Effect of antibiotics on extracellular protein level in Pseudomonas aeruginosa

Effect of antibiotics on extracellular protein level in Pseudomonas aeruginosa

Plasmid 84–85 (2016) 44–50 Contents lists available at ScienceDirect Plasmid journal homepage: www.elsevier.com/locate/yplas Effect of antibiotics ...

388KB Sizes 10 Downloads 37 Views

Plasmid 84–85 (2016) 44–50

Contents lists available at ScienceDirect

Plasmid journal homepage: www.elsevier.com/locate/yplas

Effect of antibiotics on extracellular protein level in Pseudomonas aeruginosa Eigo Takahashi a,b, Jae Man Lee b, Hiroaki Mon b, Yuuka Chieda a, Chisa Yasunaga-Aoki a, Takahiro Kusakabe b, Kazuhiro Iiyama a,⁎ a b

Laboratory of Insect Pathology and Microbial Control, Institute of Biological Control, Faculty of Agriculture, Graduate School, Kyushu University, Fukuoka, Japan Laboratory of Insect Genome Science, Faculty of Agriculture, Graduate School, Kyushu University, Fukuoka, Japan

a r t i c l e

i n f o

Article history: Received 10 December 2015 Received in revised form 11 March 2016 Accepted 16 March 2016 Available online 17 March 2016 Keywords: Pseudomonas aeruginosa Extracellular protein Tetracycline Kanamycin Alkaline protease

a b s t r a c t Pseudomonas aeruginosa PAO1 organisms harbouring different plasmids were cultured in broths containing appropriate antibiotic(s). Extracellular proteins were more abundant in the presence of tetracycline or kanamycin than in the presence of other antibiotics. Zymography revealed that alkaline protease (AprA) production was interfered by these antibiotics. Extracellular proteins were not observed at the same level when AprA-deficient EG03 strains were cultured in the presence of different antibiotics. The extracellular protein levels were dependent on the antibiotics and plasmid derivative groups. Levels of extracellular protein were not significantly different between PAO1 (pBBR1MCS-5) and EG03 (pAprcomp-MCS5), and profiles of the extracellular proteome were comparable. In contrast, the level of EG03 (pBBR1MCS-MCS5) extracellular protein was higher than those observed in the other two strains. These results suggested that although AprA partially contributes to the alteration of extracellular protein level, the effect is limited. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Pseudomonas aeruginosa is ubiquitous and found in diverse types of environment including soil, freshwater, and marine environments. It is also a known opportunistic pathogen of vertebrates, invertebrates, and plants (Jander et al., 2000; Jarrell and Kropinski, 1982). P. aeruginosa secretes various proteins as virulence factors such as exotoxin A (ToxA), ExoU, ExoS, ExoY, ExoT, and proteases (Gellatly and Hancock, 2013). ToxA is an ADP-ribosyltransferase that inactivates the elongation factor 2 (Iglewski et al., 1977). ExoS and ExoT are bifunctional cytotoxins (Goehring et al., 1999; Yahr et al., 1996). ExoY and ExoU are an adenylate cyclase and a potent phospholipase A 2, respectively (Yahr et al., 1998; Phillips et al., 2003; Sato et al., 2003). Furthermore, P. aeruginosa produces various proteases such as elastase A, elastase B, alkaline protease, protease IV, and P. aeruginosa small protease (Hoge et al., 2010). To investigate the contribution of these extracellular proteins in P. aeruginosa pathogenesis, the pathogenicity of gene-disrupted and complemented strains is often compared with that of the parent strain. To prevent plasmid curing, an appropriate antibiotic is often added when the plasmid is used for gene complementation. Therefore,

⁎ Corresponding author at: Institute of Biological Control, Faculty of Agriculture, Graduate School, Kyushu University, Hakozaki 6-10-1, Higashi-ku, Fukuoka, Japan. E-mail address: [email protected] (K. Iiyama).

http://dx.doi.org/10.1016/j.plasmid.2016.03.001 0147-619X/© 2016 Elsevier Inc. All rights reserved.

misinterpretation of results may occur if the antibiotic causes an alteration in the extracellular protein level. During the study of P. aeruginosa extracellular protein, certain antibiotics were found to cause a dramatic change in the extracellular protein levels. A previous study showed that tetracycline inhibited protease production, but not protease activity, in P. aeruginosa (Shibl and Al-Sowaygh, 1980). Furthermore, erythromycin suppressed leucocidin, elastase, and protease production in P. aeruginosa (Kita et al., 1991), whereas aminoglycoside antibiotics, including gentamicin and streptomycin, decreased the levels of protease and phospholipase C (Hostacká and Majtán, 1993). Lincomycin and clindamycin inhibited lipase production in Propionibacterium spp., whereas tetracycline only inhibited its production in Propionibacterium granulosum (Unkles and Gemmell, 1982). In eukaryotic cells, tetracycline is known to inhibit matrix metalloproteases (Greenwald et al., 1992; Nip et al., 1993; Duivenvoorden et al., 1997; Maitra et al., 2003; Acharya et al., 2004). Therefore, because P. aeruginosa alkaline protease (AprA), encoded by aprA, is a metalloprotease (Morihara, 1964; Okuda et al., 1990; Duong et al., 1992), antibiotics are thought to inhibit its production. We speculated that secreted AprA may degrade other extracellular proteins in the absence of an antibiotic. Conversely, if AprA production is suppressed by certain antibiotics, degradation of extracellular proteins is either reduced or does not occur. To investigate this hypothesis, extracellular proteins of P. aeruginosa cultured in the presence of several antibiotics were assessed in this study.

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

45

Table 1 Bacteria, plasmids and oligonucleotides used in this study. Description or sequencea

Reference or source Laboratory stock

S17-1

F−, φ80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, − + hsdR17(r− K , mK ), phoA, supE44, λ , thi-1, gyrA96, relA1 thi, pro, hsdR, recA, chromosomal RP4, tra+, TpR, Sm/SpR

Pseudomonas aeruginosa PAO1 PrEG03 EG03

Prototype strain aprA deletion mutant of PAO1, ΔaprA::(FRT-ΩaacC4-FRT), GmR Markerless aprA deletion mutant of PAO1, ΔaprA::FRT

Professor J. Kato This study This study

Plasmid pBBR1MCS-2 pBBR1MCS-3 pBBR1MCS-4 pBBR1MCS-5 pJB3 pJB3Km1 pJB3Tc20 pHERD20T pHERD26T pHERD30T pK18mobsacB pAprC pKOC pAprcomp-MCS5 pHP45Ω pHP45ΩaacC4 pPS854 pPS854aacC4 pGEM T-Easy pGEMFRTaacC4 pFLP2 pFLP2ΩSm/Sp

Broad host range plasmid, KmR Broad host range plasmid, TcR Broad host range plasmid, Amp/CbR Broad host range plasmid, GmR Broad-host-range cloning vector, Amp/CbR Broad-host-range cloning vector, KmR, Amp/CbR Broad-host-range cloning vector, TcR, Amp/CbR Escherichia-Pseudomonas shuttle vector, Amp/CbR Escherichia-Pseudomonas shuttle vector, TcR Escherichia-Pseudomonas shuttle vector, GmR Allelic-exchange suicide vector, sacB, oriT (RP4), lacZ, KmR 9.1-kb aprX-aprD-aprE-aprF-aprA fragment in pK18mobsacB, KmR 10.2-kb aprX-aprD-aprE-aprF-ΔaprA::(FRT-aacC4-FRT) fragment in pK18mobsacB, KmR 9.1-kb aprX-aprD-aprE-aprF-aprA fragment in pBBR1MCS-5, GmR Source of Ω, AmpR, Sm/SpR Source of ΩaacC4, AmpR, GmR Source of FRT sequence, AmpR Source of FRT-aacC4-FRT cassette, ΩaacC4 fragment in pPS854, AmpR, GmR TA cloning vector, AmpR FRT-aacC4-FRT cassette in pGEM T-Easy, AmpR, GmR Broad-host-range, site-specific excision vector, ori1600, oriT, sacB, AmpR Ω fragment in pFLP2, AmpR, Sm/SpR

Kovach et al. (1995) Kovach et al. (1995) Kovach et al. (1995) Kovach et al. (1995) Blatny et al. (1997) Blatny et al. (1997) Blatny et al. (1997) Qiu et al. (2008) Qiu et al. (2008) Qiu et al. (2008) Schäfer et al. (1994) This study This study This study Prentki et al. (1991) Blondelet-Rouault et al. (1997) Hoang et al. (1998) This study Promega This study Hoang et al. (1998) This study

Oligonucleotide K18MSLEf K18MSLEr PA1244(53R)-IF aprF1000f aprI(86R)-IF omega-inner FRT-EcoRV

GAATTCCATGTCATAGCTGTTTCCTGTG GAATTCCACTGGCCGTCGTTTTACA TATGACATGGAATTCGTCTTTTCCTTTTCATCCTTCGTCA ATGGAGAAGAGCCATTACGACCT CGGCCAGTGGAATTCATCAGACTGCTGGCCATACTGATAC TATGCTTGTAAACCGTTTTGTGAA GATATCAAGCTTGCATGCCTGCAGGTCGACTCT

This study This study This study This study This study This study This study

Bacterium, plasmid or oligonucleotide Escherichia coli DH5α

Simon et al. (1983)

a Abbreviations for phenotype: AmpR, ampicillin resistance; CbR carbenicillin resistance; GmR gentamicin resistance; KmR kanamycin resistance; SpR, spectinomycin resistance; SmR, streptomycin resistance; TcR, tetracycline resistance; and TpR, trimethoprim resistance. Underlines in oligonucleotides indicated artificial sequences of restriction enzyme recognition site or overlapping vector sequences for In-fusion.

2. Materials and methods 2.1. Bacteria, plasmids, and culture condition Bacterial strains and plasmids used in this study are listed in Table 1. P. aeruginosa PAO1 was a gift from Professor J. Kato (Hiroshima University, Japan). The strain was originally obtained from the laboratory of Ananda M. Chakrabarty (University of Illinois at Chicago, USA). Cultures of Escherichia coli and P. aeruginosa were routinely grown in Luria– Bertani (LB) medium (Lennox; Sigma-Aldrich, Japan) at 37 °C and 30 °C, respectively. For protein analysis, P. aeruginosa was inoculated into 3 ml LB broth in a glass test tube (inner diameter 13 mm × length 125 mm). The tube was aerobically incubated (FMS-100; Tokyo Rikakikai Co., Ltd., Japan) with a reciprocal shaker (stroke width of 25 mm; Multi Shaker MMS-310; Tokyo Rikakikai Co., Ltd., Japan) at 200 strokes/min for 48 h. Antibiotics were used at the following concentrations (for E. coli and P. aeruginosa, respectively): 30 and 50 μg/ml for gentamicin, 12 and 48 μg/ml for tetracycline, and 30 and 200 μg/ml for kanamycin. For β-lactam antibiotics, ampicillin (50 μg/ml for E. coli) and carbenicillin (200 μg/ml for P. aeruginosa) were used. Triclosan was added to the medium at 5 μg/ml for P. aeruginosa selection. Streptomycin was used for E. coli S17-1 culture at 5 μg/ml. Plasmids for aprA disruption and complementation were constructed as follows: ΩaacC4 fragment, amplified by PCR using a primer

(omega-inner) from pHP45ΩaacC4, was ligated into EcoRV-digested pPS854, and designated as pPS854aacC4. To introduce EcoRV sites into both ends of the FRT-aacC4-FRT cassette in pPS854aacC4, PCR was carried out using the FRT-EcoRV primer and the KOD-Plus-Neo polymerase (TOYOBO Co., Japan). After adding adenine overhangs to the amplicon using a HybriPol DNA polymerase (Nippon Genetics Co. Ltd., Japan), the fragment was cloned into pGEM T-Easy (Promega KK, Japan) to construct the pGEMFRTaacC4. pK18mobsacB was linearised by PCR with K18MSLEf/K18MSLEr primers using the KOD-Plus-Neo polymerase. The 9.1-kb aprX–aprD– aprE–aprF–aprA fragment was amplified from P. aeruginosa PAO1 genomic DNA using PA1244(53R)-IF/aprI(86R)-IF primers. Purified PCR fragment was cloned into the linearised pK18mobsacB using the In-fusion PCR cloning kit (Takara Bio Inc., Japan) to create pAprC. FRT-ΩaacC4FRT cassette was prepared from pGEMFRTaacC4 by EcoRV digestion. The cassette was ligated into EcoRV-digested pAprC to create the pKOC (aprA-disruption plasmid). The 9.1-kb aprX–aprD–aprE–aprF–aprA PCR fragment was cloned into linearised pBBR1MCS-5 using a similar procedure. The plasmid was designated as pAprcomp-MCS5 (aprA-complementation plasmid). pHP45Ω was digested with BamHI, and Ω fragment carrying the Sm/ Sp resistance gene was ligated into the same site on pFLP2 to create the pFLP2Sm/Sp. Flp recombinase expressed from pFLP2Sm/Sp excised FRTΩaacC4-FRT cassette by site-specific recombination (Hoang et al., 1998).

46

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

2.2. Construction of the alkaline protease-deficient mutant pKOC was transferred to PAO1 from E. coli S17-1 by mating. The bacterial suspension was spread onto LB supplemented with triclosan, gentamicin, and 10% sucrose to counter-select aprA mutant strain (PrEG03, aprA::(FRT-ΩaacC4-FRT)). pFLP2Sm/Sp was transferred from S17-1 to PrEG03. Several colonies grown on LB medium supplemented with streptomycin and triclosan were subcultured in LB broth in the absence of antibiotics to cure pFLP2Sm/Sp. Clones that lost the plasmid were selected by plating on LB containing 10% sucrose. Loss of gentamicin resistance was verified. In addition, deletion of aprA internal region was evaluated by PCR. This markerless aprA-deletion mutant strain was designated as EG03. 2.3. Protein analysis Bacterial strains were cultured in LB broth supplemented with the corresponding antibiotic for 48 h. The cultures were centrifuged (20,600 × g, 4 °C, 15 min) to separate the supernatant (extracellular fraction) from bacterial cells. The cells were resuspended in 10 mM Tris–HCl, 1 mM EDTA (pH 8.0), and lysed with 0.1% sodium dodecyl sulphate (SDS). The resulting cell lysate was subjected to subsequent analysis as the cellular fraction. Total protein concentration was determined by the bicinchoninic acid method (BCA) (Pierce BCA protein assay kit; Life Technologies, Japan) after trichloroacetic acid (TCA) precipitation at a final concentration of 10%. Bovine serum albumin was used as standard for protein quantitation. Proteins (7.5-μl culture equivalent) were analysed using 10% SDS-polyacrylamide gel electrophoresis (PAGE) and resolved proteins were stained with Coomassie Brilliant Blue (CBB) R-250 (Nacalai Tesque, Japan). Where indicated, bands were analysed using the Image J software (the National Institutes of Health, USA). 2.4. Analysis of protease Gelatin-zymography was performed to detect the presence of alkaline protease using a previously described method, but with a different substrate (Kaibara et al., 2012). Briefly, proteins in the culture filtrates (7.5-μl culture equivalent) were resolved in a 10% SDS-PAGE gel containing 0.1% gelatin. The gel was incubated in the renaturation buffer at room temperature for 30 min twice to remove SDS, and subsequently incubated in the development buffer at 37 °C overnight. The gel was stained with CBB R-250 to detect digestion of the substrate. Total activities of non-AprA protease(s) were determined in EG03. EG03 strains harbouring different plasmids were cultured, and supernatants were prepared as described above. Total activities of protease(s) were measured according to a method described by Benitez et al. (2001) with modifications. Briefly, reaction buffer (100 mM Tris–Cl, 5 mM CaCl2, pH 8.0) containing 50 μl of azocasein (5 mg/ml) was incubated with 50 μl of culture filtrate at 37 °C for 1 h. The reaction was stopped by the addition of 200 μl TCA and samples were incubated at 4 °C for 15 min. After centrifugation (20,600 × g, 4 °C, 5 min) the supernatant (150 μl) was transferred to 175 μl of 525 mM NaOH, and the absorbance at 440 nm was measured. As negative control, fraction of each culture filtrate was inactivated by heating at 95 °C for 10 min. One azocasein unit was defined as the amount of enzyme required to produce a 0.01 unit increase in absorbance at 440 nm in 1 h, using the negative control as baseline. 3. Results and discussion 3.1. Analysis of cellular and extracellular proteins produced by P. aeruginosa PAO1 harbouring different plasmids Concentrations of cellular and extracellular proteins of P. aeruginosa PAO1 harbouring different plasmids were determined. Concentrations

of cellular proteins were not affected by the presence of the plasmid; however, extracellular protein concentrations varied among the different strains (Fig. 1A). Concentrations of cellular and extracellular proteins in plasmid-free P. aeruginosa were 85.2 and 40.1 μg/ml, respectively. In P. aeruginosa harbouring pBBR1MCS-2, pBBR1MCS-3, pJB3Km1, pJB3Tc20, or pHERD26T, the concentrations of the extracellular protein were significantly higher than those in plasmid-free PAO1 (Fig. 1A). The higher overall concentration was not caused by an increase in specific proteins, since virtually all proteins were elevated (Fig. 1B). This difference in extracellular protein levels was also observed in derivatives that shared the same plasmid backbone. For example, the effects of pBBR1MCS-2/3/4/5, which belong to the pBBR1-derivative group, on protein levels were varied (Fig. 1A, B). Only the antibiotic resistance gene differed among plasmids within the same derivativegroup; thus, antibiotic supplemented into the culture broth and/or the expressed antibiotic resistance protein were thought to cause the observed protein level variation. When PAO1 harbouring pJB3Km1 or pJB3Tc20 was cultured in the presence of carbenicillin only, the protein level was unchanged (data not shown). Therefore, tetracycline and kanamycin were thought to regulate extracellular protein level. 3.2. Tetracycline and kanamycin interfered with P. aeruginosa alkaline protease production Tetracycline inhibits protein synthesis by preventing the attachment of aminoacyl-tRNA to the ribosomal acceptor (A) site (Chopra and Roberts, 2001). In this study, tetracycline concentration was adjusted to 48 μg/ml. This concentration was considered a sub-minimal inhibitory concentration (sub-MIC) because it supported the growth of P. aeruginosa harbouring the tetracycline resistance gene (data not shown). If tetracycline non-specifically inhibits the synthesis of all proteins at sub-MIC, then reductions in both extracellular and intracellular protein concentrations are expected. Furthermore, P. aeruginosa would fail to grow in the absence of essential gene products. Unexpectedly, extracellular protein concentrations increased in the presence of tetracycline (Fig. 1A). Tetracycline is known to inhibit protease production in P. aeruginosa at sub-MIC (Shibl and Al-Sowaygh, 1980). In addition, tetracycline has been shown to inhibit matrix metalloproteases in eukaryotic cells (Greenwald et al., 1992; Nip et al., 1993; Duivenvoorden et al., 1997; Maitra et al., 2003; Acharya et al., 2004). Therefore, the activity of P. aeruginosa alkaline protease (AprA; a metalloprotease) in strains harbouring different plasmids was investigated using gelatinzymography (Fig. 2). AprA activity was not detected in P. aeruginosa grown in the presence of tetracycline or kanamycin. By contrast, other antibiotics did not appear to inhibit AprA activity. Importantly, the absence of AprA activity (Fig. 2) coincided with the presence of abundant extracellular proteins (Fig. 1A, B). This association led us to hypothesize that tetracycline and kanamycin inhibit the production of AprA. Because AprA is known to degrade other extracellular proteins, the effect of AprA inhibition on the overall extracellular protein level was investigated. 3.3. Analysis of extracellular proteins produced by P. aeruginosa EG03 harbouring different plasmids To assess whether the inhibition of AprA production affects the extracellular protein level, an AprA-deficient, markerless mutant, EG03, was constructed from PAO1 (Fig. 3A). The deletion of aprA internal region was confirmed by PCR (Fig. 3B). Gelatin-zymography revealed that EG03 (pBBR1MCS-5) completely lost AprA expression, and a complemented strain, EG03, harbouring pAprcomp-MCS5, showed AprA overexpression (Fig. 3C). Subsequently, we carried out extracellular protein analyses of EG03. Concentrations of extracellular protein varied among different antibiotics used (Fig. 4A). With the exception of the strain harbouring

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

47

Fig. 1. Concentrations and SDS-PAGE analyses of extracellular and cellular proteins of Pseudomonas aeruginosa PAO1 harbouring different plasmids. P. aeruginosa PAO1 harbouring different plasmids were cultured in LB broth supplemented with appropriate antibiotics for 48 h. Derivative groups for each plasmid are shown. Antibiotics used are indicated in parentheses. Abbreviations of antibiotics are shown in the footnote of Table 1. Protein concentrations of the extracellular (A, upper panel) and cellular (A, lower panel) fractions were determined using the BCA method. Experiments were repeated three times. Data are shown as the average ± standard error. *, P b 0.05 and **, P b 0.01 compared to the plasmid-free PAO1 (closed column) as determined by Student's t-test. The extracellular (B, upper panel) and cellular (B, lower panel) fractions were analysed by SDS-PAGE under reduced conditions. Samples (7.5-μl culture equivalent) were resolved in 10% SDS-PAGE gels and proteins were stained with CBB R-250.

Fig. 2. Gelatin-zymography of culture filtrates of P. aeruginosa PAO1 harbouring different plasmids. P. aeruginosa strains were cultured as described in Fig. 1. To detect the protease activity, proteins in the culture filtrates (7.5-μl culture equivalent) were resolved in a 10% SDS-PAGE gel containing 0.1% gelatin. The gel was incubated in the renaturation buffer at room temperature for 30 min twice to remove SDS, and subsequently incubated in the development buffer at 37 °C overnight. The gel was stained with CBB R-250 to detect digestion of the substrate.

pHERD30T, EG03 strains supplemented with antibiotics showed significantly higher extracellular protein levels than did plasmid-free EG03 (P b 0.05; Fig. 4A). The concentration of extracellular proteins in EG03 (pHERD30T) was approximately twice that observed in plasmid-free EG03, although this difference was not statistically significant. SDSPAGE analysis revealed that differences in the total extracellular protein level were not due to a specific protein (Fig. 4B). Total protease activities were measured from the same culture filtrates (Fig. 4C). Remarkably, all antibiotics evaluated in this study caused near complete inhibition of protease activities. Since EG03 was an AprA-deficient mutant, protease activities were thought to be contributed by protease(s) other than AprA. However, only AprA was detected in the zymography analysis (Fig. 2); other proteases were not detected under the experimental conditions due to an unknown reason. Because activities of protease (other than AprA) were inhibited by all antibiotics evaluated and because EG03 was inherently deficient in AprA, the effects of proteases on extracellular proteins were considered negligible. Thus, the results presented in Fig. 4A and B show the effect of antibiotics on extracellular proteins excluding proteases. Since the use of antibiotics alone cannot fully explain the observed alteration in extracellular protein levels (Fig. 4A, B), it was postulated that the plasmid backbones may contribute to this effect. Therefore, we re-analysed the results from the plasmid derivative groups (alphabets in Fig. 4A) and performed a statistical analysis. In the pBBR1derivative group, tetracycline induced greater increase in extracellular protein levels than kanamycin, carbenicillin, and gentamicin did. In the pJB3-derivative group, extracellular protein levels were higher in

48

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

Fig. 3. Construction of the aprA-deletion mutant, EG03. Schematic diagrams of aprA region in the P. aeruginosa genome and plasmids are shown (A). Arrows and triangles indicate primers and EcoRV restriction sites, respectively. Open circles denote FRT sequences (not in scale). aprA deletion in EG03 was confirmed by PCR using the aprF1000f/ aprI(86r)-IF primer pair (B). Zymography was performed to detect the alkaline protease production of PAO1 (pBBR1MCS-5, empty vector), EG03 (pBBR1MCS-5), and EG03 (pAprcomp-MCS5).

strains supplemented with carbenicillin/kanamycin and carbenicillin/ tetracycline when compared to those supplemented with carbenicillin alone. Meanwhile, in pHERD-derivatives, carbenicillin and tetracycline induced higher levels of extracellular protein than gentamicin did. In general, tetracycline was more likely to increase the level of extracellular protein. Together these results suggested that tetracycline and kanamycin inhibited the production of all proteases and other antibiotics inhibited non-AprA protease(s). Tetracycline caused a significant increase in extracellular protein level, whereas gentamicin suppressed extracellular protein production. However, the effects of kanamycin and carbenicillin on extracellular protein levels were dependent on the plasmidbackbone. 3.4. Effect of AprA on level and profile of extracellular protein In order to assess AprA role in regulating the level of extracellular protein, PAO1 (pBBR1MCS-5), EG03 (pBBR1MCS-5), and EG03 (pAprcompMCS5) were cultured in the presence of gentamicin. Since other proteases (non-AprA proteases) were inhibited under conditions described in Fig. 4C, these strains were appropriate for investigating the AprA function. No significant difference in extracellular protein concentration was observed between PAO1 (pBBR1MCS-5) and PAO1 (pAprcomp-MCS5).

Fig. 4. Analyses of extracellular proteins of the aprA-deletion mutant, EG03 P. aeruginosa EG03 strains were cultured as described in Fig. 1. Concentrations of extracellular protein were determined using the BCA method (A). Experiments were repeated three times and data are shown as the average ± standard error. *, P b 0.05 and **, P b 0.01 compared to the EG03 (pBBR1MCS-5, empty vector) as determined by Student's t-test. Within the same derivative group (samples with the same alphabetical letter), no significant differences in extracellular protein concentrations were observed as determined using the Tukey's honest significant difference test at P b 0.05. Extracellular proteins (7.5-μl culture equivalent) were resolved using SDS-PAGE under reduced conditions and stained with CBB R-250 (B). Total activities of protease(s) were measured. Experiments were repeated three times and data are shown as the average ± standard error. *, P b 0.05 and **, P b 0.01 compared to the plasmid-free EG03 (closed column) as determined by Student's t-test.

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

49

substrates should stay undegraded in the presence of tetracycline and kanamycin, because these antibiotics inhibit the AprA production (Fig. 2). Since it was reported that AprA has substrate specificity (Morihara et al., 1973; Louis et al., 1998), the detected proteins in the culture filtrate of EG03 (pAprcomp-MCS5) probably do not have a cleavage site. First, we hypothesized that AprA was a principal factor causing the variation of extracellular protein level. However, since the extracellular protein levels varied in the EG03 strains, it was obvious that the effect of AprA on extracellular protein levels was limited. Future studies will be aimed at investigating how antibiotics inhibit the production of various extracellular proteins at different stages, including protein synthesis and secretion. In order to exclude the action of proteases, comprehensive analyses of extracellular proteins produced by a mutant strain deficient in all proteases in the presence of various antibiotics will be needed. 4. Conclusion P. aeruginosa is known to secrete several important virulence factors. Gene complementation strategies using plasmids in mutant strains are often used for the study of P. aeruginosa biology and pathogenesis. Results from the present study strongly suggest the importance of plasmid selection in gene complementation experiments. Acknowledgements The cost of publication was supported in part by a Research Grant for Young Investigators from the Faculty of Agriculture, Kyushu University. References

Fig. 5. Analyses of extracellular proteins of PAO1 and EG03 harbouring pBBR1MCS-5 derivatives P. aeruginosa strains were cultured in the presence of gentamicin to evaluate the effect of AprA on extracellular proteins. Protein concentrations were determined using the BCA methods (A). Experiments were repeated three times and data are shown as the average ± standard error. *, P b 0.05; **, P b 0.01; ns, not significant as determined by Student's t-test. Extracellular proteins (7.5-μl culture equivalent) were resolved using SDS-PAGE under reduced conditions and stained with CBB R-250 (B). Relative intensities of bands in panel B were quantified using the Image J software (C). Triangles indicate molecular weight markers as shown in panel B.

However, extracellular protein concentration was significantly higher in EG03 (pBBR1MCS-5) than in the other two strains. As observed using an SDS-PAGE analysis, PAO1 (pBBR1MCS-5) and EG03 (pAprcomp-MCS5) displayed similar, but not identical extracellular proteome profiles (Fig. 5B, C). The slight differences observed may be due to the change in protease activity (Fig. 3C). Profile of the EG03 (pBBR1MCS-5) extracellular proteome was visibly different from those of the other two strains, especially in molecular weight N 45 kDa. These results suggested the partial involvement of AprA in decreasing the levels of extracellular protein and altering the extracellular proteome profile. Therefore, AprA

Acharya, M.R., Venitz, J., Figg, W.D., Sparreboom, A., 2004. Chemically modified tetracyclines as inhibitors of matrix metalloproteinases. Drug Resist. Updat. 7, 195–208. http://dx.doi.org/10.1021/jp3079748. Benitez, J.A., Silva, A.J., Finkelstein, R.A., 2001. Environmental signals controlling production of hemagglutinin/protease in Vibrio cholerae. Infect. Immun. 69, 6549–6553. http://dx.doi.org/10.1128/IAI.69.10.6549-6553.2001. Blatny, J.M., Brautaset, T., Winther-Larsen, H.C., Haugan, K., Valla, S., 1997. Construction and use of a versatile set of broad-host-range cloning and expression vectors based on the RK2 replicon. Appl. Environ. Microbiol. 63, 370–379. Blondelet-Rouault, M.H., Weiser, J., Lebrihi, A., Branny, P., Pernodet, J.L., 1997. Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces. Gene 190, 315–317. http://dx.doi.org/10.1016/S0378-1119(97)00014–0. Chopra, I., Roberts, M., 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65, 232–260. http://dx.doi.org/10.1128/MMBR.65.2.232-260.2001. Duivenvoorden, W.C., Hirte, H.W., Singh, G., 1997. Use of tetracycline as an inhibitor of matrix metalloproteinase activity secreted by human bone-metastasizing cancer cells. Invasion Metastasis 17, 312–322. Duong, F., Lazdunski, A., Cami, B., Murgier, M., 1992. Sequence of a cluster of genes controlling synthesis and secretion of alkaline protease in Pseudomonas aeruginosa: relationships to other secretory pathways. Gene 121, 47–54. http://dx.doi.org/10.1016/ 0378-1119(92)90160-Q. Gellatly, S.L., Hancock, R.E., 2013. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog. Dis. 67, 159–173. http://dx.doi.org/10.1111/2049632X.12033. Goehring, U.M., Schmidt, G., Pederson, K.J., Aktories, K., Barbieri, J.T., 1999. The N-terminal domain of Pseudomonas aeruginosa exoenzyme S is a GTPase-activating protein for Rho GTPases. J. Biol. Chem. 274, 36369–36372. http://dx.doi.org/10.1074/jbc.274.51. 36369. Greenwald, R.A., Moak, S.A., Ramamurthy, N.S., Golub, L.M., 1992. Tetracyclines suppress matrix metalloproteinase activity in adjuvant arthritis and in combination with flurbiprofen, ameliorate bone damage. J. Rheumatol. 19, 927–938. Hoang, T.T., Karkhoff-Schweizer, R.R., Kutchma, A.J., Schweizer, H.P., 1998. A broad-hostrange Flp-FRT recombination system for site-specific excision of chromosomallylocated DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77–86. http://dx.doi.org/10.1016/S0378-1119(98)00130–9. Hoge, R., Pelzer, A., Rosenau, F., Wilhelm, S., 2010. Weapons of a pathogen: proteases and their role in virulence of Pseudomonas aeruginosa. In: Méndez-Vilas, A. (Ed.), Current research technology and Education Topics in Applied Microbiology and Microbial Biotechnology Vol. 1.Formatex Research Centre, Badajoz, pp. 383–395 Hostacká, A., Majtán, V., 1993. Alterations in Pseudomonas aeruginosa exoproducts by subMICs of some antibiotics. Folia Microbiol. (Praha) 38, 349–352. http://dx.doi.org/10. 1007/BF02898607.

50

E. Takahashi et al. / Plasmid 84–85 (2016) 44–50

Iglewski, B.H., Liu, P.V., Kabat, D., 1977. Mechanism of action of Pseudomonas aeruginosa exotoxin A: adenosine diphosphate-ribosylation of mammalian elongation factor 2 in vitro and in vivo. Infect. Immun. 15, 138–144. Jander, G.L., Rahme, G., Ausubel, F.M., 2000. Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects. J. Bacteriol. 182, 3843–3845. http://dx.doi.org/10.1128/JB.182.13.3843-3845.2000. Jarrell, K.F., Kropinski, A.M., 1982. The virulence of protease and cell surface mutants of Pseudomonas aeruginosa for the larvae of Galleria mellonella. J. Invertebr. Pathol. 39, 395–400. http://dx.doi.org/10.1016/0022-2011(82)90065–9. Kaibara F, Iiyama K, Chieda Y, Lee JM, Kusakabe T, Yasunaga-Aoki C and Shimizu S (2012) Construction of serralysin-like metalloprotease-deficient mutants of Serratia liquefaciens and their virulence in the silkworm, Bombyx mori. J. Insect Biotechnol. Sericol. 81: 55–61. http://dx.doi.org/10.11416/jibs.81.2_3_055 Kita, E., Sawaki, M., Oku, D., Hamuro, A., Mikasa, K., Konishi, M., Emoto, M., Takeuchi, S., Narita, N., Kashiba, S., 1991. Suppression of virulence factors of Pseudomonas aeruginosa by erythromycin. J. Antimicrob. Chemother. 27, 273–284. http://dx.doi. org/10.1093/jac/27.3.273. Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop 2nd, R.M., Peterson, K.M., 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175–176. http://dx.doi. org/10.1016/0378-1119(95)00584–1. Louis, D., Bernillon, J., Wallach, J.M., 1998. Specificity of Pseudomonas aeruginosa serralysin revisited, using biologically active peptides as substrates. Biochim. Biophys. Acta 1387, 378–386. http://dx.doi.org/10.1016/S0167-4838(98)00144–7. Maitra, S.R., Bhaduri, S., Valane, P.D., Tervahartiala, T., Sorsa, T., Ramamurthy, N., 2003. Inhibition of matrix metalloproteinases by chemically modified tetracyclines in sepsis. Shock 20, 280–285. Morihara, K., 1964. Production of elastase and proteinase by Pseudomonas aeruginosa. J. Bacteriol. 88, 745–757. Morihara, K., Tsuzuki, H., Oka, T., 1973. On the specificity of Pseudomonas aeruginosa alkaline proteinase with synthetic peptides. Biochim. Biophys. Acta 309, 414–429. http://dx.doi.org/10.1016/0005-2744(73)90040–5. Nip, L.H., Uitto, V.J., Golub, L.M., 1993. Inhibition of epithelial cell matrix metalloproteinases by tetracyclines. J. Periodontal Res. 28, 379–385. http://dx.doi.org/10.1111/j. 1600-0765.1993.tb01082.x. Okuda, K., Morihara, K., Atsumi, Y., Takeuchi, H., Kawamoto, S., Kawasaki, H., Suzuki, K., Fukushima, J., 1990. Complete nucleotide sequence of the structural gene for alkaline proteinase from Pseudomonas aeruginosa IFO 3455. Infect. Immun. 58, 4083–4088.

Phillips, R.M., Six, D.A., Dennis, E.A., Ghosh, P., 2003. In vivo phospholipase activity of the Pseudomonas aeruginosa cytotoxin ExoU and protection of mammalian cells with phospholipase A2 inhibitors. J. Biol. Chem. 278, 41326–41332. http://dx.doi.org/10. 1074/jbc.M302472200. Prentki, P., Binda, A., Epstein, A., 1991. Plasmid vectors for selecting IS1-promoted deletions in cloned DNA: sequence analysis of the omega interposon. Gene 103, 17–23. http://dx.doi.org/10.1016/0378-1119(91)90385-O. Qiu, D., Damron, F.H., Mima, T., Schweizer, H.P., Yu, H.D., 2008. PBAD-based shuttle vectors for functional analysis of toxic and highly regulated genes in Pseudomonas and Burkholderia spp. and other bacteria. Appl. Environ. Microbiol. 74, 7422–7426. http://dx.doi.org/10.1128/AEM.01369-08. Sato, H., Frank, D.W., Hillard, C.J., Feix, J.B., Pankhaniya, R.R., Moriyama, K., FinckBarbançon, V., Buchaklian, A., Lei, M., Long, R.M., Wiener-Kronish, J., Sawa, T., 2003. The mechanism of action of the Pseudomonas aeruginosa-encoded type III cytotoxin, ExoU. EMBO J. 22, 2959–2969. http://dx.doi.org/10.1093/emboj/cdg290. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., Pühler, A., 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. http://dx.doi.org/10.1016/0378-1119(94)90324–7. Shibl, A.M., Al-Sowaygh, I.A., 1980. Antibiotic inhibition of protease production by Pseudomonas aeruginosa. J. Med. Microbiol. 13, 345–348. http://dx.doi.org/10.1099/ 00222615-13-2-345. Simon, R., Priefer, U., Pühler, A., 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Nat. Biotechnol. 1, 784–791. http://dx.doi.org/10.1038/nbt1183-784. Unkles, S.E., Gemmell, C.G., 1982. Effect of clindamycin, erythromycin, lincomycin, and tetracycline on growth and extracellular lipase production by propionibacteria in vitro. Antimicrob. Agents Chemother. 21, 39–43. http://dx.doi.org/10.1128/AAC.21. 1.39. Yahr, T.L., Barbieri, J.T., Frank, D.W., 1996. Genetic relationship between the 53- and 49kilodalton forms of exoenzyme S from Pseudomonas aeruginosa. J. Bacteriol. 178, 1412–1419. Yahr, T.L., Vallis, A.J., Hancock, M.K., Barbieri, J.T., Frank, D.W., 1998. ExoY, an adenylate cyclase secreted by the Pseudomonas aeruginosa type III system. Proc. Natl. Acad. Sci. U. S. A. 95, 13899–13904. http://dx.doi.org/10.1073/pnas.95.23.13899.