Sambrook et al., 1989). Plasmid pKAAl03-108 and Media,

methods

of cultivation

and ~~sfo~atjon

buffer (pH 7.0) for 6 h at 4”C, and the dialysates were assayed for AAC activity. Large- and small-scale was carried out by the method of Kieser (1984). Recombinant DNA techniques and electrophoretic

lividam

et al. (1989).

for

used for maintaining plasmids in E. coli and S. fividms were as described (Hopwood et al., 1985). The acdescribed (Takeshima et al., 1989). Culture filtrates from 96 h cultures of transformants of S. lividans were preppro-

31 dium, and AAC activity of the culture filtrate was measured. The reversed phase HPLC profiles of the reaction product are shown in Fig. 3. The retention time of the authentic peptide nuclei was 9.5 min at the conditions used (Fig. 3A). The reaction product obtained with the culture filtrates of S. Zividuns[pKAAl03] and of A. utuhensis had the same retention time (Fig. 3C and D), indicating that AAC was encoded in the 7.5-kb BglII fragment. To localize sac more closely, the 6,0-kb BamHI fragment and 4.0-kb PstI fragment which gave a positive response against probes in the Southern hyb~dization analysis were subcloned and examined for their ability to cause AAC activity in S. iividans IT46 The smallest fragment capable of causing activity was the 3.0-kb ClaI-PstI fragment present in pKAA104107 (Fig. 2B). This suggested that the genes for both subunits are encoded on this fragment. To determine the transcriptional direction for the gene, the 2.7-kb &I-BamHI fragment was subcloned into M 13mplO and M13mpll (Messing and Vieira, 1982), and the recombinant phages were analyzed by dot blot hybridization using the synthetic oligo probes as shown in Fig. 1. Both probes hybridized only to the Ml3mplO DNA, suggesting that the sac gene was transcribed as shown in Fig. 2. (d) Nucleotide sequence of the UC gene The nt sequence of the 3.0-kb CZaI-PstI fragment was determined (Fig. 4). The sequence contains one ORF of 2358 nt with GTG start codon and TGA stop codon. There are five potential start codons between the CZaI site and the N-terminal aa codon of the B subunit. We assumed that the A

c

B

II-

0

IO Tlme (min)

20 0

nm

200

D

IO

200

Time (mln)

(mln)

Time (mln

Fig. 3. Reversed phase HPLC profiles ofthe reaction products and the authentic

peptide

which is one of the products extracted

nucleus.

To detect

of AAC activity,

with two volumes of n-butanol

from AcuA

the cyclic peptide the reaction

nuclei,

mixtures

to remove remaining

)

were

AcuA after

termination of the reaction, and the aqueous layers were analyzed by reversed phase HPLC. The samples were injected to a YMC-Pack A-302 column pre-equilibrated

with a mixture of water, acetonitrile,

acetic acid,

and pyridine (96:2: 1: 1). Then the column was developed at a flow rate of I.0 ml/min with the same solvent. The eluents were monitored at 280 nm. (A)The authentic

sample of peptide nuclei; (B, C, and D) reaction

product

after incubation with culture filtrate from S. lividam JT46 (B), from S. ~j~jd~~~[pKAAlO3~ (C), and from A. uta~e~js NRRL12052 (D).

first GTG serves as the start codon because a putative ribosome binding site, GGAGaTG showing complementarity to the 3’ end of 16s rRNA of S. lividans (Bibb and Cohen, 1982) is present 6 bp upstream. The N-terminal aa sequence of each subunit (Fig. 1) showed a perfect match with sequences deduced from the ORF. The translated protein contains 786 aa residues, with an M, of 84067. In the region flanking the sac gene at the 3’ side, an inverted repeat sequence was found at position 2438 with a stability value of -35.60 kcal/mol calculated according to Turner et al. (1987). The identified ORF supports the existence of a precursor, which would be processed to the two subunits. The B subunit is from the N-terminal part of the precursor and the A subunit from its C-terminal part. To confirm the precise sizes of the two subunits, the C-terminal aa positions of the subunits isolated from A. utahensis were determined with the aid of carboxypeptidase Y. While the C terminus of the A subunit did not give a clear result, because of being so poorly soluble in water, that of the B subunit was obtained as follows: ‘-Pro-Asp-Ala-COOH’. This corresponds to aa positions 212-214. Accordingly, the C terminus of the B subunit is separated from the N terminus of A subunit by a spacer peptide consisting of 15 aa. The calculated M,s of B and the assumed A subunits were 19100 and 60300, respectively, which are similar to the results by SDS-PAGE analysis of the purified enzyme (Takeshima et al., 1989). Such characteristics of the primary structure of AAC described above seem to be similar to those of penicillin G acylase (Bock et al., 1983), 7/I-(4-carboxybutanamido) cephalosporanic acid (GL7ACA) acylase (Matsuda et al., 1985), and cephalosporin acylase (Matsuda et al., 1987a). The first 34 aa residues of the ORF correspond to typical bacterial leader peptides (Perlman and Halvorson, 1983). The aa sequence of the C-terminal region of the presumed leader peptide (-ArgGln-His-Asp) is, however, somewhat unusual: in most secreted Streptomyces proteins, the cleavage site of leader peptidase is ‘Ala-Xaa-Ala’. There are three possible cleavage sites of leader peptidase in the first 34 aa residues, ‘Ala’“-Ala”-Ala’2’, “Ala’2-Ile’3-Ala’4’ and ‘Ala20-Thr21Ala22’. Based on these observations, it is assumed that the N-terminal region of the primary acylase protein is cleaved after secretion as in some Streptomyces proteins such as protease A and B in S. griseu.s(Henderson et al., 1987), and cc-amylase inhibitor in S. griseosporeus (Nagaso et al., 1988). Another possibility, that the recognition site of the leader peptidase in A, utahensis might be different from that of the Streptomyces, is unlikely because the AAC is secreted well by S. lividans. (e) The aa sequence of AAC

The aa sequence of AAC deduced from the ORF was compared with those of penicillin G acylase (Schumacher

32

1

91

181

GAGCGTGGTTGCTTCATCG GCCTGCCXAGCGATGAGAGTATGTGGGCGG @+i%P _--_

CCTGCCGCGCCCCGCCACCTCGGTGCGGGCCT

fMTSSYMRLKA GTGACGTCCT

AAIAFGVIVA TGCGCCTGAAAGCA GCAGCGATCGCCTTCGGTGTGATCGTGGCG

TAGAGC~C~~CGCC 0 r* TAAVPSPASG R ACCGCAGCCGTGCCGTCACCCGcTTCCGGc A *m;>GSL~

FGVGYVQAED NICVIAESVV CGGGAGCCTCGGT TTCGGCGTCGGGTACGTGCAGGCCGAGGAC AACATCTGCGTCATCGCCGAGAGCGTGGTG

271

TANGERSRWF 361

GATGPDDADV ACGGCCAACGGTGAGCGGTCGCGGTGGTTC G

RTTSSTQAID CGCACGACCTCTT 140

451

541

RGXAWVRPLS AGYNHFLRRT GVRRLTDPAC GCCGGCTACAACCA CTTCCTACGCCZCACC GGCGTGCACcGcCTGACCGACCCGGCGTGc CGC-CTGGGTGCGccCGCTcTCC

631

LDGIVAATPP EIDLWRTSWD SMVRAGSGAL GGGCCGGTTCCGGGGCGCTGCTCGACGGCATCGTCGCCGCGACGC GAGATCGATCTCTGGCGTACGTCGTGGGAC AGCATFT

721

230 LDGTSAGIG TAAGPASAPE A td AAIAAA ?k! ACAGCCGCCGGGCCCGCGTCAGCCccGGAG GCACCCGACGCCGCCGCGATCGcCd%CGCC CTCGACGGGACGAGCGCGGGCATCGGCAGC

811

#hVnT.cafifiT AACGCGTACGGCCT-

RYDVEGAALI GDPIIEIGHN FYRMHLKVPG TTCTACCGGATGCACCTCAAGGTGCCCGGC CGCTACGACGTCGAGGGCGCGGCGCTGATC GGCGACCCGATCATCGAGATCGGGCACAAC

290

901

TARRFVWHRL SLVPGDPTSY RTVAWSXTVS CGCACGGTCGCCTGGAGCCACACCGTCTCC ACCGCCCGCCGGTTCGTGTGGCACCGCCTG AGCCTCGTGCCCGGCGACCCCACCTCCTAT

320

991

ARTVTVQTGS GPVSRTFHDT YVDGRPERMR TACGTCGACGGCCGGCCCGAGCGGATGcGc GCCCGCACGGTCACGGTCCAGACCGGCAGC GGCCCGGTCAGCCGCACCTTCCACGACACC

350

1081

1171

RYGPVAVVPG C~AC~C~~CGT~T~C~

1261

VLDRHQFLPW RAFDGWLRMG QAKDVRALXA CGCGCCTTCGACGGGTGGCTGCGGATGGGC CAGGCCAAGGACGTCCGGGCGCTCAAGGCG GTCCTCGACCGGCACCAGTTCCTGCCCTGG

1351

440 PRVTGALAAA VNVXAADARG EALYGDHSVV GTCAACGTGATCGCCGCCGACGCGCGGGGC GAGGCCCTCTACGGCGATCATTCGGTCGTC CCCCGGGTGACCGGCGCGCTCGCTGCCGCC

1441

470 SRSDCALGAD CIPAPFQPLY ASSGQAVLDG TGCATCCCGGCGCCGTTCCAGCCGCTCTAC GCCTCCAGCGGCCAGGCGGTCCTGGACGGT TCCCGGTCGGACTGCGCGCTCGGCGCCGAC

1531

PASLPVRFRD DYVTNSNDSH PDAAVPGILG CCCGACGCCGCGGTCCCGGGCATTCTCGGC CCGGCGAGCCTGCCGGTGCGGTTCCGCGAC GACTACGTCACCAACTCCAACGACAGTCAC

1621

530 WLASPAAPLE GFPRILGNER TPRSLRTRLG TGGCTGGCCAGCCCGGCCGCCCCGCTGGAA GGCTTCCCGCGGATCCTCGGCAACGAACGC ACCCCGCGCAGCCTGCGCACCCGGCTCGGG

YURSOYVY.A(N CC GTGAAcGGcAGcGGGATGGTGCTGGccAAC

170

200 CG

P”FPWQGAER 260 CCGCACTTCCCGTGGCAGGGCGCCGAACGC

AITDVNAGNN ~T~~~ffiT~~C

TFDWTPATAY A~TTC~C~~GCC~CC~AC

380

LDQIQQRLAG TDGLPGXGFT TARLWQVMFG CTGGACCAGATCCAGCAGCGCCTCGCCGGC ACGGACGGTCTGCCCGGCAAGGGCTTCACC ACCGCcCGGcTcTGGCAGGTcATGTTCGGc

410

500

560

590 1801 SRGAKLFTEF A~CG~~~~CCTGTT~C~AGTTC

1891

VDLTAACTAL GTC~CCT~CC~~CCT~C~~TG

SRFDERADLD ~CC~TTC~T~~GT~CGACCT~C

1981

FEVTDPVRTP APFWNTTDPR 650 LAGGIRFADT CTCGCGGGCGGAATCAGGTTCGCCGACACC TTCGAGGTGACCGATCCGGTACGCACCCCC GCGCCGTTCTGGARCRCCRCGGATCCGCGG VRTALADACN GSPASPSTRS VGDIXTDSRG GTACGGACGGCGCTCGCCGACGCGTGCAAC GGCTCGCCGGCATCCCCCTCGACGCGAAGC GTGGGAGACATCCACACCGACAGCCGCGGC

680

2071

GEAGTFNVIT NPLVPGVGYP ERRIPIHGGR GAACGGCGCATCCCCATCCACGGTGGCCGC GGGGAAGCAGGCACCTTCAACGTGATCACC AACCCGCTCGTGCCGGGCGTGGGATACCCG

710

2161

QVVHGTSFVM CAGGTCGTCCACGGAACATCGTTCGTGATG

AVELGPHGPS GRQILTYAQS GCCGTCGAACTCGGCCCGCACGGCCCGTCG GGACGGCAGATCCTCACCTATGCGCAGTCG

740

2251

DTIXYTEAQI TNPNSPWYAD QTVLYSRXGW ACGAACCCGAACTCACCCTGGTACGCCGAC CAGACCGTGCTCTACTCGCGGAAGGGCTGG GACACCATCAAGTACACCGAGGCGCAGATC

770

2341

2431

AADPNLRVYR VAQRGR’ GCGGCCGACCCGAACCTGCGCGTCTACCGG GTGGCACAGCGGGGACGCTGACCCACGTCA CGCCGGCTCGGCCCGTGCGGGG GCGCAGGG

2521 -*Y

2611 2701 2791 2881

Fig. 4. The nt sequence arrows

downstream

~G~CG~~~~

G~GTT~~CGT~~~C @X!ATCCGTGTACACATGCCGGGCGCCGGT GATGCCGTGCAWCGGTAATAGGCCATCGG GGCGTGGGTCAGGTCCAGCTCCTGGCACAAG-CCCTCGACCACCTCGTCGC-GC GCCGGCCGCTCGGWGCAGAACTCA~G

~~TGC~~TGT~~~TC CGTCAGATCGCGXGCAGGAA

CGGGTCGGC

GCGGGTC-CWCACC-G

TCGCGCGATGGCGGGTTCGGTCGGCCGGAA ACTCGCCGGGCACT

of sac gene and deduced

from the stop codon

aa sequence.

show an inverted

Numbers

4%

at the left and right of each lane represent

repeat possibly

serving as a transcriptional

terminator.

nt and aa, respectively. The underlined

The facing

nt sequences

repre-

sent a potential ribosome-binding site (rbs) and selected restriction enzyme target sites. The boxed sequences indicate aa residues determined by N- and C-terminal aa sequencing. The downward arrows indicate posttranslational processing sites for the leader peptide and the subunits. An asterisk indicates the stop codon. The B and the presumed

A subunits

are located at aa positions

35-214

and 230-786,

respectively.

The 4.0-kb PstI fragment

was subcloned

in pBluescriptIISK+ (Stratagene, La Jolla, CA) in both orientations, and successive deletions were created by digestion with exonuclease III and mung bean nuclease (Henikoff, i984). DNA sequencing was carried out by the dideoxy-chain termination method (Sanger et al., 1977) using 7-deaza-dGTP and Sequenase

ver. 2.0 (Stratagene)

according

actions were performed at 42°C. Sequencing The nt sequence data reported in this paper D90543.

to the recommendations

of the supplier

but with some modifications:

the elongation

and termination

re-

data were compiled, edited, and analyzed using the SDC GENETYX (Software development Co., LTD.). will appear in the DDBL, EMBL and GenBank Nucleotide Sequence Database under the accession No.

33 et al., 1986), GL-7ACA acylase (Matsuda et al., 1985), and cephalosporin acylase (Matsuda et al., 1987b). There was no overall similarity, but the N-terminal regions of their small and large subunits showed some homologies, respectively (Fig. 5). These enzymes contain the following common characteristics: fi) they catalyze deacylation of substrates, (ii) their genes are translated as single precursor polypeptide and then processed to the active form consisting of two subunits. It has been reported that the small subunit of the penicillin G acylase from Proteus rettgeri contains a domain that imparts specificity for the substrate (Daumy et al., 19X.5), so the homologous sequences of the small subunits might be related to this function. Further, it is supposed that the homologous sequence of N-terminal regions of the large subunits are related to the recognition sequence

of an AAC processing

enzyme.

TABLE

I

Enzyme activity of AAC in Strain[plasmid]

Strepptomyces lividunscarrying various plasmids AAC activity (mu/ml

a

culture)b

COPY number

extraceliular

intracellular

A. uruhensisNRRL12052 S. lividans JT46

20.0 NDd

4.5

S. lividans[pKAA173]

31.0

8.0

130.8

S. lividans[pKAA103]

19.5

4.0

35.4

S. ~~~jdu~~pKAA503]

17.5

3.5

1

a Values ofA.

and pKAA503

spectively,

by inserting

’ Extracellular

are given for comparison.

were constructed

from pIJ702

7.5-kb BglII fragment

activity was measured obtained

mycelia

were assayed

Plasmids

and pKU5,

re-

from pKAA1.

as reported

et al., 1989). Cell extracts by the sonication

1’ -

NDd

utuhensisNRRL12052

pKAA173

(per cell)

previously

from the disruption for intracei~ular

(Takeshima

of the washed activity.

mU,

milliunits.

(f) Production of AAC S. lividans[pKAA103] was cultured in TSB medium and AAC activity in the culture filtrate was assayed periodically. Most of the activity (approx. 80%) was detected in the culture filtrate (Table I). The time course profile of AAC production in S. Iividans was substantially similar to that in the original producer, A. utahensis. It began at early logarithmic growth phase and continued for more than 144 h. The productivity in S. lividans[pKAA103] was similar to A. ~tahensjs as reported in a previous paper (Takeshima et al., 1989). Other strains carrying pKAA104, pKAA105, pKAA106 and pKAA107 produced AAC in a similar profile. Further, the 7.5kb BgIIl fragment was subcloned into the BglII sites of other Streptomyces vectors, pKU5 [tsr,

A subunit

Fig. 5. The aa sequence

homology

of the subunits

of the AAC

of A.

utahensis NRRL12052 to other acylases. A, B subunit; B, A subunit; a, AAC of A. utuhensis NRRLl2052; (b), penicillin G acylase of E. coli ATCCll105; d, cephalosporin

c, GL-7ACA acylase

gous aa are indicated

acylase of Pseudomonas of Pseudomonas

by white letters.

sp. strain

sp. strain GK16;

and

SE83. The homolo-

’ The sac gene is chromosomally

located.

d ND, not detectable.

emE, SCP2* (Lydiate et al., 1985) derivative,

constructed by H. I.] and pIJ702 (Katz et al., 1983), which differ from pKU109 in their copy number. S. Zividans[pKAA173] (pKAA173 is the pIJ702 derivative) gave the highest productivity of AAC (Table I). The production of extracellular AAC increased about 1.5-fold in this strain relative to the original producer, while the levels of AAC production in S. Iividans carrying pKAA103 and pKAA503 were nearly equal to those of the original strain. These results suggest that the gene dosage slightly affects production in S. Zividans. We used the culture medium of S. Zividans[pKAA103] as the enzyme source in the subsequent work. A summary of a typical preparation is given in Table II. The overall yield of the purified enzyme was 54.5 y0 and the purification was about 1670-fold. From the culture filtrate of A. utahensis, the purified acylase obtained was in relatively low yield (18.1%) as previously described (Takeshima et al., 1989), because most of AAC was bound to the pigments in the culture and the complex was difficult to dissociate. On the other hand, S. lividans JT46 did not produce such pigments, so, AAC was obtained efficiently from the culture filtrate of S. lividans[pKAA103] with high yield. (g) Properties of AAC from a ~trept~~~~e~ li~id~~~ transformant The purified AAC gave five bands (55,23,21, 20.5 and 19.5 kDa) on SDS-PAGE (Fig. 6A). The mobility of the largest 55-kDa peptide was the same as that of A subunit of AAC from A. utahens~, indicating that it corresponds to the large subunit of AAC. Although the band corresponding to the small subunit (B subunit) of AAC from A. utahensis was not found in the purified preparation from S. lividans, four smaller bands were observed. Western-blot

34 TABLE

II

Purification

of AAC from Streptomyces

Purification

steps”

lividuns[pKAA103]

Broth filtrate 40:;

saturated

Total

Specific

Yield

Purification

protein

activity’

activity

(%)

(-fold)

(mg)

(units)

(units/mg)

7,960

55.00

0.0069

100

1

(NH&SO,

66.88

55.00

0.8224

100

650M

43.98

0.9474

76.4

12.1

41.67 42.67

119.0 137.1

3.53

77.6

510.9

2.7

30.00

11.11

54.5

1607.8

DEAE-Toyopearl Hydroxyapatite Butyl-Toyopearl

650M

” AAC was isolated

from broth filtrate of S. lividuns[pKAA103]

nium sulfate precipitation. precipitate

Total

was dissolved

The broth filtrate was adjusted in 10 mM Na.phosphate

as reported

to 40%

previously

saturation

buffer (pH 6.5) and dialyzed

(Takeshima

with ammonium against

et al., 1989) except for using 40% saturated

sulfate, placed

at 4°C overnight,

the same buffer. The dialysate

ammo-

and centrifuged.

The

was applied on DEAE-Toyopearl

650M column. b AAC activity was measured

as reported

previously

(Takeshima

et al., 1989).

A 12

3

WW 68.0 45.0 30.0 20.1 14.3

Fig. 6. Electrophoretic phoretic patterns. SDS-12% proteins

analysis

of the purified

AAC.

(A) Gel electro-

The samples were subjected to electrophoresis

PAGE)

(in 0.1 y0

by the method

of Laemmli

(1970) and stained

with Silver Stain KANTO.

(B) Western

blot analysis.

ples were handled

the same as in (A) and transfered

membrane

(Burnette,

procedure

by using the mouse

goat anti-mouse

1981). Protein bands were detected anti-AAC

for

The sam-

to nitrocellulose by immunoblot

serum and an affinity- purified

IgG alkaline phosphatase

conjugate

(Promega,

Madison,

WI). Lanes: 1, the purified AAC from S. lividans; 2, from A. utahensis; 3, AAC negative fraction from DEAE cellulose column chromatography of culture filtrate of A. utuhensis. The standard

proteins

and their molecular

weights were as follows (from the top): bovine serum albumin ovalbumin

(45 kDa); carbonic

kDa); and lysozyme

anhydrase

(68 kDa);

(30 kDa); trypsin inhibitor

(20.1

(14.3 kDa).

analysis using anti-serum directed against the native acylase from A. utahensis gave the following results (Fig. 6B): the A subunit from A. utahensis and the 55-kDa peptide from S. Zividans both responded to the anti-serum, while the four bands from S. Zividans and the B subunit from A. utahensis did not. However, it is presumed that these bands

are subunits of AAC from S. lividans for the following reasons. (i) The molecular ratio of an overall amount of these four peptides and the 55-kDa polypeptide was determined to be 1:l. (ii) By SDS-PAGE, they were developed along with 55-kDa polypeptide in the chromatography of butyl-Toyopearl. (iii) The specific activity of the purified enzyme preparation was 11.1 milliunits/mg protein, which is approximately equal to that of the purified acylase from A. utahensis (Takeshima et al., 1989). Further, we found that two other polypeptides in the A. utahensis culture filtrate responded to the anti-serum as shown in lane 3 in Fig. 6B. These peptides were eluted in a different fraction from the AAC (87 and 60 kDa on SDS-PAGE), consequently, purified AAC does not contain them. The large polypeptide corresponded in size to the sum of the two subunits of AAC and is probably the precursor peptide of the two subunits. In this fraction, the 19-kDa peptide band did appear as shown in line 3 in Fig. 6A. It is not clear, however, whether this is same as the B subunit. (h) Conclusions (I) The sac gene of A. utahensis was cloned from an Escherichia colicosmid library ofA. utahensis genomic DNA using oligo probes. When a 3.2-kb ClaI-PstI fragment of the cloned DNA was subcloned into S. lividans using pKU109 as a vector, the recombinant produced AAC extracellularly. (2) From the analysis of the N-terminal aa sequences of both subunits and the aa sequences deduced from the entire nt sequence, it was concluded that the two subunits of the mature AAC were generated from a common precursor encoded by a single ORF. It was also found that the ORF codes for a putative signal peptide consisting of 34 aa responsible for the secretion of AAC. (3) In S. Zividans the precursor peptide of AAC was also processed to the active form, though it was incomplete. The molecular weight of the small subunit from S. lividans was

35 different from that of A. utahensis, indicating

that the mode

a multi-copy

of AAC is specific in A. utahensis.

of the maturation

Kieser, T., Hopwood,

D.A., Wright,

broad host-range

ysis and development

of structural

head of bacteriophage Lydiate,

We are indebted to M. Otani (Toyo Jozo Co.) for valuable advice during the course of this work. We thank D. A. Hopwood for providing pIJ702, T. Kieser for pIJ699 and S. lividam JT46, and Y. Komagata for preparing antiacuieacin A acylase anti-serum.

D.J.,

plasmid

plasmid:

of DNA cloning vectors.

185 (1982) 223-238. Laemmli, UK: Cleavage ACKNOWLEDGEMENTS

H.M. and Thompson,

Streptomyces

proteins

T4. Nature

Malpartida,

during the assembly

analysis

D.A.:

strain. J. Bacterial.

A., Matsuyama,

matsu, K.: Cloning cephalosporin

of the

acid acylase from

163 (1985) 1222-1228.

K., Yamamoto,

K., Ichikawa,

and characterization

acylases

into useful

and structure

gene for 7~-(4-carboxybut~amido~~phalospor~ic a Pseudomonas

of the

The Streptomyces

and development

cloning vectors: Gene 35 (1985) 223-235. Matsuda, A. and Komatsu, K.: Molecular cloning

Matsuda.

anal-

Mol. Gen. Genetics

227 (1970) 680-685.

F. and Hopwood,

SCPZ*: its functional

C.J.: pIJlO1

functional

S. and Ko-

of the genes for two distinct

from a Pseudomonas

strain. J. Bacterial.

169

(1987a) 5815-5820. REFERENCES

Matsuda,

A., Toma,

K. and Komatsu.

genes for two distinct Bibb, M.J. and Cohen, S.N.: Gene expression tion

and

application

Srreptomjxes

of

lividans.

Gen. Genet.

Moi.

B&k, A., Wirth, R., Schmid, P.: The penicillin

acylase

of two dissimilar

subunits.

in Strepfomyces:

promoter-probe

plasmid

strain. J. Bacterial.

construcvectors

in

187 (1982) 265-277. G., Lang, G. and Buck&,

from Esche~chja

cub ATCCI

FEMS

Microbial.

I IO5 consists

Lett. 20 (1983)

135-

139. from sodium trocellulose

dodecyl

electrophoretic

sulfate-polyacrylamide

and radiographic

nated protein Daumy,

blotting’:

detection

A. Anal. Biochem.

G.O., Danlay,

of proteins

gels to unmodified

with antibody

ni-

and radioiodi-

112 (1981) 195-203.

D. and McCall,

penicillin

Proteus rettgeri

transfer

G acylase.

J. Bacterial.

subunits

in

163 (1985) 1279-

1281. Debono, Patent Hanahan,

M.: Derivatives 56-120655

of cyclic peptide nuclei (in Japanese).

Japanese

(1981)

Henderson,

G., Krygsman,

Characterization Sfreptomyces

of Escherichia coli with plasmids.

griseus. J. Bacterial.

geted breakpoints Hopwood,

D.A.,

digestion

M.J.,

B. and Murray,

bacteriophage 3259-3263.

Chater,

III creates

tar-

Gene 28 (1984) 351-359.

K.F..

Kieser,

T., Bruton,

Nagaso,

of Streptomyces. Norwich,

K.: Packaging

A Laboratory

Manual.

UK, 1985.

recombinant

of the tyrosinase lividans. J. Gen.

amylase inhibitor

into

D.A.: Cloning

affecting the isolation cofi. Plasmid

and expression in Streptotnyces

Gene

19 (1982)

M., Asano, K. and and ch~a~te~zation

30 (1977) 297-302. H.: Nucleotide

sequence

of a Streptomyces griseaspareus proteinaceous (HaimII)

D. and Halvorson,

tion site and sequence

gene. J. Bacterial. H.O.:

A putative

in eukaryotic

alpha-

170 (1988) 4451-4457. signal peptidase

and prokaryotic

recogni-

signal peptides.

J. Mol. Biol. 167 (1983) 391-409. J., Fritsch,

Laboratory

Manual,

Sanger, F., Nicklen,

E.F.

and Maniatis,

T.: Molecular

2nd ed. Cold Spring Harbor

Cloning.

Laboratory

A

Press,

NY, 1989.

S. and Coulson,

inhibitors.

A.R.: DNA sequencing

Proc. Natl. Acad.

with chain-

Sci. USA 74 (1977) 5463-

5467. Schumacher,

G.. Sizmann,

D., Haug, H., Buckel, P. and Bock, A.: Penrelation. Nucleic Acids

Res. 14 (1986) 5713-5727. H., Inokoshi,

deacylation

J., Takada,

Y., Tanaka,

H. and amura,

enzyme for aculeacin

A, a neutral

lipopeptide

from Actinoplanes them.

utahensis: purification

S.: A

antibiotic,

and characterization.

J. Bio-

105 (1989) 606-610.

Tsai, J,F.-Y.

DNA molecules

gene from Streptomyces antibioticus Microbial. 129 (1983) 2703-2714.

lividans and Escherichiu

A. J. Antibiot.

and expression

and Chen, C.W.: Isolation

myces lividans mutants

Gen. Genet. Turner,

C.J. and Hopwood.

M., Hayashi, I. Isolation

H., Saito, S., Saito, H. and Takahashi,

Takeshima

C.J.,

particles in vitro. Proc. Natl. Acad. Sci. USA 74 (1977)

Katz, E., ~ompson,

Kieser, T.: Factors

with exonuclease

fragments.

icillin acylase from E. coli: unique gene-protein

D.J., Smith, C.P., Ward, J.M. and Schrempf,

Manipulation

The John Innes Foundation, Horn,

A and B from

I69 (1987) 3778-3784.

for DNA sequencing.

Bibb,

Kieser, H.M., Lydiate, H.: Genetic

of genes for protease

restriction

‘I’.: Studies on aculeacin,

te~inating

P., Liu, C.J., Dave);, C.C. and Malek, L.T.:

and structure

S.: Unidirectional

of double-digest

Cold Spring Harbor,

D.: Studies on ~ansfo~ation

of the

169 (1987b) 5821-5826.

K., Yagi, A., Satoi, S., Takada,

Matsuda,

Sambrook.

J. Mol. Biol. 166 (1983) 557-580

Henikoff,

Mizuno,

Perlman.

A.S.: Role of protein

sequence

from a Pseudomonas

269-276.

of aculeacin W.N.: ‘Western

Burnette,

acylases

Messing, J. and Vieira, J.: A new pair of Ml3 vectors for selecting either DNA strand

G., Schumacher,

K.: Nucleotide

cephalosporin

and characterization

deficient in intraplasmid

of Strepto-

recombination.

Mol.

208 (1987) 211-218.

D.H., Sugimoto,

N., Jaeger, J.A., Longfellow,

C.E., Freier, S.M.

and Kierzek, R.: Improved parameters for prediction of RNA structure. Cold Spring Harbor Symp. Quant. Biol. 52 (1987) 123-133. Yanisch-Perron, C., Vieira. J. and Messing, J.: Improved Ml3 phage

of ccc DNA from Streptomyces

cloning

12 (1984) 19-36.

M13mpl8

vectors

and

and pUC19

host

strains:

vectors.

nucleotide

sequences

Gene 33 (1985) 103-119.

of the