Cloning, sequencing and expression in Escherichia coli of the d -2-hydroxyisocaproate dehydrogenase gene of Lactobacillus casei

Cloning, sequencing and expression in Escherichia coli of the d -2-hydroxyisocaproate dehydrogenase gene of Lactobacillus casei

Gene, 78 (1989) 47-57 4-I Elsevier GEN 02979 Cloning, sequencing and expression in Escherichia coli of the D-2-hydroxyisocaproate dehydrogenase ge...

1MB Sizes 0 Downloads 25 Views

Gene, 78 (1989) 47-57

4-I

Elsevier GEN

02979

Cloning, sequencing and expression in Escherichia coli of the D-2-hydroxyisocaproate dehydrogenase gene of Lactobacillus cusei (Semi-lethality gene; Gram-positive;

promoter; terminator; ribosome-binding site; codon usage)

Hans-Philipp Lerch, Helmut Bl&eker, Helmut Kallwass, Jiirgen Hoppe, Hsin Tsai and John Coliins Geselkchaft ftir Biotechnologische Forschung, Braunschweig (F.R. G.) Tel. (0531)6181-200 Received by J.-P. Lecocq: 17 June 1988 Revised: 18 November 1988; 13 January 1989 Accepted: 24 January 1989

SUMMARY

D-2-Hydroxyisocaproic acid dehydrogenase (D-HicDH) from Lactob~c~~I~s casei was purified and partially sequenced. A 65-mer o~god#x~bonucleotide probe corresponding to the N-terminal 23 amino acids was synthesized and a physical map was made of the genomic region which hybridized most strongly. A strongly hybridising restriction fragment was highly purified and eventually cloned at low frequency in pBR322. The original clones spontaneously produced D-HicDH at about 0.05% of total protein and showed viability problems in that lo- to 12-h growth-lag periods occurred after diluting stationary cultures into fresh medium. Subcloning into pGEM3 plasmids for sequencing with concomitant ExoIII deletion led to clones which no longer exhibited the growth inhibition characteristics but now made D-HicDH as 3 to 5% of total protein. Subcloning downstream from a double pt pR promoter in plasmid pJLA601 gave a highly inducible clone that builds large inclusion bodies of largely denatured D-HicDH. The gene transcript was mapped for L. caseiand Escherichiu coli hosts. The promoter, terminator and Shine-Dalgarno sequence are functional in both organisms. The gene encodes a protein subunit of 38 kDa, whereby 67 % of the sequence could be checked by correlation with partial peptide sequences from the original enzyme. So far no Lactobacillus gene has been found to utilize the Arg codons AGG and AGA.

C~~es~unden~ to: Dr. 1. Collins, Department of Genetics, GBF, Mascheroder Weg 1, D-3300 Braunschweig (F.R.G.) Tel. (0531)6181-200; Fax(0531)6181515.

Abbreviations: aa, amino acid(s); ADH, alcohol dehydrogenase; Ap, ~picill~; bp, base pair(s); A, deletion; o-HicDH, D-zhydroxyisocaproate dehydrogenase; D-Hi&H, gene coding for o-HicDH; DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen; EtdBr, ethidium bromide; ExoIII, bacteriophage 1 exonuclease III; FPLC, fast protein liquid chromatography; GAPDH, ~y~eraldehyde 3-phosphate dehy~ogenase; HEPES, ~-2-hydroxyethylpiper~ine-~-2-eth~esulfonic acid; 0378-t 119/89/$03.50 0 1989Elsevier Science Publishers

B.V. (Biomedical

kb, kilob~e(s) or 1000 bp; fuc, lactose operon of E. cali; LDH, L-lactate dehydrogenase; LeuDH, L-leucine dehydrogenase; L-HicDH, L-2-hydroxyisocaproate dehydrogenase; MRS medium, see MATERIALS AND METHODS, section b; nt, nucleotidefs); oligo, oligodeoxyribonucleotide; PAGE, polyacrylamide gel electrophoresis; pr, and pa, phage 1 leftward and rightward major promoters in the immunity region; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; SDS, sodium dodecyl sulfate; SR medium, see MATERIALS AND METHODS, section b; TE, 0.01 M Tris/l mM EDTA pH 8.0; T4, T4-bacte~ophage; Ter, stop eodon; [ 1,designates plasmidcarrier state.

Division)

48

INTRODUCTION

D-2-Hydroxyisocaproate dehydrogenases (DHicDH) were first isolated by Hummel et al. (1984; 1985) from various Gram-positive organisms including L. casei ssp. pseudoplantarum (DSM 20008). This NAD(H)-dependent enzyme catalyses the stereospecific and reversible reduction of various aliphatic and aromatic 2-ketocarboxylic acids to form the corresponding D-Zhydroxycarboxylic acids. It can be applied in an industrial-scale process in combination with L-HicDH (Schtitte et al., 1984) and LeuDH (Schtttte et al., 1985) to form L-aa using ammonia, polyethyleneglycol-bound NAD cofactor and a racemic mixture of 2-hydroxycarboxylic acids reactor in a continuous-process membrane (Wandrey et al., 1984). The enzyme has been crystallised (Kallwass et al., 1987) and compared with respect to partial sequences and immunological techniques to L-HicDH (Tsai et al., 1987) and a number of other amino- or hydroxyacid dehydrogenases to which it is unrelated (H.-P. L., unpublished results). To obtain reasonable quantities of enzyme for an industrial-scale process (initial yields were only 0.6 mg per liter culture = 108 units) and as a first step towards a gene technological approach to protein design aimed at altering the substrate specificity, all of the genes for these enzymes (D-HicDH, L-HicDH and LeuDH) are being cloned. Our results in cloning and characterising the D-HicDH-coding gene and expressing it in E. coli are reported in this paper.

MATERIALS AND METHODS

(Darmstadt, F.R.G.), [ Y-~~P]ATPand [ a-35S]dATP were purchased from Amersham Buchler (Braunschweig, F.R.G.). Tryptone, peptone, yeast extract and Casamino acids were from Difco (Detroit, MI), meat extract was from Gibco BRL (Eggenstein, F.R.G.). The FPLC system with Mono Q column and DEAE-Sephacell were from Pharmacia (Freiburg, F.R.G.). Hydroxylapatite was obtained from Bio-Rad. The 65-mer oligo was synthesised on a Pharmacia Gene Assembler according to the recommendations of the manufacturer. Shorter oligos used as primers for sequencing were synthesised according to Frank et al. (1988). (b) Bacterial strains, plasmids and media

Chromosomal DNA was isolated from L. casei ssp. pseudoplantarum DSM20008. Recombinant plasmids were transformed into E. coli DHl (F- , endAl,hsdR17(r,mK +),supE44, hi-l, A-, recA 1, gyrA96, relA 1) (Hanahan, 1983). Plasmid pBR322 (Bolivar et al., 1977) and expression vector pJLA601 (Schauder et al., 1987) are described. pGEM plasmids and pGEM sequencing primers were from Promega Biotec. L. casei was grown in MRS medium (deMan et al., 1960). Recombinant E. coli strains were plated on and propagated in SR medium to prevent possible toxic effects of the cloned Lactobacillus genes. SR medium (1 liter) was prepared by combining 100 ml of separately autoclaved solution A and 900 ml of solution B. SR plates are made of SR medium + 15 g agar per liter. Solution A is 170 mM KH,PO,, 720 mM K,HPO,; solution B contains 20 g tryptone, 20 g yeast extract, 20 g Casamino acids, 10 g meat extract and 5 ml 87% glycerol. TE buffer contains 0.01 M Tris * HCl pH 8.0 and 0.1 mM EDTA.

(a) Materials

Restriction endonucleases, TCDNA ligase, T4 polynucleotide kinase, E. coli polymerase I, PolIk, ExoIII and mung-bean nuclease were purchased from Boehringer (Mannheim, F.R.G.), Pharmacia (Freiburg, F.R.G.), New England Biolabs (Schwalbath, F.R.G.), or Gibco BRL (Eggenstein, F.R.G.). Sequenase was from United States Biochemical Corp. (Cleveland, OH), lysozyme from Serva (Heidelberg, F.R.G.), mutanolysin from Sigma (Deisenhofen, F.R.G.) and proteinase K from Merck

(c) Preparation of chromosomal bacillus casei

DNA from Lacto-

One liter of MRS medium, supplemented with 1% glycin (Bae et al., 1985) and without Mg * sulfate, was inoculated with a 30-ml overnight culture. Cells were grown 5 h with slow rotation in flasks without baffles at 37°C to mid-log phase (Ass0 = 1.6). The culture was centrifuged 10 min at 6000 x g. After the pellet had been washed with 180 ml 0.1 M EDTA pH 7.0 and 180 ml 20 mM K 3phosphate/l0 mM

EDTA pH 6.8, cells were resuspended in 10 ml 0.1 MHEPES/lO mMEDTA/0.3 Mraflimose/OS% Triton X-100 pH 6.9. Cells were lysed by adding 40 mg lysozyme and 2500 units of mutanolysin, as described by Monsen et al. (1983) for streptococci. Proteins were digested by proteinase K (24 mg) in the presence of 0.5 y0 SDS at 60” C in a total volume of 70 ml until lysis was complete. After addition of 70 g CsCl and 8 ml of EtdBr solution (5 mg/ml in H,O), chromosomal DNA was separated from the five cryptic plasmids of this Lactobacillus strain by isopycnic centrifugation in a Beckman Ti 50.2 rotor for 48 h at 38 000 rev/mm and 18°C. Chromosomal DNA was collected with a wide bore pipette and EtdBr was extracted with isopropanol, saturated with TE buffer and CsCl. The DNA was dialysed extensively against several changes of TE buffer. (d) Construction of a cosmid gene bank from Lacto-

bacillus casei Chromosomal DNA from L. casei was partially digested with varied amounts of Sau3A and ligated with vector arms of PvuII-cleaved (dephosphorylated) and BamHi-cleaved pcos2EMBL (Ish-Horowitz and Burke, 1981; Poutska et al., 1984). The ligation mixtures were packaged k vitro according to Scalenghe et al. (1981). Packaged recombinant cosmids were transduced into E. coli DHl. A total of 1500 recombinant cosmid clones were obtained on packaging 0.5 c(g input L. casei DNA. (e) Raising

antiserum

against

D-HicDH

and syn-

thesis of an oligo probe for screening

D-HicDH was purified with slight modifications according to Hummel et al. (1985). After further purification on a FPLC Mono Q, chromatography on DEAE-Sephacell and hydroxylapatite, homogeneous enzyme was obtained. A rabbit was immunised with 0.6 mg protein of this preparation mixed with 1 ml of complete Freund’s adjuvant; two weeks later, a further 0.2 mg, mixed with 1 ml of complete Freund’s adjuvant, were injected. Titration of antisera and test on Western blots were as described previously (Tsai et al., 1987). The first 25 N-terminal aa of D-HicDH were sequenced by gas-phase sequencing using 0.13 mg protein which was treated with methanol/HCl prior

to sequencing to remove a formyl group from the N-terminal aa which would have inhibited sequencing (Hoppe and Sebald, 1980). According to this sequence, a 65-mer oligo probe was synthesized based on the most frequent codon usage in the Staphylococcus hyicus lipase gene (G&z et al., 1985). (f) Nucleotide

sequence analysis

A set of progressive unidirectional deletion subclones from the EcoRI site of pHL2 was generated by the method of Henikoff (1984). Sequencing (Sanger et al., 1977) was performed on 2 pg alkalidenatured supercoiled plasmid DNA (Chen and Seeburg, 1985) using [a- 35S]dATP and Sequenase, a modified bacteriophage T7 DNA polymerase (Tabor and Richardson, 1987) according to the instructions of the supplier. Samples of the sequencing reactions were run on a wedge-shaped (0.2-0.6 mm) 6% polyacrylamide gel. (g) mRNA analysis

The beginning and end of the D-HicDH gene transcript were mapped by primer extension and nuclease Sl mapping as described by Williams and Mason (1985) and in Maniatis et al. (1982). Total RNA from E. coli was isolated by the guanidinium isothiocyanate method according to Maniatis et al. (1982). For RNA isolation, L. casei cells were washed with 20 mM potassium phosphate/l0 mM EDTA/l M sucrose pH 6.9 and incubated 10 min at 37’ C in this buffer with 625 units/ml mutanolysin to remove the cell wall. Protoplasts were spun down and treated in the same way as E. coli cells in all following steps of the RNA isolation procedure, namely starting with the addition of guanidinium isothiocyanate. For primer extension reaction and nuclease S 1 mapping, the total cell RNA was further purified on a disposable anion exchanger Quiagenpack 500 according to the instructions of the supplier (Diagen GmbH, Dusseldorf, F.R.G.) to remove all traces of protein, DNA and even tRNA. The primer extension reaction was carried out with a 22-mer oligo complementary to nt position 433-454 of the gene sequence (see Fig. 3). A dideoxy chain-termination reaction using this oligo as a primer was run in parallel on the sequencing gel. The 3’ end of the mRNA was mapped by cleavage of the D-HicDH

50

gene with BumHI, filling with PolIk and [ a-32P]dATP, subsequent cleavage with Nr~1 about 550 bp downstream from the BumHi site; this 3’-labelled fragment was hybridised with RNA from the E. coli clone with the D-HicDH gene in pGEM3 (pHL2), and L. cusei. After nuclease Sl digestion, samples were loaded on a standard sequencing gel. A sequencing reaction of the 3’-labelled DNA fragment according to Maxam and Gilbert (1977) was run in parallel as a marker. (h) Partial amino acid sequences D-HicDH purified according to Kallwass et al. (1987) was treated as follows. CNBr cleavage was done at room temperature for 10 h by a lOOO-fold molar excess over total methionine in 70% formic acid subsequent to reduction in 0.1 M 2-mercaptoethanol for 72 h at room temperature and vacuum drying. Lysyl residues were protected by citraconylation according to Cruickshank et al. (1974) followed by dialysis against 0.1 M NH,HCO,. Tryptic digestion of native or citraconylated D-HicDH was performed at 37°C in 0.1 M NH,HCO, by 1% TPCK-trypsin (Sigma) by weight of D-HicDH for 3 h and after repeated addition of 1% trypsin for another 3 h. Endoproteinase Arg-C (Boehringer) was applied as 5% by weight of D-HicDH in 0.1 M NH,HCO, at 37 “C for 24 h. After proteolytic digestion the samples were lyophilised and submitted to reversed-phase chromatography on a Nucleosil C,, 10 pm column (Macherey & Nagel) or a Hypersil C, 5-pm column (Shandon) using acetonitrile or isopropanol gradient elution in 0.1 y0 (v/v) trifluoroacetic acid. Tryptic digests of citraconylated D-HicDH were directly used for reversed-phase chromatography on a Poly-F column (DuPont) with acetonitrile gradient elution in 1% (v/v) triethylamine. Peptides were sequenced in a Model 470 A Protein Sequencer (Applied Biosystems) using polybrene attachment. (i) Other techniques E. coli colonies were screened for plasmid content according to Bimboim and Doly (1979). Elution of DNA fragments from agarose gels was done as described by Zassenhaus et al. (1982)using an ISCO model 1750 electrophoretic sample concentrator.

DNA was transferred to nitrocellulose filters in 20 x SSC (3 M NaC1/0.3 M Na, - citrate pH 7.0) as described by Southern (1975) and to nylon filters in 0.4 N NaOH as described by Khandjian (1987). End labelling of oligos with [Y-~~P]ATP and T4 polynucleotide kinase, and hybridisation of filters were done according to Woods (1984). SDS-PAGE of proteins was performed as described by Laemmli (1970). For transfer of proteins to nitrocellulose filter and Western blotting the method of Towbin et al. (1979) was used. D-HicDH activity was assayed as described previously (Hummel et al., 1985). SDS-PAGE of peptides obtained by proteolytic digestion of D-HicDH was performed using the PHAST-System and Gradient 8-25 PHAST-Gels (Pharmacia).

RESULTS

AND DISCUSSION

(a) Amino acid sequence analysis Proteolytic digestion of D-HicDH was most successfully achieved by CNBr and trypsin. Both reagents degrade D-HicDH completely to smaller peptides with high specificity. During tryptic cleavage of native D-HicDH two core peptides insoluble in aqueous buffer were formed with it4,s of approx. 2000 and 6000, as determined by SDS-PAGE. The smaller tryptic core peptide corresponded to the known N-terminal sequence. A sequence of 54 aa (residues 181-234) of the larger core peptide was determined. In these peptides tryptic cleavage did not occur at residues Arg-9, Lys-196 and Lys-224. Treatment with endoproteinase Arg-C in contrast yielded a complex mixture of peptides in the M, range of 38 000 (intact D-HicDH subunit) to 1000 (lower detection limit of SDS-PAGE analysis) indicating slow hydrolysis rates resulting in incomplete cleavage at many or all possible cleavage sites. Endoproteinase Glu-C did not degrade D-HicDH either under acidic, or under basic reaction conditions (Houmard and Drapeau, 1972). Solubility problems were overcome by citraconylation of D-HicDH and keeping the acid-labile protecting groups (Dixon and Perham, 1968) intact at high pH after tryptic digestion. The citraconylated peptides are soluble and were purified by reversed-

51

phase chromatography in basic solution using polymer-based reversed-phase column packings. Amino acid sequence analysis of D-HicDH and its proteolytic fragments revealed partial sequences of 226 aa residues (67%) of the total 335 residues D-HicDH subunit, which are in agreement with the corresponding gene sequences. (b) Restriction

mapping of the D-HicDH

gene on

the Lactobacillus casei genome

The optimal hybridisation conditions for the 65-mer oligo probe were established by several genomic Southern-blot experiments. If filters were hybridised and washed in 6 x SSC at 50°C only one band could be seen for each of the restriction endonuclease digests. Single and double restriction endonuclease digests of chromosomal DNA were separated on agarose gels and the size of the hybridising fragments was determined by Southern blotting. From these data, a restriction map of the region on the L. casei genome containing the D-HicDH gene was constructed (Fig. 1). (c) Cloning of the D-HicDH

gene

The initial isolation of a D-HicDH clone can be regarded as an inefficient event (e.g., this region was absent in the 1500-clone cosmid gene bank) which is not correlated with a detrimental effect of the gene product. We were, therefore, forced to use another approach enriching for the required genomic region. Immunoblotting methods were also applied without success and are, therefore, not covered in detail here. L. casei chromosomal DNA (1 mg) was digested with CZaI and separated on a 0.8% preparative agarose gel. DNA fragments of about 15 kb were excised from the gel and the DNA recovered by electroelution. This fraction was digested with XhoI and DNA fragments of 6.5-kb size were isolated.

sdl Clal I

md# Pvu I

I

khl EcoRl I

&HI

I

Hp.31 Ssl I I

EC0RI thdl I

Psll

I

Sdl

Cl01

I

I

-

, 0 Fig. 1. Restriction

,

4

5

10

map

D-HicDH gene. The arrow

of the L. casei indicates

I

15

genome

around

the D-HicDH gene.

kb

the

The eluate contained only five different ClaI-XhoI fragments as could be seen upon digestion of an aliquot of these DNA fragments with BamHI (not shown). The purified DNA fragments were ligated into ClaI + SalI-digested pBR322 and transformed into E. coli DH 1. Cells were spread on SR plates containing 50 pg Ap/ml. Plasmid DNA was isolated from 40 of the resulting clones and digested with CZaI + BamHI. Four of these clones contained an insert in the vector and one of these four clones showed the expected fragment sizes upon digestion with ClaI + BamHI. In a Southern-blot experiment, this clone hybridised strongly with the 65-mer oligo probe. Restriction mapping of the inserted DNA fragment with BarnHI, EcoRI, HindIII, PvuII and Sal1 and subsequent Southern blotting showed coincidence of the location of the restriction sites with the chromosomal map. This clone (pHLl), bearing the 6.5-kb fragment of L. casei chromosomal DNA in pBR322, was difficult to cultivate due to its abnormal growth behaviour. If an overnight culture was diluted 1: 1000 into fresh medium, no growth could be observed during 10 h, whereas a similarly treated culture of E. cofi DH l[pBR322] grew into late log phase during this time. After 24 h, both cultures had the same absorbance (A550 = 28 for growth in SR medium). This experiment was repeated live times by daily dilution of both cultures and the results were always the same. The deletion clones generated for the sequencing of the D-HicDH gene, did not show this 10-h lag phase although they produced D-HicDH at 3-5x total cell protein. (d) Gene sequence

The sequencing strategy and the complete nucleotide sequence of the D-HicDH gene are shown in Figs. 2 and 3. The 65-mer oligo probe used in cloning was found to match the genomic sequence of the D-HicDH gene to 80% (52 out of 65), the longest continuous homologous stretch being 11 nt long. The mismatches at nt positions 34 and 36 were caused by an artefact which occurred during N-terminal protein sequencing. The genomic sequence contains Glu-12 whereas a Tyr was designated during the protein sequencing. Since the protein had been treated with methanol/HCl prior to N-terminal sequencing, the methylester of Glu may have formed during this treatment causing misinterpretation of

52

A

0

500

1000

-B

1500

AAlCAACAAGAGATGTTGCCGlTTAAAAACGCCATTGATGATTATCTlACTGGCAAGGAG CAAACCATCACAATACCGGTGACTTACCAtGGACACCGTtGCAA6AAGCCGTCTGGCAGT

I21

ATCTGCAAACGATTCCTTATGGAGAGACCCGAACGTACGCACAGGT6GCAGCCGCAGTCG

,8,

GTCATCCGCACGCCTTCCAAGCAGTCGGCTcTGAGGtCG6GAAGAATCCCGTTATGAtCG

241

CTGTGCCTTGTCATCGCGTCCTGCGCAAAGATGGTGGTTlGGGTGGCTTTCGT66CGGTT

30,

TGCCAATCAAGCGCGACtTGTTGGCACtTGAACAAGGCAGCGGCCAATTTTTtAAAGATG

36,

&ii RBS lbs8a' -10 ClTTTTCACAGAGCCATCTT~TATACGGTCICTCCICAAATlG6AAAGGAAGTTTAACAC _-

bp

--

I 6,

--

--B-B 4--------r

Fig. 2. Restriction map of the D-HicDH gene and sequence strategy. (A): Only unique restriction sites are shown. Arrow specifies the D-HicDH gene. (B): Sequencing strategy. An EcoRI-PvuII fragment from pHL1 was cloned into EcoRI + PvuI-cleaved pGEM3 (clone pHL2). After cleavage with EcoRI + PstI, digestion with exonuclease III and mung bean nuclease, ligation and transformation into E. coli DH 1, a set of overlapping clones was generated as described in MATERIALS AND METHODS, section f. A piece of the complementary DNA strand was sequenced by cloning an EcoRIBumHI fragment from pHL1 into EcoRI + BamHI-cleaved pGEM4 and sequencing from the SP6 primer. The remaining gaps were sequenced by using short synthetic oligo primers (about 20nt in length), based on the previous sequences. Sequencing reactions starting with synthetic primers are marked by a point at the arrow. pGEM3-D-HicDH (pHL2)-deletions 458 and 4417 produced 3 to 5% of total protein as D-HicDH, thus exhibiting their own promoter activity which is repressed in clone pHL1.

the sequencing data. Apart from this no discrepancies were found between the peptide sequences and the genomic sequence of the D-HicDH gene. Codon usage for the D-HicDH gene was compared with data from other Lactobacillus genes, namely: L. casei, dihydrofolate reductase gene (Andrews et al., 1983 Lactobacillus 30a, histidine decarboxylase gene (Vanderslice et al., 1986), ORF 1 from the insertion element ISLl isolated from L. casei bacteriophage (Shimizu-Kadota et al., 1985), B-D-phosphogalactoside galactohydrolase gene of L. casei (Porter and Chassy, 1988), factor III-lac gene of L. casei (Alpert and Chassy, 1988), Lactobacillus confusus, L-HicDH gene (H-P.L., R. Frank and J.C., manuscript submitted), L. casei ssp. pseudoplantarium, D-HicDH gene (this paper). Only one example of ATA (isoleucine) codon usage was observed (Porter and Chassy, 1988). These gene sequences contain 1805 codons including 66 Arg codons and 101 isoleucine codons. So far the codons AGA/G (Arg), and UAG (Ter) have not been found. It should be noted that AGA/G are used as stop

421

NKIIAVGARVDElQVFKQYA ATGAAGATTATTGCTTACGGTGCTCGCGTTGACGA6ATTCAATAtTTCAAGCAAT6G6CC

48,

KOTGNTLEVHTEFLDENTVE AAGCATACAGGCAACACACTTGAATACCATACAGAATTTCTCGATGAAAACACCGTT6AA

541

YAKGFDGINSLQTlPVAA6V T6GCCTAAAGCGTTTGAT6GCATCAAlTCATTGCAGACAAC6CCATATGCA6CCGGCGTT

601

FEKh!NAVG,KFLT,RNVGTD TTTCAAAAAATGCACGCGTATGGTATCAAGTTCTTGAC6ATTCGGAATGTG6GlACGGAT

66,

NlDl4TANKQVGIRLSNVPAV AACATTGATATGACTGCCATGAAGCAATACGGCATTCGTTTGAGCAATGTACC6GCTTAT

121

SPAAIAEFALTDTLVLLRNN TCGCCAGCAGCCATTGCT6AATTTGCTTTGACC6AtACTTTGTACTTGCTACGTAATAT6

18,

GKVQAQLQAGDVEKASTFIG 66TAAAGTACAGGCGCAACTACAGGCGG6CGATTATGAAAAAGCGGGCACCTTCATCGGT

84,

KELGQQTVGVl4GTCNI6QVA AA6GAACTCGCTCAGCAAACCGTTGGCGTGATGGGCACCGGTCATAtTGGACAGGtTGCT

90,

IKLFKGFGAKVIAVDPVPWK ATCAAACTGTTCAAAGGCTTTGGCGCCAAAGTGATTGCTTACGATCCTTATCCAAT6AAG

96,

GDHPDFDVVSLEDLFKQSDV GGCGATCACCCAGATTTT6ACTATGTCAGCCTTGAA6ACCTCTTlAAGCAAAGTGATGTC

,021

IDLNVP6IEQNTHI,NEAAF ATTGATCTTCATGTTCCTGGGATTGAACAAAATACCCACATlATCAATGAAGCGSCATlT

LOB,

NLNKPGAlVINtARPNLlDT AATTTGATGAAACCGGGTGCGAlTGTGATCAACACGGCTCGGCCAAATCT6ATT6ACACG

,141

QANLSNLKSGKLA6VGIDTV CAAGCCATGCTCAGCAATCTtAAGTCTGGCAA6TTGGCC6GTGTC6G6ATT6ACACCTAT

,20,

EVETEDLLNLAKNGSFKDPL GAATACGAAACCGAGGACTTGTTGAATCTC6CCAA6CAC6GCAGCTTCAA6GATCC6TTG

126,

YDELLGNPNVVLSPHIAVVT TGGGACGAGCT6TTCGG6Al6CCAAATGTTGTCCTCA6CCC6CACATT6CCTACTACACC

132,

ETAVHNl4VVFSLQHLVDFLt 6AGACGGCT6T6CATAATAT6GTtTACTTCTCACTACAACATCTC6tl6ATTTCTl6ACC

138,

KFKPARKLLVQQVVN* AAATTCAAACCA6CAC6GAAGtTACTG6TCCAGCAA6TA6lCAACt6AATAG

144,

TERNINATDR 6CCCTGCCTAtTCACCAATACGtTAAT66CA6A ---,--

,501

6CTTAAAAAATCGAATTccc1ccLITT6ccIT6171TTT6

l-45' -

sror

,561 162,

6GATCATAAAAGCGTCAACGGCGtTTG

Fig. 3. Complete nucleotide of the D-HicDH gene, and corresponding amino acid sequence, ‘-10, -35 and -45’ region of the promoter, ribosome-binding site (RBS) and start point and end (stop) of the mRNA are indicated.

codons in vertebrate mitochondria (review: Fox, 1987). Although no prokaryotic group has been described to have this type of variation in codon usage, it must still be considered an open question, until data (e.g., foreign gene expression) have been

53

obtained on how, or if, these codons (useable) in Lactobacillus.

are used

(e) Promoter sequence

The start point of transcription of the D-HicDH gene was determined by primer extension. Transcription starts at the same position in both E. coli and L. casei. The promoter of the D-HicDH gene (Fig. 3) is similar to other promoter sequences from Gram-positive organisms (Graves and Rabinowitz, 1986; Van der Vossen et al., 1987). At -45 there is a typical oligo(A) stretch, followed by TTCACA at -35 (analogous to the consensus: TTGACA). The presumed TATA-box (TACGGT _ 6) is preceded by TG, a feature typical for promoters from Grampositive bacteria. AU GAdI C=G A=U ;2 U=A A=U U

C

C=G CEG G=C U=A CsG CcGA GEC T=A

GEC

C=G

A=U A=U A=U CA=UU

uA

AG U A

C

A U

U

UA

G

A AC~G

G

E=uA A:U U*G GSC A=U

(f) Terminator sequence

g”, G=C

Fig. 4. Possibl&.econdary mRNA.

The sequence

structure

a Rho-independent et al., 1987).

at 3’ end of the D-HicDH

of nt 1434 to 1482 in Fig. 3, namely

upper part of the secondary

structure

terminator

The D-HicDH promoter resembles strongly expressed E. coli promoters. Like phage lp, promoter it has a degenerate TATA-box. It has been suggested by Knaus and Bujard (1988), that the -10 region of pL (GATACT) might be responsible for the efficient transition of the promoter-bound RNA polymerase from the initiation complex to the elongation complex. At nt position + 7 there is a TTG in the D-HicDH promoter, followed by a pm-me-rich region. This is also a feature of the highly expressed P HZ07 and pm from E. coli phage T5. It has been shown (Kammerer et al., 1986) that weaker promoters could be activated by coupling to such a downstream region. The oligo(A) at -45 of the D-HicDH promoter might the responsible for efficient binding of the RNA polymerase as in T5 and T7 promoters (Knaus and Bujard, 1988). The expression level of the D-HicDH gene under control of its own promoter in E. coli is very different depending on the presence of upstream sequences. In pHL1, D-HicDH production is on the same level as in L. casei (about 0.05% of total cell protein). Deletion subclones in the pGEM3 vector, which were used for sequencing, produced constitutively 3-5% of total cell protein D-HicDH. These clones contained 58 or 417 bp of the Lactobacillus DNA upstream from the D-HicDH structural gene. D-HicDH mRNA from these two clones could be easily detected in a Northern-blot experiment using the oligo from the primer extension mapping or the nick-translated 5.6-kb ClaI-BamHI fragment from pHL1 as a probe. Under the same conditions, D-HicDH mRNA could barely be detected in total cell RNA from E. coli (pHL1) or L. casei. This indicates, that the level of D-HicDH mRNA is about loo-fold lower in E. cofi (pHL1) and L. casei, which agrees with the differences in the protein levels. One may conclude from these data that there might be a repressor gene present on the L. casei DNA upstream from the D-HicDH gene (> -417).

the

shown here, is similar to

as found

in E. coli (Friedman

Downstream from the gene-coding region there are several inverted repeats, spanning 50 bp (Fig. 3). A possible large stem/loop structure is shown in Fig. 4 (free energy of formation: -18.8 kcal). The mRNA ends at the last three U’s at the terminator in both E. coli and L. casei. The stem/loop structure

54

represents a typical Rho-independent (type I) terminator (review: Friedman et al., 1987). In view of the high levels of mRNA and of D-HicDH inducible in the cell with the pJLA vector (Fig. 6) both the efficiency of the Shine-Dalgarno sequence and messenger RNA stability appear to be high. The latter would be expected, at least in part, to be determined by a stable secondary structure at the 3’ end of the mRNA (Newbury et al., 1987).

domain consists of six j-pleated sheets, linked by cl-helices (for reviews see Rossmann et al., 1974; 1975). The #IA, clB and /IB structural elements of D-HicDH can be aligned due to similarity in the ammo acid sequence (Table I). In the other parts of the NADH-binding domain (PC, fiD, crD, aE, /3E and /IF) structures are conserved although the amino acid sequences show more divergence (according to Chou and Fasman, 1974; not shown).

(g) Evolutionary relationship of D-HicDH to other

(h) Expression of the D-HicDH

dehydrogenases

coli

The D-HicDH amino acid sequence was compared with the sequences of all dehydrogenases in the EMBL data base (version 12). No significant similarity (exceeding 15 y0 overall homology) to any other dehydrogenase was found. In the search for shorter regions of homology, many dehydrogenases showed homologies to aa residues 146-180 of D-HicDH. The corresponding regions of the other dehydrogenases are part of the NADH-binding domain. This structurally strongly conserved

The Western blot (Fig. 5) shows that the D-HicDH gene is expressed in E. coli, probably from its natural Lactobacillus promoter. The enzyme produced in E. coli has apparently the same M, as that produced in L. casei. Degradation products were not observed. D-HicDH activity was measured in the soluble cell protein. Specific activity in the L. casei extract was 0.27 units/mg. The original D-HicDH E. coli clone pHL1 produced 0.15 units/mg and in the E. coli DHl control no D-HicDH activity could be mea-

TABLE

gene in Escherichia

I

Alignment

of NADH

Dehydrogenase

binding

structural

elements

of various

Secondary

a Source

dehydrogenases

structure

according

to Rossmann

element b

Reference’ UB

BA

BB

GAPDH

pig (muscle)

, VKVGVDGFGRIGRLVTRAAFNSGKVDIVAINBPF

GAPDH

lobster

,.SKIGIDGFQRIGRLVLRAALSCG-AQVVAVNBPFIAL(2)

(muscle)

,VRVAINGFGRIGRLVMR

GAPDH

yeast

LDH

dogfish

ADH

D. melanogaster

ADH

horse (liver)

,‘,sSTCAVFQLGGVGL

ADH

rat (liver)

D-HicDH

L. casei Consensus

a Enzyme

abbreviations:

,,NKI

(muscle)

(1975)

I DL(1)

IALSRPNVEVVALNDPF

TVVPVPAVGMACA

I TN

(3)

I S I LMKDLADEVALVDVMEDK

(4)

,NVIFVAGLgGInLDTSKELLKRD-LKNLVILDRIENP IGVDI

NKDK

(6)

,,STCAVFPLGGVGLSVV

I GCKTAG-AAKI

IAVDI

NKDK

(7)

,,QTVGVMQTQHIQQVAI **** * * **++

KLFKGFG--AKVIAYDPYPMK + * * * **

‘;V:V

sequenced

GAPDH,

(5)

SV I MGCKAAG-AARI

glyceraldehyde

GkGg;G: 3-phosphate

;V

RAAE

dehydrogenase;

G-AA

LDH, lactate

this paper **+

*

V;I;DPF;DK dehydrogenase.

See also abbreviations

on the first page of this article. b Underlined sequences

amino acids are conserved

’ (1) Harris and Perham (6) Jbrnvall

(1968); (2) Davidson

(1970); (7) Branden

Rossmann

above the sequences.

with the same secondary d Asterisks,

o-HicDH

with respect

structure sequence

et al. (1967); (3) Holland

of GAPDH

prediction

(Garnier

and Holland

is based on structural

for NADH-binding.

Dashes

are included

(1979); (4) Taylor (1977); (5) Benyajati

data from X-ray crystallography

(Ohlsson

in the

et al. (1981); et al., 1974;

from pig and yeast and ADH from rat. p-sheet regions A + B and a-helical are by sequence

comparison.

et al., 1978; Chou and Fasman,

with the consensus sequence.

essential

alignment.

The other alignments

matches

to the consensus

and are considered

to optimise

et al. (1975). Alignment

et al., 1974), for the sequences

A are designated

sequence

in all sequences

where a gap has been introduced

sequence.

Plus symbols,

For D-HicDH,

the alignment

region

is in accordance

1974). conservative

amino acid exchange

in D-HicDH

55

L.

casei

E. cdi

r-

E. cdi [pHLl]

12

3

4 5 67

8 9 10

--

--

Fig. 5. Western blot. Total cell proteins of L. cusei, E. coli DHl and E. coli DHl[pHLl] have been separated on a 0.1% SDS-12.5 % polyacrylamide gel and blotted onto a nitrocellulose filter. For each species, three different protein concentrations, descending by a factor of two (left to right), were applied to the gel. The arrow indicates the D-HicDH band.

sured. Cloning of the D-HicDH gene in the expression vector pJLA 60 1 led to a clone which produces D-HicDH at over 60% of total cell protein (Fig. 6). D-HicDH accumulates in the form of large inclusion bodies in the cells and the enzyme activity (3.5 units/mg) in the soluble cell protein is about 5% of the expected

value.

(i) Conclusions (1) The cloning and characterisation of the D-HicDH gene of L. casei is described. The derived amino acid sequence shows the NAD-binding domain (GXGXXG[ 17 to 19 X]D) so far common to all known NAD-(H)-cofactor binding dehydrogenases. D-HicDH and D-HicDH show no significant homology to any other gene or gene product present in the EMBO/SWISSPROT database, with the exception of the Rossmann-fold discussed above. (2) It is noted that so far no Lactobacillus gene has been found to use the AGA, AGG (Arg) or UAG (stop) codons and in only one case has AUA (Ile) been reported from over 1800 codons analysed. The regulatory regions, namely promoter, ribosomebinding region and terminator, were shown to be recognised in the same way in both E. coli and L. casei.

Fig. 6. Expression of the D-HicDH gene under control of Iz pa and pL promoters in E. coli DHl. The D-HicDH gene was cloned into the ,SphI site of the polylinker of the expression vector pJLA601. The resulting clone was grown in SR medium at 30°C to A 550 = 0.4 and induced by temperature shift to 42°C. Total cell protein from aliquots of the culture was separated on a 0.1% SDS-12.5% polyacrylamide gel. Lanes: 1, before induction; 2, 30 min after induction; time difference between the following lanes is 30 min. The arrow indicates the D-HicDH band.

(3) With respect to the cloning methodology, the region described was very difficult to clone, being completely absent in a normal genomic cosmid bank. Only subsequent to the mapping of and physically enriching for the required sequence using a long homologous ‘consensus’ probe (see Woods, 1984, and Wood, 1987, for a discussion on the use of various-length probes; Pennica et al., 1984; Ulhich et al., 1985) was the cloning successful. The low viability of the initial clones is correlated with high segregational plasmid instability and poor growth properties conferred by a DNA fragment closely linked to the D-HicDH gene. Removal of this region allowed normal growth of the recombinant strains and at least loo-fold derepression of the D-HicDH gene. (4) We present a method for efficient production of D-HicDH, which could be used for large-scale production of certain aa or D-hydroxyacids. The availability of the gene and gene sequence will now

56

provide a basis for the production study

of structure-function

part of a protein

of mutants

for the

relationships,

e.g., as

Dixon, H.B.F. and Perham, groups

anhydride.

blocking

Biochem.

of amino

J. 109 (1968)

312-314.

design project.

Fox, D.T.: Natural Genet. Frank,

variation

R., Meyerhans,

fragments:

We thank Dr. H’.L. Paul (BBA, Braunschweig) the rabbits.

for

We thank John

McCarthy for the pJLA vector and Barbel SeegerKunth and Sabine Peters for secretarial assistance.

in the genetic

code. Annu.

Rev.

21 (1987) 67-91.

Simultaneous

ACKNOWLEDGEMENTS

his help in immunising

R.N.: Reversible

with citraconic

K. and

and biological

an efficient and complete

Enzymol. Friedman,

A., Schwellnus,

synthesis

Blocker,

applications

H.:

of DNA

methodology.

Methods

154 (1988) 201-249.

D.I., Imperiale,

formation

M.J. and Adhya,

in the control

S.L.: RNA 3’ end

of gene expression.

Annu.

Rev.

Genet. 21 (1987) 453-488. Garnier,

J., Osguthorpe,

accuracy

D.J. and Robson,

and implications

the secondary

B.: Analysis

of simple methods

structure

ofglobular

F., Kern,

E. and

proteins.

of the

for predicting J. Mol. Biol. 120

(1978) 97-120. REFERENCES

Gbtz,

F., Popp,

nucleotide Alpert,

C.-A. and Chassy,

tide sequence

B.M.: Molecular

cloning and nucleo-

III’“” gene of Lactobacillus casei.

of the factor

Gene 62 (1988) 277-288. Andrews,

J., Clore,

Gronenborn,

Davies,

B., Kalderon,

R.W., Gronenborn,

D., Papadopoulos,

S., Sims, P.F.G. and R. Stancombe: the dihydrofolate

reductase

A.M.,

PC., Schafer,

Nucleotide

sequence

of

gene of methotrexate-resistant

Lactobacillus casei. Gene 35 (1985) 217-222. and simple method acid bacteria.

for isolating

Kor. J. Appl.

plasmid

Microbial.

Bioeng.

13 (1985)

289-296. Benyajati,

D.A. and Sofer, W.: Alcohol

gene of Drosophila melanogaster: relationship

dehydrogenase of intervening

sequences

Proc. Natl. Acad.

to functional

domains

recombinant

Heyneker,

H.L., Boyer,

Construction

Greene,

cloning

C.-J., Jornvall,

Vol. 11. Academic

proce-

Betlach,

system.

M.C.,

J.H. and Falkow,

of new cloning

S.:

vehicles,

Gene 2 (1977) 95-l 13.

H., Eklund,

H. and

Furugren,

B.:

In Boyer, P.D. (Ed.), The Enzymes,

Press, New York,

Chen, E.Y. and Seeburg, simple method

P.J.,

H.W., Crosa,

Alcohol dehydrogenases.

P.H.: Supercoil

for sequencing

1975, pp. 104-190. sequencing:

plasmid

a fast and

DNA. DNA 4 (1985)

165-170. Biochemistry

Cruickshank

W.H.,

chromatography peptides. Davidson,

G.D.: Prediction

of protein

J. Mol. Biol. 166 (1983) 557-580.

J.I. and

Perham,

dehydrogenase

from

B.L. and Kaplan,

for the

selective

H.: Diagonal

purification

muscle.

cultivation

Nature

3-phosphate

J.I.: Amino

dehydrogenase

Hensel,

R., Mayr,

U. and

of the

Glyceraldehyde muscle.

3-phosphate

Nature

Yang,

allosteric

219

(1968)

C.: The complete

L-lactate

Henikoff,

S.: Unidirectional

creates

targeted

from

134 (1983) 503-511.

digestion

breakpoints

primary

dehydrogenase

Lactobacillus casei. Eur. J. Biochem.

with

exonuclease

for DNA sequencing.

III

Gene 28

Hoppe, J. and Sebald, W.: Amino acid sequence ofthe proteolipid subunit

of the proton-translocating bacterium

ATPase

complex

PS-3. Eur. J. Biochem.

from

107 (1980)

57-65. Holland,

J.P. and Holland,

M.J.: The primary

glyceraldehyde-3-phosphate

structure

of a

gene from Sac-

dehydrogenase

charomyces cerevisiae. J. Biol. Chem. 254 (1979) 9839-9845. Houmard,

J. and Drapeau,

proteolytic Acad. Hummel,

G.R.:

Staphylococcal

enzyme specific for glutamoyl

protease:

bonds.

a

Proc. Natl.

Sci. USA 69 (1972) 3506-3509. W., Schiitte, H. and Kula, M.-R.: New enzymes for the

synthesis

of chiral

M.E.: A medium

J. Appl.

Hummel,

compounds.

W., Schiitte,

Ann. N.Y. Acad.

Bacterial.

for the

23 (1960)

H. and Kula,

dehydrogenase

Sci. 434

enzyme

suitable

M.-R.:

D-2-Hydroxyiso-

Lactobacillus casei. A new

from

for stereospecific

reduction

of 2-ketocarbo-

xylic acids. Appl. Microbial. Biotechnol 21 (1985) 7-15. Ish-Horowitz, P. and Burke, J.F.: Rapid and efficient cosmid vector Jornvall,

cloning.

Nucleic

Acids Res. 9 (1981) 2989-2998.

H.: Horse liver alcohol dehydrogenase

structure

216 (1967) 1181-1185.

M. and Sharpe,

of lactobacilli.

of tyrosyl

52 (1974) 1013-1017.

of glyceraldehyde

J.C., Rogosa,

130-135.

R.N.: pig

1025-1028.

caproate

Malchy,

Can. J. Biochem.

from lobster

conforma-

13 (1974) 222-245.

B.E., Sajgo, M., Noller, H.F. and Harris,

acid sequence deMan,

of Escherichia coli with

D.: Studies on transformation

(1984) 194-205.

Chou, P.Y. and Fasman, tion

Hanahan,

the thermophilic

and characterization

II. A multipurpose Brand&n,

extraction

plasmid DNA. Nucleic Acids

Res. 7 (1979) 1513-1523. Bolivar, F., Rodriguez, R.L.,

gene. J.

Biol. Chem. 261 (1986) 11409-11415.

(1984) 351-359.

Sci. USA 78 (1981) 2717-2721.

H.L. and Daly, J.: A rapid alkaline

dure for screening

in the protein.

J.C.: In vivo and in vitro trans-

of the Clostidium pasteurianum ferredoxin

structure C., Place, A.R., Powers,

Birnboim,

M.C. and Rabinowitz,

cription

Harris,

DNA from lactic

Complete

13 (1985) 5895-5906.

plasmids.

Bae, H.S., Baek, Y.J., Kim, Y.K., Yoo, M. and Pack, Y.: Rapid

K.H.:

hyicus cloned in Staphylococcus carnosus. Nucleic Acids Res. Graves,

G.M.,

Schleifer,

of the lipase gene from Staphylococcus

sequence

of the isoenzymes.

- on the primary

Eur. J. Biochem.

16 (1970)

41-49. Kallwass,

H., Tsai,

molecular

H. and

properties

Schtltte,

H.: Crystallisation

of D-2-hydroxyisocaproate

and

dehydro-

57

genase from LactobaciZlus casei. FEMS Microbial. Lett. 43 (1987) 263-267. Kammerer, W., Deuschle, U., Gentz, R. and Bujard, H.: Functional dissection of Escherichia coli promoters: information in the transcribed region is involved in late steps of the overall process. EMBO J. 5 (1986) 2995-3000. Khandjian, E.W.: Optimized hybridization of DNA blotted and fixed to nitrocellulose and nylon membranes. Biotechnology 5 (1987) 165-167. Knaus, R. and Bujard, H.: pL of coliphage lambda: an alternative solution for an efficient promoter. EMBO J. 7 (1988) 2919-2923. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685. Maxam, A.M. and Gilbert, W.: A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74 (1977) 560-564. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Monsen, T.J., Holm, S.E. and Burman, L.G.: A general method for cell lysis and preparation of deoxyribonucleic acid from streptococci. FEMS Microbial. Lett. 16 (1983) 19-24. Newbury, S.F., Smith, N.H., Robinson, E.C., Hiles, I.D. and Higgins, C.F.: Stabilization of translationally active mRNA by procaryotic REP sequences. Cell 48 (1987) 297-310. Ohlsson, I., Nordstrom, B. and Brand&n, C.-I.: Structural and functional similarities within the coenzyme binding domains of dehydrogenases. J. Mol. Biol. 89 (1974) 339-354. Pennica, D., Nedwin, G.E., Hayflick, J.S., Seeburg, P.H., Derynck, R., Palladino, M.A., Kohr, W.J., Aggarwal, B.B. and Goeddel, D.V.: Human tumour necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature 312 (1984) 724-729. Porter, E.V. and Chassy, B.M.: Nucleotide sequence of the B-Dphosphogalactoside galactohydrolase gene of Lactobacillus casei: comparison to analogous pbg genes of other Grampositive organisms. Gene 62 (1988) 263-276. Poutska, A., Rackwitz, H.-R., Frischauf, A.-M., Hohn, B. and Lehrach, H.: Selective isolation of cosmid clones by homologous recombination in Escherichia coli. Proc. Natl. Acad. Sci. USA 81 (1984) 4129-4133. Rossmann, M.G., Mqras, D. and Olsen, K.W.: Chemical and biological evolution of a nucleotide-binding protein. Nature 250 (1974) 194-199. Rossmann, M.G., Liljas, A., Branden, C.-J. and Banaszak, L.J.: Evolutionary and structural relationships among dehydrogenases. In Boyer, P.D. (Ed.), The Enzymes, Vol. 11. Academic Press, New York, 1975, pp. 61-102. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Scalenghe, F., Turco, E., Edstrom, J.-E., Pirrotta, V. and Melli, M.: Microdissection and cloning of DNA from a specific region of Drosophila melanogaster polytene chromosomes. Chromosoma 82 (1981) 205-216. Schauder, B., Blocker, H., Frank, R. and McCarthy, J.E.G.: Inducible expression vectors incorporating the Escherichia

co/i atpE translational

initiation region. Gene 52 (1987) 279-283. Schiitte, H., Hummel, W. and Kula, M.-R.: L-2-Hydroxyisocaproate dehydrogenase -a new enzyme from Lactobacillus co&w for the stereospecific reduction of 2-ketocarboxylic acids. Appl. Microbial. Biotechnol. 19 (1984) 167-176. Schtitte, H., Hummel, W., Tsai, H. and Kula, M.-R: L-Leucine dehydrogenase from Bacillus cereus: production, large scale purification and protein characterization. Appl. Microbial. Biotechnol. 22 (1985) 306-317. Shimizu-Kadota, M., Kiwaki, M., Hirokawa, H. and Tsuchida, N.: ISLl: a new transposable element in Lactobacillus casei. Mol. Gen. Genet. 200 (1985) 193-198. Southern, E.M.: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98 (1975) 503-517. Tabor, S. and Richardson, C.C.: DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84 (1987) 4767-4771. Taylor, S.S.: Amino acid sequence of dogfish muscle lactate dehydrogenase. J. Biol. Chem. 252 (1977) 1799-1806. Towbin, H., Staehelin, T. and Gordon, J.: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76 (1979) 4350-4354. Tsai, H., Lerch, H.-P., Kalwass, H., Schiitte, H., Hoppe, J. and Collins, J.: The D- and L-2-hydroxyisocaproate dehydrogenases from lactobacilli are structurally and immunologically unrelated enzymes. In Neijssel, O.M., Van der Meer, R.R. and Luyben, K.C.A.M. (Eds.), Proc. 4th Eur. Congr. Biotechn., Vol. 2. Elsevier, Amsterdam, 1987, pp. 228-231. Van der Vossen, J.M.E.M., Van der Lelie, D. and Venema, G.: Isolation and characterisation of Streptococcus cremork Wg2specific promoters. Appl. Eur. Microbial. 53 (1987) 2452-2457. Ullrich, A., Bell, J.R., Chen, E.Y., Herrera, R., Petruzzelli, L.M., Dull, T.J., Gray, A., Coussens, L., Liao, Y.-C., Tsubokawa, M., Mason, A., Seeburg, P.H., Grunfeld, C., Rosen, O.M. and Ramachandran, J.: Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes. Nature 313 (1985) 756-761. Vanderslice, P., Copeland, W.C. and Robertus, J.D.: Cloning and nucleotide sequence of wild type and a mutant histidine decarboxylase from Lactobacillus 30a. J. Biol. Chem. 261 (1986) 15186-15191. Wandrey, C., Fiolitakis, E., Wichmann, U. and Kula, M.-R.: L-amino acids from a racemic mixture of a-hydroxy acids. Ann. N.Y. Acad. Sci. 434 (1984) 91-94. Williams, J.G. and Mason, P.J.: Hybridisation in the analysis of RNA. In Hames, B.D. and Higgins, S.J. (Eds.), Nucleic Acid Hybridisation - A Practical Approach. IRL Press, Oxford, 1985, pp. 139-160. Wood, J.W.: Gene cloning based on long oligonucleotide probes. Methods Enzymol. 152 (1987) 443-447. Woods, D.: Oligonucleotide screening of cDNA libraries. Focus 6 (1984) l-3. Zassenhaus, H.P., Butow, R.A. and Harmon, Y.P.: Rapid electroelution of nucleic acids from agarose and acrylamide gels. Anal. Biochem. 125 (1982) 125-130.