Detection and identification of U69 gene mutations encoded by ganciclovir-resistant human herpesvirus 6 using denaturing high-performance liquid chromatography

Detection and identification of U69 gene mutations encoded by ganciclovir-resistant human herpesvirus 6 using denaturing high-performance liquid chromatography

Journal of Virological Methods 161 (2009) 223–230 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.els...

1MB Sizes 0 Downloads 24 Views

Recommend Documents

No documents
Journal of Virological Methods 161 (2009) 223–230

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Detection and identification of U69 gene mutations encoded by ganciclovir-resistant human herpesvirus 6 using denaturing high-performance liquid chromatography Kazushi Nakano a , Kazuko Nishinaka a , Tatsuya Tanaka b , Atsushi Ohshima c , Nakaba Sugimoto a , Yuji Isegawa a,∗ a

Department of Infectious Disease Control, G-5, Graduate School of Medicine, Osaka University, 2-2 Yamada-Oka Suita, Osaka 565-0871, Japan Center for Medical Research and Education, C-10, Graduate School of Medicine, Osaka University, Suita, Osaka 565-0871, Japan c Gene Engineering Laboratory, Genomics Program, Nagahamabio Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829, Japan b

a b s t r a c t Article history: Received 24 February 2009 Received in revised form 10 June 2009 Accepted 16 June 2009 Available online 25 June 2009 Keywords: U69 Protein kinase HHV-6 GCV resistant dHPLC

A denaturing high-performance liquid chromatography (dHPLC) assay was developed to detect antiviral drug-resistance mutations of human herpesvirus 6 (HHV-6). Recombinant baculoviruses were created that contained wild-type and mutant forms of the HHV-6 U69 gene, which determines sensitivity to the antiviral drug ganciclovir (GCV). The mutations causing GCV resistance in HHV-6 U69 were single-base mutations adapted from known GCV-resistant DNA sequences of HCMV, and their ability to confer GCV resistance on recombinant baculoviruses was confirmed. Six characterized mutant sequences, including one reported previously that encodes a GCV-sensitive kinase-activity mutant, were used. DNA was extracted, and the levels of homoduplex and heteroduplex DNA in the PCR products from mixed wildtype and mutant viral DNAs were determined using dHPLC. The optimized assay could distinguish the different mutants, and could detect mutants representing only 10% of the DNAs. The new assay with dHPLC readout permitted the rapid (4 h), objective, and reproducible detection of HHV-6 drug-resistance mutations. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Human herpesvirus 6 (HHV-6) was first isolated in 1986 from the peripheral blood of patients with lymphoproliferative disorders (Salahuddin et al., 1986). Comparison with other human herpesviruses by molecular and immunological analyses revealed that it has distinct characteristics (Lusso et al., 1988). HHV-6 replicates predominantly in CD4+ lymphocytes (Takahashi et al., 1989) and may establish latent infection in cells of the monocyte/macrophage lineage (Kondo et al., 1991). Infection with this virus results in exanthem subitum (ES), a common illness in infants (Yamanishi et al., 1988), but has not been linked clearly to any disease in adults except in patients with immunodeficiency. Because HHV-6 infects frequently immunocompromised individuals, especially transplant recipients, AIDS patients, and children with congenital immunodeficiency disorders, it is important to assay the susceptibility of HHV-6 clinical isolates to antiviral drugs. HHV-6 is amenable to therapy with the acyclovir derivative ganciclovir (GCV), which is a nucleoside analogue that is

∗ Corresponding author. Tel.: +81 6 6879 3301; fax: +81 6 6879 3309. E-mail address: [email protected] (Y. Isegawa). 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.06.016

mono-phosphorylated by an encoded virus protein kinase (U69 in HHV-6) before being further phosphorylated by host cellular kinases to its active, triphosphate form. GCV triphosphate is a competitor of dGTP and inhibits the viral DNA polymerase (Erice, 1999). GCV-resistant HCMV mutants have been both isolated from patients and generated in the laboratory (Chou et al., 2005; Lurain et al., 2001; Smith et al., 1997). Little work has been done to elucidate the resistance of HHV-6 to GCV, to date, although GCVresistant HHV-6 has been reported (Bolle et al., 2002; Isegawa et al., 2009; Manichanh et al., 2001; Safronetz et al., 2003), GCVphosphorylation by U69 gene product has been shown (Bolle et al., 2002) and U69 mutations responsible for GCV resistance have been assayed using the baculovirus expression system (Safronetz et al., 2003). Denaturing high-performance liquid chromatography (dHPLC) separates PCR products by size and sequence. It detects sequence divergences in DNA fragments, including single-base substitutions and short deletions and insertions. This method is sufficiently sensitive for the reliable detection of nearly 100% of DNA sequence variations at an optimized partially denaturing temperature (Xiao and Oefner, 2001). Previously, the susceptibility of HHV-6 to antiviral drugs was determined by real-time PCR (Isegawa et al., 2007). In this study, a new approach for detecting HHV-6 U69 mutations

224

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

using dHPLC was developed and evaluated. With this approach, clinical samples can be processed in a 96-well format and loaded continuously onto the column for rapid analysis. 2. Materials and methods 2.1. Cells and viruses Umbilical cord blood mononuclear cells (CBMCs) were separated on a Ficoll-Conray gradient, transferred to RPMI 1640 medium containing 10% fetal calf serum (FCS), and stimulated with 5 ␮g/ml phytohemagglutinin for 2 or 3 days. HHV-6 strain HST, which was isolated from a patient with ES and belongs to the HHV-6B group, was propagated in fresh human peripheral mononuclear cells (Yamanishi et al., 1988). When more than 80% of the cells showed cytopathic effects, the culture was frozen and thawed twice, spun at 1500 × g for 10 min, and the supernatant was stored at −80 ◦ C as a cell-free virus stock. The viruses and DNA samples used for the U69 DNA sequence analysis were reported previously (Sjahril et al., 2009). Recombinant baculovirus containing the full-length wild-type U69 ORF (strain HST) was constructed as described before (Isegawa et al., 2008). The M318V U69 mutant baculovirus constructed previously (Isegawa et al., 2009) was used. Spodoptera frugiperda 21 (Sf-21) cells (Invitrogen, Tokyo, Japan) were maintained and propagated in Sf-900 medium (Invitrogen) supplemented with 5% FCS, at 27 ◦ C. 2.2. DNA sequencing and sequence analysis To amplify the HHV-6 genomic DNA, the viral genome was isolated from virus-infected CBMCs with a QIAamp DNA blood mini kit (Qiagen K.K., Tokyo, Japan), and 100 ng of total DNA was subjected to 30 cycles of PCR with EX-Taq polymerase (Takara Bio Inc., Otsu, Shiga, Japan), as described before (Sjahril et al., 2009). PCR for the DNA sequence analysis was carried out with the primer pair: U69-Met-NcoI and U69-Ter-NotI, which was reported previously (Isegawa et al., 2008). The corresponding sequences were confirmed by direct sequencing of the PCR products amplified from the DNA, using an ABI PRISM 3100 gene analyzer (Applied Biosystems Japan Ltd., Tokyo, Japan). 2.3. Construction of mutant recombinant baculoviruses To construct recombinant baculoviruses expressing mutant U69 genes, the following mutations were introduced into the pAcH6 plasmid containing the wild-type U69: C–A, T–G, T–C, C–A, and G–A at positions 1340, 1342, 1349, 1385, and 1388, respectively, using the PrimeSTAR® Mutagenesis Basal Kit (Takara Bio). As shown in Fig. 1A, these mutations corresponded to A447D, C448G, L450S, A462D, and C463Y in functional subdomain XI. Sf-21 insect cells were transfected with pAcH6 plasmids containing the mutant U69 genes together with the linearized AcNPV baculovirus DNA (BaculoGoldTM , BD PharMingen, San Diego, CA), and the recombinant baculoviruses were expanded into high-titer virus stocks, following the manufacturer’s instructions. The insertion of the U69 gene into the baculovirus genome was confirmed by PCR analysis. 2.4. Real-time PCR assay for recombinant baculovirus antiviral susceptibility testing Cells (5 × 105 ) in each well of a 12-well culture plate were infected with recombinant baculoviruses at an MOI of 0.3 (100 ␮l) at room temperature. One hour later, the medium was changed to

Fig. 1. (A) Map of the HHV-6 protein kinase (U69) functional subdomains, and predicted GCV-resistance mutations estimated from the UL97 mutation map of GCV-resistant HCMV. Gray boxes: subdomains of the HHV-6 U69 protein kinase. (B) Position map of synthesized primers and predicted GCV-resistance mutations in the HHV-6 U69 nucleotide sequence. Arrows: mutation positions. Arrowheads: primers; numbers show primer starting positions.

1 ml of Sf-900 medium with serial twofold dilutions of GCV (Wako, Osaka, Japan) ranging from 78 to 1250 ␮M. The plates were incubated at 27 ◦ C for 3 days, then 1 ml of the culture was collected, the cells were separated from the baculovirus-containing supernatant by centrifugation (1100 × g, 1 min, 4 ◦ C), and the DNA was extracted from the supernatant using the QIAamp DNA blood mini kit (Qiagen). The DNA samples were examined by real-time PCR or stored at −70 ◦ C until assayed. Reference GCV-susceptible (HST) and GCV-resistant (M318V) recombinant baculoviruses were included as controls in each PCR assay, as shown in a previous report (Isegawa et al., 2009). To quantify the recombinant baculovirus DNA, the DNA samples were subjected to quantitative, real-time PCR for HHV-6 U69 DNA as described previously (Isegawa et al., 2007). 2.5. PCRs Several primer sets were designed and tested (Fig. 1B). Forward primers were dHPLC-a2 (770–790), CAAATTCCGTTTGTATGGATC; dHPLC-a0 (837–855), CGAAGATTGGGATGTCAGG; and dHPLC-a3 (1162–1181), TTGGTCAATGTATGCGAGGC. The reverse primers were dHPLC-b1 (1601–1585), CCATACTCGGACGACTG; and dHPLC-ter (1692–1674), TCACATCTGAAAGAGAGAT. The sizes of the PCR products obtained by the primer pairs dHPLC-a2 and -ter, dHPLC-a0 and -b1, and dHPLC-a3 and -b1 were 923 bp, 765 bp, and 440 bp, respectively. The suitability and assay conditions for the dHPLC analysis of the PCR products were predicted by the WAVE simulation software (Transgenomic, Inc., San Jose, CA). 2.6. Detection of mutations by dHPLC The detection of mutations in the amplified PCR products was performed by dHPLC with the WAVE Nucleic Acid Fragment Analysis System (Transgenomic, Inc.). All buffers were supplied by Transgenomic. Buffer A contained 0.1 M triethylammonium acetate (TEAA) and 0.025% (vol/vol) acetonitrile, and buffer B was 0.1 M TEAA and 25% (vol/vol) acetonitrile. In the WAVE system, the PCR products are separated on a chromatographic column (DNASep column) packed with C18 alkylated polystyrene-divinylbenzene polymeric beads. A positively charged ion-pairing reagent (TEAA) allows the negatively charged

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

DNA to interact with the hydrophobic DNASep column matrix. An increasing proportion of the organic mobile phase (acetonitrile) is then used to elute the DNA fragments from the matrix in a size-dependent manner (under nondenaturing conditions) or a sequence-dependent manner (under partially or fully denaturing conditions), and the fragments are detected by UV analysis. For the present analysis, the temperature was set high enough for the partial denaturation of DNA duplexes. Under these conditions, the wild-type DNAs elute as a single peak, whereas mixtures of

225

wild-type and mutant DNAs (which contain homoduplex and heteroduplex DNAs) elute as two to four peaks or as a single peak with a shoulder. The temperature, gradient conditions, and flow rates of the WAVE system were optimized to differentiate the wild-type and GCV-resistance DNA types. HHV-6 U69 mutations were detected by mixing each sample with an HHV-6 control (wild-type). The samples were also automatically quantified by the WAVE system according to their peak area or height.

Fig. 2. Variation in U69 gene amplicons of the compared HHV-6 strains. All nucleotides are shown for the B viruses, and only the variation is shown for the other viruses. Numbers are the nucleotide positions of the U69 gene. Underlines indicate the nucleotide sequences of subdomains VIb and XI. *The B viruses were HHV-6 variant B strains HST, Z29, AB69, BT344, BT348, BT415, BT449, BT451, BT499, BT519, BT552, BT562, M2, St. W., ES-1, ES-3, ES-5, ES-6, ES-7, ES-8, ES-11, ES-12, ES-13, ES-14, ES-16, ES-17, ES-21, and ES-24. **The A viruses were variant A strains U1102, GS, DA, CO1, CO7, and CO8. Subtypes AB84 and ES-18 were of variant B and #5628 was of variant A.

226

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

2.7. Nucleotide sequence accession numbers The DDBJ accession numbers for the region between the dHPLCa0 and dHPLC-b1 primers of the U69 genes of the strains and isolates, U1102, GS, DA CO1, CO7, CO8, #5628, AB69, AB84, BT344, BT348, BT415, BT449, BT451, BT499, BT519, BT552, BT562, St. W., ES-1, ES-3, ES-5, ES-6, ES-7, ES-8, ES-11, ES-12, ES-13, ES-14, ES16, ES-17, ES-18, ES-21, and ES-24, used in this paper are from AB480248 to AB480281. 3. Results 3.1. U69 DNA sequence analysis To examine whether the U69 deviation between strains U1102 and HST was conserved within variants A and B, the nucleotide sequence of the U69 gene in 36 HHV-6 isolates, classified as 7 variant A and 29 variant B isolates, was determined. The HHV-6 variant B strains isolated from ES patients were HST, St. W., ES1, ES-3, ES-5, ES-6, ES-7, ES-8, ES-11, ES-12, ES-13, ES-14, ES-16, ES-17, ES-21, and ES-24 (Sjahril et al., 2009). The variant B strains isolated from bone marrow transplantation recipients were AB69, BT344, BT348, BT415, BT449, BT451, BT499, BT519, BT552, BT562, and M2 (Sjahril et al., 2009). Isolate M2 is a GCV-resistant virus (Isegawa et al., 2009). Strain Z29 was isolated originally from an AIDS patient. All the variant B viruses except isolates AB84 and ES-18 had the same sequence (Fig. 2). The nucleotide substitutions compared with strain HST were A861C and C1281G for AB84 and ES18, respectively. All the variant A viruses except #5628 had the same sequence. In #5628, which was isolated from a healthy donor, the nucleotide substitutions compared with the strain U1102 sequence were A896G, A901A, A960C, C1032T, G1173A, T1197C, T1206C, and G1272A (Fig. 2). Thus, the U69 deviation between strains U1102 and HST was conserved in variants A and B (Fig. 2). 3.2. Recombinant baculovirus antiviral susceptibility testing To assess the contributions of the U69 gene mutations (A447D, C448G, L450S, A462D, and C463Y) to GCV resistance, a baculovirus reduction assay was performed. In this assay, recombinant baculoviruses bearing the wild-type U69 gene show GCV susceptibility, which depends on the U69 kinase activity, since it was shown that baculoviruses with no U69 protein kinase insert are not affected by the drug (Safronetz et al., 2003). As shown in Fig. 3, the recombinant baculoviruses expressing the U69 A447D, C448G, L450S, A462D, and C463Y mutants were all equally resistant to GCV, to the same degree as the positive control baculovirus expressing the U69 M318V mutant (Isegawa et al., 2009; Safronetz et al., 2003), under conditions in which a control baculovirus expressing the wild-type U69 (Isegawa et al., 2009; Safronetz et al., 2003) was GCV-sensitive. Therefore, the U69 M318V, A447D, C448G, L450S, A462D, and C463Y substitutions were all associated with HHV-6 GCV resistance.

Fig. 3. Effect of GCV on the titer of recombinant baculoviruses containing wild-type or mutated HHV-6 U69 protein kinase. The wild-type virus (BV-U69-wild) and GCVsensitive mutant virus (BV-U69-L202I-L213I) were sensitive to GCV as described previously (Isegawa et al., 2009). GCV resistance index: treatment/non-treatment titer. Error bars indicate the range of values recorded from triplicate experiments., BV-U69-wild; , BV-U69-L202I-L213I; 䊉, BV-U69-M318V; , BV-U69-A447D; , BVU69-C448G; , BV-U69-L450S; , BV-U69-A462D; ♦, BV-U69-C463Y.

C448G, L450S, A462D, and C463Y, were detected by dHPLC (data not shown). Next, to work with as small a PCR product as possible, it was determined whether one of the other primer pairs could be used to detect selectively all or a subset of the mutations. With the PCR products from the primer pair dHPLC-a0 and -b1, all of the mutations were still detectable by dHPLC (Fig. 4A), but with the dHPLC-a3 and -b1 pair, L450S could not be detected (data not shown); therefore, the dHPLC-a0 and -b1 primer set was used for the rest of the experiments. All of the mutations except U69 M318V were detected at a 59 ◦ C column temperature, and M318V was optimally detected at 54.5 ◦ C (Fig. 4A). Under the optimum conditions, each mutation exhibited a characteristic DNA elution pattern (Fig. 4B). In contrast, when the clinical samples AB84, M2 and ES-18 were assayed with a normal control, no additional peaks were detected by dHPLC under the two optimum conditions (data not shown). These results suggested that using the optimum column temperature, each mutation could be predicted by its characteristic DNA elution pattern in clinical samples analyzed by dHPLC. 3.4. Mutation frequency estimation by dHPLC To analyze the mutation frequency quantitatively by dHPLC, the area or height of the detected peaks was measured. When samples of wild-type and mutant PCR products mixed 1:1 were analyzed by dHPLC, the ratio of homoduplex-to-heteroduplex DNAs was almost the same whether it was determined from the peak area or the peak height (Table 1). The result determined from the peak area for a range of mutant ratios was almost same as that

3.3. Detection of HHV-6 U69 mutations by dHPLC The goal of this study was to develop an easy-to-perform assay for detecting HHV-6 U69 mutations that confer antiviral-drug (GCV) resistance, which would be suitable for implementation in a modern routine diagnostic laboratory. Therefore, to determine and optimize its characteristics, several parameters of the assay were studied in detail, such as the size and amount of the PCR products, and a temperature titration of the mixtures of PCR products from the wild-type and mutant U69 was performed. When the primer pair dHPLC-a2 and -ter (Fig. 1B) was used for PCR amplification, all of the mutations, U69 M318V, A447D,

Table 1 Ratio of homoduplex to heteroduplex DNA determined from peak area or peak height. Heteroduplex/homoduplex

M318V A447D C448G A462D C463Y

Area

Height

1/1.0 1/2.5 1/1.1 1/1.1 1/1.0

1/1.1 1/2.3 1/1.2 1/1.2 1/0.8

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

227

Fig. 4. Temperature titration of mixtures of wild-type and mutant PCR products. PCR products were amplified using primers dHPLC-a0 and -b1. (A) The temperature titration range for U69-A447D, U69-C448G, U69-L450S, U69-A462D, and U69-C463Y was 56–61 ◦ C. The range for U69-M318V was 51–56 ◦ C. (B) Chromatogram of each mutant under optimum conditions.

determined from the peak height for U69 M318V (data not shown). Therefore, the data were analyzed using the peak height as a semiquantitative assessment, because the computer could not always determine the peak areas accurately. When the mutant ratios were

varied, the dHPLC elution profiles of pooled DNA amplicons containing 0–50% of the variant allele (Fig. 5) showed an increase in the ratio of heteroduplex-to-homoduplex DNA relative to the mutation ratio (Fig. 6). The observed data paralleled the theoretical data

228

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

Fig. 5. dHPLC elution profiles of pooled DNA amplicons representing 0–50% of the variant allele. The chromatogram of each mutant was obtained under the optimum conditions shown in Fig. 4.

except for U69-A447D. These results suggest that using dHPLC, a mutation affecting at least 10% of a DNA pool can be detected, and the amount of a GCV-resistance mutation can be measured semi-quantitatively. 4. Discussion The estimation of single-nucleotide polymorphism (SNP) allele frequency in pooled DNA samples is a promising approach to clarifying the relationships between SNPs and diseases or drugresistance. Several methods have been described for estimating SNP allele frequency in pooled DNA samples, including dHPLC (Hoogendoorn et al., 2000; Wolford et al., 2000), restriction fragment length polymorphism (RFLP) (Breen et al., 2000; Shifman et al., 2002), single strand conformation polymorphism (SSCP) (Sasaki et al., 2001), bioluminometric assay coupled with modified primer extension reactions (BAMPER) (Zhou et al., 2001), matrix-assisted laser desorption/ionization time-of-flight (MALDITOF) mass spectrometry (Buetow et al., 2001; Ding et al., 2004), pyrosequencing (Gruber et al., 2002; Neve et al., 2002), real-time

PCR with allele-specific primers (Germer et al., 2000), real-time PCR with allele-specific probes (Breen et al., 2000; Xu et al., 2002; Yu et al., 2006), alternately binding probe competitive PCR (ABC-PCR) (Tani et al., 2007; Noda et al., 2008), and nucleobase quenching probe (QP) assay (Leman et al., 2006; Matsumoto et al., 2007). Although real-time PCR with allele-specific probes, ABCPCR, and the QP assay appear promising for the high-throughput, sensitive, and accurate estimation of SNP allele frequencies in DNA pools, these methods require highly specialized, expensive devices that combine a fluorometer and thermal cycler for realtime fluorescence intensity measurements; moreover, real-time PCR with allele-specific probes requires the design and optimization of two allele-specific fluorescent probes that are labeled with different fluorescent dyes. The dHPLC assay described here also has the potential for high-throughput, sensitive, and accurate results, and provides an overall estimation of the SNP allele frequency. The handling, including sample preparation, for this dHPLC assay is not complex, although it is not simpler than for real-time PCR. Moreover, this assay costs less to perform than real-time PCR.

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

229

Fig. 6. Allele frequencies calculated from the analysis of PCR product pools for U69 polymorphisms.

To determine whether the dHPLC method could be used to detect U69 mutations, the U69 nucleotide sequences of clinical samples were first compared, as shown in Fig. 2. HHV-6 variant B is related to disease, and only variant B viruses have been detected as reactivated viruses after transplantation (Bolle et al., 2005; Sjahril et al., 2009). For variant B, all the clinical samples examined except AB84 and ES-18 had the same U69 gene sequence. In general, when the active center of an enzyme is mutated, the activity of the enzyme is decreased. For example, mutation D314A in subdomain VIb of U69 led to a loss of protein kinase activity (data not shown). Therefore, it is speculated that the mutations in the active site of the U69 protein cause GCV resistance by reducing the enzyme activity, and multimutations may lead to a complete loss of kinase activity. Although Smith et al. (1997) reported two strains of GCV-resistant HCMV that have double mutations in the UL97 protein kinase, most of the GCV-resistant HCMVs of the UL97 mutation type have a single mutation. It would be rare for two concurrent mutations related to GCV resistance in the U69 gene to occur, and if they did, they should be located in subdomain VIb and/or XI, as predicted by findings in GCV-resistant HCMV. A novel mutation in subdomain VIb or XI would probably be detected by the dHPLC method described here, because a given set of conditions of the dHPLC assay is used to detect any mutation within subdomain XI, and the same is true for subdomain VIb. However, if a novel mutation causing GCV resistance occurred in another part of the U69 gene, this method would not be effective for detecting it. The mutations of isolates AB84 and ES-18, which were not in subdomain VIb or XI (and do not confer GCV resistance) were not detected with dHPLC under the two opti-

mum conditions, and would require different dHPLC conditions to be detected. Nevertheless, the U69 mutations related to GCV resistance were detected easily and quickly by dHPLC. The mutations situated in subdomain XI were detected at 59 ◦ C, while the one in subdomain VIb was detected at 54.5 ◦ C. The detection temperature for subdomain XI may be related to the relatively GC-rich nature of this region. For this reason, it may be relatively simple to identify mutations in subdomain XI on the basis of temperature. Each mutation of subdomain XI was distinguishable from the others by its elution pattern on dHPLC. These results suggest that the mutation of a GCV-resistant virus can be predicted from the elution pattern and temperature of dHPLC, although DNA sequencing may be required to confirm the mutation. Since the DNA amounts of the GCV-resistance mutations could be measured semi-quantitatively by dHPLC, these findings suggest that the proportion of GCV-resistant virus in a clinical sample could also be determined by dHPLC. If GCV-resistant variant A viruses occurred, they could probably be detected by the dHPLC method using strain U1102 as the wild-type, because all the examined variant A viruses except #5628 had the same U69 gene sequence, as shown in Fig. 2. The detection of GCV-resistance mutations from dHPLC was obtained within 4 h, in contrast to the 3 days required to obtain the full susceptibility testing results by real-time PCR (Isegawa et al., 2007). This is a considerable improvement, and transplant or immuno-compromised patients could benefit from such a quick and quantitative detection of HHV-6, especially of drug-resistant viruses. Finally, this assay would indicate when a patient must

230

K. Nakano et al. / Journal of Virological Methods 161 (2009) 223–230

change therapeutic drugs due to the appearance of an antiviral drug-resistant strain. Acknowledgements This work was supported by a Grant-in-Aid for Scientific Research (C) (grant 20611009) from the Japan Society for the Promotion of Science. We would like to express appreciation to I. Nishina (Center for Medical Research and Education, Graduate School of Medicine, Osaka University) for her technical advice on dHPLC. References Bolle, L.D., Micchel, D., Mertens, T., Manichanh, C., Agut, H., Clercq, E.D., Naesens, L., 2002. Role of the human herpesvirus 6 U69-encoded kinase in the phosphorylation of ganciclovir. Mol. Pharmacol. 62, 714–721. Bolle, L.D., Naesens, L., Clercq, E.D., 2005. Update on human herpesvirus 6 biology, clinical features, and therapy. Clin. Microbiol. Rev. 18, 217–245. Breen, G., Harold, D., Ralston, S., Shaw, D., Clair, D.S., 2000. Determining SNP allele frequencies in DNA pools. Biotechniques 28, 464–470. Buetow, K.H., Edmonson, M., MacDonald, R., Clifford, R., Yip, P., Kelly, J., Little, D.P., Strausberg, R., Koester, H., Koester, H., Cantor, C.R., Braun, A., 2001. Highthroughput development and characterization of a genomewide collection of gene-based single nucleotide polymorphism markers by chip-based matrixassisted laser desorption/ionization time-of-flight mass spectrometry. Proc. Natl. Acad. Sci. U.S.A. 98, 581–584. Chou, S., Van Wechel, L.C., Lichy, H.M., Marousek, G.I., 2005. Phenotyping of cytomegalovirus drug resistance mutations by using recombinant viruses incorporation a reporter gene. Antimicrob. Agents Chemother. 49, 2710–2715. Ding, C., Maier, E., Roscher, A.A., Braun, A., Cantor, C.R., 2004. Simultaneous quantitative and allele-specific expression analysis with real competitive PCR. BMC Genet. 5, 8–13. Erice, A., 1999. Resistance of human cytomegalovirus to antiviral drugs. Clin. Microbiol. Rev. 12, 286–297. Germer, S., Holland, M.J., Higuchi, R., 2000. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res. 10, 258–266. Gruber, J.D., Colligan, P.B., Wolford, J.K., 2002. Estimation of single nucleotide polymorphism allele frequency in DNA pools by using pyrosequencing. Hum. Genet. 110, 395–401. Hoogendoorn, B., Norton, N., Kirov, G., Williams, N., Hamshere, M.L., Spurlock, G., Austin, J., Stephens, M.K., Buckland, P.R., Owen, M.J., O’Donovan, M.C., 2000. Cheap, accurate and rapid allele frequency estimation of single nucleotide polymorphisms by primer extension and DHPLC in DNA pools. Hum. Genet. 107, 488–493. Isegawa, Y., Hara, J., Amo, K., Osugi, Y., Takemoto, M., Yamanishi, K., Fukunaga, R., Shibata, M., Ohshima, A., Horiguchi, Y., Sugimoto, N., 2009. Human herpesvirus 6 ganciclovir-resistant strain with amino acid substitutions associated with the death of a recipient after an allogeneic stem cell transplant recipient. J. Clin. Virol. 44, 15–19. Isegawa, Y., Miyamoto, Y., Yasuda, Y., Semi, K., Tsujimura, K., Fukunaga, R., Ohshima, A., Horiguchi, Y., Yonega, Y., Sugimoto, N., 2008. Characterization of human herpesvirus 6 U69 gene product and identification of its nuclear localization signal. J. Virol. 82, 710–718. Isegawa, Y., Takemoto, M., Yamanishi, K., Ohshima, A., Sugimoto, N., 2007. Real-time PCR determination of human herpesvirus 6 antiviral drug susceptibility. J. Virol. Methods 140, 25–31. Kondo, K., Kondo, T., Okuno, T., Takahashi, M., Yamanishi, K., 1991. Latent human herpesvirus 6 infection of human monocytes/macrophages. J. Gen. Virol. 72, 1401–1408. Leman, A.R., Polochock, S., Mole, S.E., Pearce, D.A., Rothberg, P.G., 2006. Homogeneous PCR nucleobase quenching assays to detect four mutations that cause neuronal ceroid lipofuscinosis: T75P and R151X in CLN1, and IVS5-1G>C and R208X in CLN2. J. Neurosci. Methods 157, 124–131.

Lurain, N.S., Weinberg, A., Crumpacker, C.S., Chou, S., 2001. Sequencing of cytomegalovirus UL97 for genotypic antiviral resistance testing. Antimicrob. Agents Chemother. 45, 2775–2780. Lusso, P., Markhan, P.D., Tschachler, E., Di Marco Veronese, F., Salahuddin, S.Z., Ablashi, D.V., Pahwa, S., Grohn, K., Gallo, R.C., 1988. In vitro cellular tropism of B-lymphotropic virus (human herpesvirus-6). J. Exp. Med. 167, 1659–1670. Manichanh, C., Oliver-Aubron, C., Lagarde, J.-P., Aubin, J.-T., Bossi, P., GantheretDejean, A., Huraux, J.-M., Agut, H., 2001. Selection of the same mutation in the U69 protein kinase gene of human herpesvirus-6 after prolonged exposure to ganciclovir in vitro and in vivo. J. Gen. Virol. 82, 2767–2776. Matsumoto, N., Kakihara, F., Kimura, S., Kurebayashi, Y., Hirai, M., Yohda, M., Hasegawa, S., 2007. Single nucleotide polymorphism genotyping of CYP2C19 using a new automated system. Anal. Biochem. 370, 121–123. Neve, B., Froguel, P., Corset, L., Vaillant, E., Vatin, V., Boutin, P., 2002. Rapid SNP allele frequency determination in genomic DNA pools by pyrosequencing. Biotechniques 32, 1138–1142. Noda, N., Tani, H., Morita, N., Kurata, S., Nakamura, K., Kanagawa, T., Tsuneda, S., Sekiguchi, Y., 2008. Estimation of single-nucleotide polymorphism allele frequency by alternately binding probe competitive polymerase chain reaction. Anal. Chem. Acta 608, 211–216. Safronetz, D., Petric, M., Tellier, R., Parvez, B., Tipples, G.A., 2003. Mapping ganciclovir resistance in the human herpesvirus-6 U69 protein kinase. J. Med. Virol. 71, 434–439. Salahuddin, S.Z., Ablashi, D.V., Markham, P., Josephs, S.F., Sturzegger, S., Kaplan, M., Halligan, G., Biberfeld, P., Wong-Staal, F., Kramarsky, B., Gallo, R.C., 1986. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234, 596–601. Sasaki, T., Tahira, T., Suzuki, A., Higasa, K., Kukita, Y., Baba, S., Hayashi, K., 2001. Precise estimation of allele frequencies of single-nucleotide polymorphisms by a quantitative SSCP analysis of pooled DNA. Am. J. Hum. Genet. 68, 214–218. Shifman, S., Pisanté-Shalom, A., Yakir, B., Darvasi, A., 2002. Quantitative technologies for allele frequency estimation of SNPs in DNA pools. Mol. Cell. Probes 16, 429–434. Sjahril, R., Isegawa, Y., Tanaka, T., Nakano, K., Yoshikawa, T., Asano, Y., Ohshima, A., Yamanishi, K., Sugimoto, N., 2009. Relationship between U83 gene variation in human herpesvirus 6 and secretion of the U83 gene product. Arch. Virol. 154, 273–283. Smith, I.L., Cherrington, J.M., Jiles, R.E., Fuller, M.D., Freeman, W.R., Spector, S.A., 1997. High-level resistance of cytomegalovirus to ganciclovir is associated with alterations in both the UL97 and DNA polymerase genes. J. Infect. Dis. 176, 69–77. Takahashi, K., Sonoda, S., Higashi, K., Kondo, T., Takahashi, H., Takahashi, M., Yamanishi, K., 1989. Predominant CD4 T-lymphocyte tropism of human herpesvirus 6-related virus. J. Virol. 63, 3161–3163. Tani, H., Kanagawa, T., Morita, N., Kurata, S., Nakamura, K., Tsuneda, S., Noda, N., 2007. Calibration-curve-free quantitative PCR: a quantitative method for specific nucleic acid sequences without using calibration curves. Anal. Biochem. 369, 105–111. Wolford, J.K., Blunt, D., Ballecer, C., Prochazka, M., 2000. High-throughput SNP detection by using DNA pooling and denaturing high performance liquid chromatography (DHPLC). Hum. Genet. 107, 483–487. Xiao, W., Oefner, P.J., 2001. Denaturing high-performance liquid chromatography: a review. Hum. Mutat. 17, 439–474. Xu, K., Lipsky, R.H., Mangal, W., Ferro, E., Goldman, D., 2002. Single-nucleotide polymorphism allele frequencies determined by quantitative kinetic assay of polled DNA. Clin. Chem. 48, 1605–1608. Yamanishi, K., Okuno, T., Shiraki, K., Takahashi, M., Kondo, T., Asano, Y., Kurata, T., 1988. Identification of human herpesvirus-6 as a causal agent for exanthema subitum. Lancet 1, 1065–1067. Yu, A., Geng, H., Zhou, X., 2006. Quantify single nucleotide polymorphism (SNP) ratio in pooled DNA based on normalized fluorescence real-time PCR. BMC Genom. 7, 143–152. Zhou, G.-H., Kamahori, M., Okano, K., Chuan, G., Harada, K., Kambara, H., 2001. Quantitative detection of single nucleotide polymorphisms for a pooled sample by a bioluminometric assay coupled with modified primer extension reactions (BAMPER). Nucleic Acids Res. 29, e93–e103.