Efficient detection of factor IX mutations by denaturing high-performance liquid chromatography in Taiwanese hemophilia B patients, and the identification of two novel mutations

Efficient detection of factor IX mutations by denaturing high-performance liquid chromatography in Taiwanese hemophilia B patients, and the identification of two novel mutations

Kaohsiung Journal of Medical Sciences (2014) 30, 187e193 Available online at www.sciencedirect.com ScienceDirect journal homepage: http://www.kjms-o...

827KB Sizes 0 Downloads 2 Views

Recommend Documents

No documents
Kaohsiung Journal of Medical Sciences (2014) 30, 187e193

Available online at www.sciencedirect.com

ScienceDirect journal homepage: http://www.kjms-online.com

ORIGINAL ARTICLE

Efficient detection of factor IX mutations by denaturing high-performance liquid chromatography in Taiwanese hemophilia B patients, and the identification of two novel mutations Pei-Chin Lin a,b,c, Yi-Ning Su d,e, Yu-Mei Liao a,b, Tai-Tsung Chang a,c, Shih-Pien Tsai f, Hsiu-Lan Shu f, Shyh-Shin Chiou a,c,* a

Division of Pediatric Hematology and Oncology, Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan b Institute of Clinical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan c Department of Pediatrics, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan d Department of Medical Genetics, National Taiwan University Hospital, Taipei, Taiwan e Graduate Institute of Medical Genomics and Proteomics, College of Medicine, National Taiwan University, Taipei, Taiwan f Department of Nursing, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan Received 22 April 2013; accepted 19 August 2013 Available online 6 January 2014

KEYWORDS Denaturing high-performance liquid chromatography (DHPLC); Factor IX (FIX); Hemophilia B

Abstract Hemophilia B (HB) is an X-linked recessive disorder characterized by mutations in the clotting factor IX (FIX ) gene that result in FIX deficiency. Previous studies have shown a wide variation of FIX gene mutations in HB. Although the quality of life in HB has greatly improved mainly because of prophylactic replacement therapy with FIX concentrates, there exists a significant burden on affected families and the medical care system. Accurate detection of FIX gene mutations is critical for genetic counseling and disease prevention in HB. In this study, we used denaturing high-performance liquid chromatography (DHPLC), which has

Conflicts of interest: All authors declare no conflicts of interest. * Corresponding author. Division of Pediatric Hematology and Oncology, Department of Pediatrics, Kaohsiung Medical University Hospital, Number 100, Tzyou 1st Road, Sanmin District, Kaohsiung City 80756, Taiwan. E-mail address: [email protected] (S.-S. Chiou). 1607-551X/$36 Copyright ª 2013, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. All rights reserved. http://dx.doi.org/10.1016/j.kjms.2013.12.003

188

P.-C. Lin et al. proved to be a highly informative and practical means of detecting mutations, for the molecular diagnosis of our patients with HB. Ten Taiwanese families affected by HB were enrolled. We used the DHPLC technique followed by direct sequencing of suspected segments to detect FIX gene mutations. In all, 11 FIX gene mutations (8 point mutations, 2 small deletions/insertions, and 1 large deletion), including two novel mutations (exon6 c.687e695, del 9 mer and c.460e461, ins T) were found. According to the HB pedigrees, 25% and 75% of our patients were defined as familial and sporadic HB cases, respectively. We show that DHPLC is a highly sensitive and cost-effective method for FIX gene analysis and can be used as a convenient system for disease prevention. Copyright ª 2013, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. All rights reserved.

Introduction Hemophilia B (HB) is a congenital bleeding disorder caused by the deficiency of clotting factor IX (FIX). Patients with severe HB suffer from frequent hemarthroses and chronic arthropathy. Although primary prophylaxis with FIX concentrates greatly improves the quality of life of patients with HB, the societal economic burden of the disease remains extremely high. The FIX gene located on the long arm of chromosome X, Xq27, is 34 kb long and contains eight exons and seven introns. Most families with HB harbor unique FIX mutations, the majority of which are point mutations; small insertions/deletions as well as larger deletions have also been identified [1,2]. Following an Xlinked recessive mode of inheritance, patients with HB typically inherit an FIX gene mutation from their mother (female carrier). Spontaneous mutations have also been noted in one-third of the patients with HB with no family history [3]. A highly sensitive and efficient method for FIX gene analysis is critical for prenatal diagnosis in affected families and detection of female carriers [4,5]. Denaturing high-performance liquid chromatography (DHPLC), which compares two chromosomes as a mixture of denatured and reannealed polymerase chain reaction (PCR)-amplified DNA fragments, offers a rapid and sensitive method for the detection of gene mutations. By the differential retention of homo- and heteroduplex DNA, the presence of a mutation can be detected by reversed-phase chromatography. Point mutations, deletions, and insertions have been detected successfully by online ultraviolet or fluorescence monitoring within 2e3 minutes from unpurified amplicons as large as 1.5 kb [6,7]. In this study, we designed a DHPLC protocol followed by direct sequencing for the assessment of 10 amplicons representing the FIX gene promoter region, coding regions, and exon-flanking sequences. We validate the use of this approach for the detection of FIX mutations using a cohort of 10 HB patients and their families.

Hospital (Kaohsiung, Taiwan) and their families were enrolled in this study. The FIX clotting activity and presence of FIX inhibitors were tested in each of the individuals enrolled. Genomic DNA was extracted from whole blood using the Puregene DNA Isolation Kit (Gentra, Minneapolis, MN, USA) according to the manufacturer’s instructions. The algorithm used for FIX gene mutation analysis is shown in Fig. 1. This study was approved by the Institutional Review Board of Kaohsiung Medical University Hospital (Kaohsiung, Taiwan).

Assay design and PCR conditions Primers for all 10 amplicons are listed in Table 1. The sizes of the amplicons used were approximately 400e600 bp. Each PCR reaction was carried out in a mixture containing the following reagents: 2.5 mL of 10 buffer, 2 mL of 2.5 mM MgCl2, 1 mL of 2.5 mM dNTP, 0.3 mL each of 10 mM forward and reverse primers, 0.1 mL of 5 U/mL Taq DNA polymerase, and 2 mL of 50 ng/mL DNA. The final volume of PCR reactions was 25 mL. Thermocycler conditions used for PCR were as follows: a denaturationeactivation step at 95 C for 10 minutes, followed by a 14-cycle program (denaturation at 95 C for 30 seconds, annealing at 57 C for 30 seconds, and elongation at 72 C for 45 seconds), and a 26-cycle program (denaturation at 95 C for 30 seconds, annealing at 50 C for

Methods Patients Twelve patients with HB who received replacement therapy with FIX concentrates in Kaohsiung Medical University

Figure 1.

Algorithm of hemophilia B gene mutation analysis.

Novel FIX mutations in hemophilia B by DHPLC Table 1

HB Primer pairs and PCR conditions for DHPLC analysis.

Primer HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB HB

189

promoter Fa promoter Rb e1 F e1 R e2þ3 F e2þ3 R e4 F e4 R e5 F e5 R e6 F e6 R e7 F e7 R e8-1 F e8-1 R e8-2 F e8-2 R poly A F poly A R

Primer sequence

Size (bp)

ACAAGCTACAGGCTGGAGACA CAAAGACCATTGAGGGAGA CCCATTCTCTTCACTTGTCC CCTAGCTAACAAAGAACCAGT AGAGATGTAAAATTTTCATGATGTT GCAGAGAAAAAACCCACATAAT CTGCAGGGGAGGACCGGGCATTCTA GAATTCAACTTGTTTCAGAGGGAA CATGAGTCAGTAGTTCCATGTACTTT TGTAGGTTTGTTAAAATGCTGAAGTT TTTAAATACTGATGGGCCTG GTTAGTGCTGAAACTTGCCT AAGCTCACATTTCCAGAAAC TGGGTTCTGAAATTATGA TAAGAATGAGATCTTTAACA CTAAGGTACTGAAGAACTAA GAAGAGTCTTCCACAAAGGG AAGATGGGAAAGTGATTAGTTA AAGAGAACCGTTCGTTTGCA AGAACTAAAGGAACTAGCAAG

410

Annealing temperature ( C)

DHPLC oven ( C)

Elution profile ( C)

57

53

57e66

53e62

407

60

57

56

57e66

56e65

506

64

59

55

59e68

54e63

245

64

51

49

51e60

49e58

272

62

53

51

53e62

51e60

458

57

58

56

58e67

56e65

393

56

57

394

51

55

57

57e66

55e64

391

59

55

57

55e64

57e66

521

59

59

57e66

59e68

DHPLC Z denaturing high-performance liquid chromatography; HB Z hemophilia B; PCR Z polymerase chain reaction. a F Z forward. b R Z reverse.

30 seconds, elongation at 72 C for 45 seconds, and a final elongation at 72 C for 10 minutes).

DHPLC Equal volumes of the amplified PCR products from a patient and a wild-type (male) control were mixed, denatured at 95 C for 5 minutes, and then incubated at 65 C for 30 minutes to obtain heteroduplexes. Mutational screening, performed for all amplified fragments from each patient, was carried out by DHPLC on a Wave DNA Fragment Analysis System (Transgenomic Inc., San Jose, CA, USA) using a DNASep column (Transgenomic Inc.). DNA molecules eluted from the column were detected by scanning with a UV detector at 260 nm. For DHPLC analysis, heterozygous profiles were identified by visual inspection of the chromatograms.

Direct sequencing Direct DNA sequencing was performed on samples showing an abnormal peak pattern. The sequencing process was carried out in a final volume of 10 mL of the purified PCR products, 2.5mM of one of the PCR primers, and 1 mL of ABI PRISM Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). A 25-cycle PCR program with denaturation at 96 C for 10 seconds, annealing at 50 C for 5 seconds, and elongation at 60 C for 4 minutes was conducted in an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Each mutation was confirmed on a second, independent, amplified PCR sample. In order to rule out the possibility of exonic polymorphisms, 150 DNA samples from

healthy, unrelated controls were screened and found negative for the novel missense mutations.

Results Ten families, including 15 individuals (12 patients with HB and 3 female carriers), were enrolled in this study. Prior to this study, all 12 patients and one of the female carriers (Case No. 5) had received FIX concentrates replacement therapy in our hospital (on demand or as prophylaxis), and no evidence of FIX inhibitors had been found. FIX gene mutations were detected by DHPLC and subsequent DNA sequencing of suspected segments in all patients and female carriers. In all, 11 FIX gene mutations were detected (Table 2), including eight point mutations (2 nonsense mutations and 6 missense mutations), one small deletion (Family No. 2), one small insertion (Family No. 6), and one large deletion (Family No. 8). Nine of the 11 identified FIX mutations were listed in the HB Mutation Database (version 13, 2004), and their respective references are listed in Table 2 [8e14]. Two mutations (exon6: c.687_695, del 9 mer and c460_461, ins T) were determined to be novel mutations after a search of literature published between 2004 and 2012 [15e23]; both of these mutations resulted in severe FIX deficiency in men (Cases No. 4 and No. 11).

Discussion Thus far, heterogeneous FIX gene mutations have been identified in all HB patients reported, and the majority of these are point mutations. For example, among 2891

190

Table 2 Family no.

Molecular defects and associated clinical phenotypes in Taiwanese hemophilia B patients. Case no.

Disease severity

1

1

Severe

1

2

1

Nadir FIX activity (%)

FIX gene mutations Position

0.7

17701

Female carriera

25.0

17701

3

Female carrierb

29.0

17701

2

4

Severe

2

5

Female carrierc

3

6

Moderate

1.4

30098

3

7

Severe

0.6

30098

3

8

Severe

0.8

30098

4

9

Severe

0.4

20554

0.1

20529e20537

28.0

20529e20537

31307 5 6 7 8 9 10 a b c

10 11 12 13 14 15

Severe Severe Moderate Severe Severe Severe

0.6 0.3 2.0 0.8 0.9 0.6

10391 17737e17738 10403 del 9900e19218 6460 31216

Nucleotide Exon5: c.424, G > T, GAG > TAG Exon5: c.424, G > T, GAG > TAG IX gene WT Exon5: c.424, G > T, GAG > TAG IX gene WT FIX gene exon6: c.687_695, del 9 mer (TGGAGAAGA) FIX gene exon6: c.687_695, del 9 mer (TGGAGAAGA) Exon7: c.783, G > T, TGG > TGT Exon7: c.783, G > T, TGG > TGT Exon7: c.783, G > T, TGG > TGT Exon6: c.712, T > G, TTC > GTC Exon8: c.1324, G > A, GGA > AGA c.277, G > A, GAT > AAT c.460_461, ins T c.289, T > C, TGT > CGT Exon4eexon5 deletion c.223, C > T, CGA > TGA c.1233, T > G, AGT > AGG

Reference Amino acid p.Glu142*

[8]

p.Glu142*/F

[8]

p.Glu142*/F

[8]

In-frame shift

Novel

In-frame shift

Novel

p.Trp261Cys

[9]

p.Trp261Cys

[9]

p.Trp261Cys

[9]

p.Phe238Val

[10]

p.Gly442Arg

[11]

p.Asp93Asn

[12] Novel [13] [14] [9] [10, 12]

p.Cys97Arg p.Arg75* p.Ser411Arg

Mother of Case No. 1. Sister of Case No. 1. Mother of Case No. 4.

P.-C. Lin et al.

Novel FIX mutations in hemophilia B by DHPLC

Figure 2. Sequences of two novel FIX gene mutations. (A) Segments containing putative mutations of Case No. 5 (female carrier) revealed to be heterozygous for exon6 c.687e695, del 9 mer and wild type. (B) Homozygous c.460e461, ins T in Case No. 11.

patient entries in the HB Mutation Database version 13, only 91 patients have gross deletions/insertions and 211 have short deletions/insertions (defined as less than 30 nucleotides). In addition, nearly one-third of the patients listed in the database carry unique mutations, 34 patients carry double mutations, and one patient has been described to carry triple FIX mutations. Therefore, complete FIX gene screening is mandatory during genetic counseling for HB.

191 Direct sequencing is the most sensitive method for detecting gene mutations; however, it is expensive and time consuming, thereby making it less suitable for genetic screening tests. Conventional screening methods such as single-stranded conformational polymorphisms, conformational sensitive gel electrophoresis, and chemical mismatch cleavage have also been used for FIX gene analysis, but these techniques only have 70e80% sensitivity [24,25]. DHPLC, developed by Professor Oefner and colleagues [26e28], allows the automated detection of single-base substitutions as well as small insertions and deletions. DHPLC has been applied to detect mutations for various diseases and has proved to have higher sensitivity and specificity (over 90%) than conventional screening methods [7,28e30]. In our study, we successfully used DHPLC and subsequent DNA sequencing of suspected segments to detect FIX gene mutations, including point mutations, small deletions/insertions, and a gross deletion in all the HB patients and female carriers screened. We were also able to confirm the presence of double point mutations in one of our patients. In addition, we identified two novel FIX gene mutations (Fig. 2). The first of these was a small deletion of nine nucleotides (nucleotides 20529e20537), which is predicted to result in an in-frame mutation (Gly183eGly184eGlu185eAsp186eAla187 > Gly183eAla184) involving the catalytic domain (Fig. 3A). Because this region is near the activated FIX (FXIa) cleavage site (Arg180eVal181), which is critical for the formation of FIXa as well as the specificity of the catalytic domain for binding to factor VIIIa, this mutation is expected to influence FIX activation or subsequent FVIIIa binding, resulting in severe HB. The second novel mutation identified was a single nucleotide insertion between 17,737 bp and 17,738 bp, and it is predicted to result in a premature stop codon (Fig. 3B). Both of these mutations were associated with an FIX activity of less than 1%, and no FIX inhibitor was observed in either patient. Familial cases were defined in this study as patients with relatives (belonging to an earlier generation) or an older cousin who were either affected with or carrying HB [31]. According to the pedigrees used in our study cohort, only Cases No. 6, No. 7, and No. 8 were defined as familial (Case No. 6 was an older cousin of Cases No. 7 and No. 8). Case No. 1 had a sibling who was proved to be a female carrier (Case No. 3), and this pair was thus defined as a sporadic sibship (first affected sibship). The other patients were determined to be sporadic isolated cases. Collectively, 25% of the HB patients were clearly familial, and 75% were sporadic (mostly sporadic isolated cases). The prevalence of familial HB cases varied widely in previous studiesdfrom 15% (2/14) in the study by Bicocchi et al. [32] to 57% (82/ 144) in the study by Kasper and Lin [31]. Our data were more similar to those reported by Bicocchi et al. [32] than to those reported by Kasper and Lin [31]. Because the cohorts used in both this study and the study by Bicocchi et al. [32] were small, we suspect that the prevalence of familial HB cases observed was influenced by sample size. In conclusion, we found that DHPLC could efficiently detect all forms of FIX gene mutations in HB patients and female carriers and also identify novel mutations. Thus, DHPLC can be used as a cost-effective and sensitive method for confirmation of HB cases as well as for carrier diagnosis.

192

P.-C. Lin et al.

Figure 3. Nucleotides and amino acid sequences of the wild-type and two novel mutant FIX genes. (A) Nucleotide positions 20518e20538 of the wild-type FIX gene and 20529e20537 deletion (exon6 c.687e695, del 9 mer). The deleted nucleotides and the predicted mutated sequence are shown as red and green letters, respectively. (B) Nucleotide positions 17735e17758 of the wildtype FIX gene and 17737e17738 insT (c.460e461, ins T). The insert T is indicated in red, and the predicted amino acids are shown as green letters.

Acknowledgments This study was supported by a grant from Kaohsiung Medical University Hospital (KMUH95-5D60).

References [1] Giannelli F, Green PM, Sommer SS, Poon M, Ludwig M, Schwaab R, et al. Haemophilia B: database of point mutations and short additions and deletionsdeighth edition. Nucleic Acids Res 1998;26:265e8. [2] Attali O, Vinciguerra C, Trzeciak MC, Durin A, Pernod G, Gay V, et al. Factor IX gene analysis in 70 unrelated patients with haemophilia B: description of 13 new mutations. Thromb Haemost 1999;82:1437e42. [3] Lawn RM. The molecular genetics of hemophilia: blood clotting factors VIII and IX. Cell 1985;42:405e6. [4] Lillicrap D. The molecular basis of haemophilia B. Haemophilia 1998;4:350e7. [5] Peake I. Genetic services available for counselling and prenatal diagnosis of haemophilia. Haemophilia 1998;4:24e5. [6] Xiao W, Oefner PJ. Denaturing high-performance liquid chromatography: a review. Hum Mutat 2001;17:439e74. [7] Wagner T, Stoppa-Lyonnet D, Fleischmann E, Muhr D, Pages S, Sandberg T, et al. Denaturing high-performance liquid chromatography detects reliably BRCA1 and BRCA2 mutations. Genomics 1999;62:369e76.

[8] Tagariello G, Belvini D, Salviato R, Are A, De Biasi E, Goodeve A, et al. Experience of a single Italian center in genetic counseling for hemophilia: from linkage analysis to molecular diagnosis. Haematologica 2000;85:525e9. [9] Rowley G, Saad S, Giannelli F, Green PM. Ultra rapid mutation detection by multiplex, solid-phase chemical cleavage. Genomics 1995;30:574e82. [10] Lin SW, Shen MC. Genetic basis and carrier detection of hemophilia B of Chinese origin. Thromb Haemost 1993;69: 247e52. [11] Ghanem N, Costes B, Martin J, Vidaud M, Rothschild C, FoyerGazengel C, et al. Twenty-four novel hemophilia B mutations revealed by rapid scanning of the whole factor IX gene in a French population sample. Eur J Hum Genet 1993;1:144e55. [12] Koeberl DD, Bottema CD, Ketterling RP, Bridge PJ, Lillicrap DP, Sommer SS. Mutations causing hemophilia B: direct estimate of the underlying rates of spontaneous germ-line transitions, transversions, and deletions in a human gene. Am J Hum Genet 1990;47:202e17. [13] Costa JM, Ernault P, Vidaud D, Vidaud M, Meyer D, Lavergne JM. Fast and efficient mutation detection method using multiplex PCR and cycle sequencingdapplication to haemophilia B. Thromb Haemost 2000;83:244e7. [14] Ludwig M, Schwaab R, Eigel A, Horst J, Egli H, Brackmann HH, et al. Identification of a single nucleotide C-to-T transition and five different deletions in patients with severe hemophilia B. Am J Hum Genet 1989;45:115e22. [15] Mukherjee S, Mukhopadhyay A, Banerjee D, Chandak GR, Ray K. Molecular pathology of haemophilia B: identification of

Novel FIX mutations in hemophilia B by DHPLC

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

five novel mutations including a LINE 1 insertion in Indian patients. Haemophilia 2004;10:259e63. Belvini D, Salviato R, Radossi P, Pierobon F, Mori P, Castaldo G, et al. Molecular genotyping of the Italian cohort of patients with hemophilia B. Haematologica 2005;90:635e42. Knobe KE, Persson KE, Sjorin E, Villoutreix BO, Ljung RC. Functional analysis of the factor IX epidermal growth factorlike domain mutation Ile66Thr associated with mild hemophilia B. Pathophysiol Haemost Thromb 2006;35:370e5. Jenkins PV, Egan H, Keenan C, O’Shea E, Smith OP, Nolan B, et al. Mutation analysis of haemophilia B in the Irish population: increased prevalence caused by founder effect. Haemophilia 2008;14:717e22. Ghosh K, Quadros L, Shetty S. Spectrum of factor IX gene mutations causing haemophilia B from India. Blood Coagul Fibrinolysis 2009;20:333e6. Seita I, Shinozawa K, Otaki M, Fujita S, Suzuki T, Amano K, et al. Double mutation, a 2-bp deletion and Val211Ile, in the blood coagulation factor IX gene of a patient with severe hemophilia B. Rinsho Byori 2009;57:417e24. Zhang Y, Yang LH, Lu YL, Ding QL, Wang XF, Liu XE, et al. Detection of factor IX gene mutation in patients with hemophilia B by DNA sequencing. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2009;17:476e8. Balraj P, Ahmad M, Khoo AS, Ayob Y. Factor IX mutations in haemophilia B patients in Malaysia: a preliminary study. Malays J Pathol 2012;34:67e9. Yu T, Dai J, Liu H, Ding Q, Lu Y, Wang H, et al. Spectrum of F9 mutations in Chinese haemophilia B patients: identification of 20 novel mutations. Pathology 2012;44:342e7. Hinks JL, Winship PR, Makris M, Preston FE, Peake IR, Goodeve AC. A rapid method for haemophilia B mutation

193

[25]

[26]

[27]

[28]

[29]

[30]

[31] [32]

detection using conformation sensitive gel electrophoresis. Br J Haematol 1999;104:915e8. David D, Rosa HA, Pemberton S, Diniz MJ, Campos M, Lavinha J. Single-strand conformation polymorphism (SSCP) analysis of the molecular pathology of hemophilia B. Hum Mutat 1993;2:355e61. Liu WO, Oefner PJ, Qian C, Odom RS, Francke U. Denaturing HPLC-identified novel FBN1 mutations, polymorphisms, and sequence variants in Marfan syndrome and related connective tissue disorders. Genet Test 1997;1:237e42. Underhill PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, et al. Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chromatography. Genome Res 1997;7:996e1005. O’Donovan MC, Oefner PJ, Roberts SC, Austin J, Hoogendoorn B, Guy C, et al. Blind analysis of denaturing high-performance liquid chromatography as a tool for mutation detection. Genomics 1998;52:44e9. Giordano M, Oefner PJ, Underhill PA, Cavalli Sforza LL, Tosi R, Richiardi PM. Identification by denaturing high-performance liquid chromatography of numerous polymorphisms in a candidate region for multiple sclerosis susceptibility. Genomics 1999;56:247e53. Oldenburg J, Ivaskevicius V, Rost S, Fregin A, White K, Holinski-Feder E, et al. Evaluation of DHPLC in the analysis of hemophilia A. J Biochem Biophys Methods 2001;47:39e51. Kasper CK, Lin JC. Prevalence of sporadic and familial haemophilia. Haemophilia 2007;13:90e2. Bicocchi MP, Pasino M, Bottini F, Lanza T, Mori PG, Acquila M. Mutation analysis impact on the genetic counseling of sporadic hemophilia B families. Am J Med Genet A 2003;118A: 328e31.