Equine bone marrow-derived mesenchymal stromal cells inhibit reactive oxygen species production by neutrophils

Equine bone marrow-derived mesenchymal stromal cells inhibit reactive oxygen species production by neutrophils

Journal Pre-proof Equine bone marrow-derived mesenchymal stromal cells inhibit reactive oxygen species production by neutrophils ´ Schenffeldt, Pablo ...

3MB Sizes 0 Downloads 0 Views

Journal Pre-proof Equine bone marrow-derived mesenchymal stromal cells inhibit reactive oxygen species production by neutrophils ´ Schenffeldt, Pablo Alarcon, ´ Gabriel Espinosa, Anita Plaza, Andres ´ Claudio Gonzalo Gajardo, Benjam´ın Uberti, Gabriel Moran, Henr´ıquez

PII:

S0165-2427(19)30225-9

DOI:

https://doi.org/10.1016/j.vetimm.2019.109975

Reference:

VETIMM 109975

To appear in:

Veterinary Immunology and Immunopathology

Received Date:

25 June 2019

Revised Date:

8 November 2019

Accepted Date:

12 November 2019

´ P, Gajardo G, Uberti Please cite this article as: Espinosa G, Plaza A, Schenffeldt A, Alarcon ´ G, Henr´ıquez C, Equine bone marrow-derived mesenchymal stromal cells inhibit B, Moran reactive oxygen species production by neutrophils, Veterinary Immunology and Immunopathology (2019), doi: https://doi.org/10.1016/j.vetimm.2019.109975

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

EQUINE BONE MARROW-DERIVED MESENCHYMAL STROMAL CELLS INHIBIT REACTIVE OXYGEN SPECIES PRODUCTION BY NEUTROPHILS.

Gabriel Espinosa1*, Anita Plaza2*, Andrés Schenffeldt1, Pablo Alarcón1, Gonzalo Gajardo3, Benjamín Uberti4, Gabriel Morán1, Claudio Henríquez1** ([email protected])

and Morphophysiology Department, Faculty of Veterinary Sciences, Universidad

Austral de Chile

Animal Science Department, Faculty of Veterinary Sciences, Universidad Austral de Chile

4 Veterinary

-p

3

Department, Faculty of Medicine, Universidad Austral de Chile

ro

2 Medicine

of

1 Pharmacology

Clinical Sciences Department, Faculty of Veterinary Sciences, Universidad Austral de

lP

re

Chile

ur na

Gabriel Espinosa: [email protected] (* Both authors contributed equally to this work) Anita Plaza: [email protected] (* Both authors contributed equally to this work) Andrés Schenffeldt: [email protected] Pablo Alarcón: [email protected]

Jo

Gonzalo Gajardo: [email protected] Benjamín Uberti: [email protected] Gabriel Moran: [email protected] Claudio Henríquez: [email protected] (** Corresponding author)

Highlights 

Equine mesenchymal stromal cells inhibit oxidative metabolism in neutrophils, increase their lifespan and modulate their function.



The supernatant obtained from equine mesenchymal stromal cells strongly inhibit respiratory burst of neutrophils.



The supernatant obtained from equine mesenchymal stromal cells doesn’t affect important

ro

of

microbicidal functions.

-p

Abstract

Background: Polymorphonuclear neutrophils (PMN) are the largest leukocyte population in the

re

blood of most mammals including horses, and play an important defensive role in many

lP

infectious diseases. However, the mechanisms that increase PMN as one of the main cellular subsets in the defense against pathogens could also be involved in the pathophysiology of

ur na

dysregulated inflammatory conditions. Mesenchymal stem/stromal cells (MSCs) are a heterogeneous population with a modulatory potential on the inflammatory response and are known to interact with nearly all cells of the immune system, including PMN. In this study, the in vitro modulation of equine bone marrow-derived MSCs on equine PMN phagocytosis, ROS

Jo

production, and NETs generation was assessed. Results: In co-culture with MSCs, unstimulated PMN produce less ROS (2.88%  1.43) than PMN in single culture (5.89%  2.63) (p=0.016). Moreover, PMN co-cultured with MSCs remain conditioned to produce fewer ROS after PMA stimulation in comparison to PMN in single culture (p<0.05). Additionally, it was found that incubation with MSC supernatant strongly inhibited ROS

production (83%  6.35 less than control) without affecting phagocytosis or capacity for NETosis (p<0.01). Conclusions: These results suggest a modulatory effect of equine BM-derived MSCs on PMN respiratory burst, without impairing other important microbicidal functions. This supports the potential use of equine MSCs in excessive or persistent inflammatory conditions in which

of

neutrophils are the main effector cells.

ro

List of abbreviations

-p

MSCs: Mesenchymal stem/stromal cells PMN: Polymorphonuclear neutrophil

re

NADPH: Nicotinamide adenine dinucleotide phosphate oxidase

lP

ROS: Reactive oxygen species NETs: Neutrophil extracellular traps

ur na

Treg: Regulatory T cells Breg: Regulatory B cells BM: Bone Marrow Th1: T helper 1

Jo

Th2: T helper 2

PBS: Phosphate-buffered saline DMEM: Dulbecco's Modified Eagle's Medium RPMI: Roswell Park Memorial Institute medium FBS: Fetal bovine serum GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

CFSE: Succinimidyl Carboxyfluorescein Ester PBMC: Peripheral blood mononuclear cells ConA: Concanavalin A PTGS2: Prostaglandin-endoperoxide synthase 2 COX-2: Cyclooxygenase 2 SN-MSC: Mesenchymal stem/stromal cells supernatant

of

DHE: Dihydroethidium PMA: Phorbol 12-myristate 13-acetate

ro

MFI: Mean fluorescence intensity

f-MLP: N-formyl-methionyl-leucyl-phenylalanine

re

IL-6: Interleukin 6

-p

OZ: Opsonized zymosan

lP

IL-8: Interleukin 8

GM-CSF: Granulocyte-macrophage colony-stimulating factor

ur na

SOD3: Superoxide dismutase

TSG-6: Tumor necrosis factor-inducible gene 6 protein LPS: Lipopolysaccharide

Jo

hAMSC: Amniotic membrane MSCs

Keywords: Horse, Mesenchymal stromal cells, Neutrophils, Respiratory burst.

Background

Polymorphonuclear neutrophils (PMN) are the largest leukocyte population in the blood of most mammals, including horses. They are considered first responders to tissue damage or pathogen signals, and play an important defensive role in many infectious diseases (Witko-Sarsat et al., 2000). Once recruited, PMN activation induces a plethora of different microbicidal mechanisms, including the ingestion of pathogens through phagocytosis and generation of antimicrobial reactive oxygen species (ROS). High ROS concentration in turn induces the release of proteases

of

and formation of neutrophil extracellular traps (NETs), which contribute to combat and kill microorganisms effectively (Dabrowska et al., 2016). However, the mechanisms that increase

ro

neutrophil presence in inflamed tissues may also be involved in the pathophysiology of

-p

dysregulated inflammatory conditions. When uncontrolled, the antimicrobial activities of PMNs can provoke severe inflammatory and autoimmune diseases that can lead to significant local, and

re

in some cases, extensive long-term damage. This dysregulation of inflammatory conditions has

lP

been associated to endothelial dysfunction, neurodegeneration, carcinogenesis, and aging (O'Neill et al., 2015; Trachootham et al., 2008). In horses, there is extensive literature supporting

ur na

the tissue-damaging role of PMN in different inflammatory conditions, such as laminitis, ischemia-reperfusion, asthma, and infertility (Anderson and Singh, 2018; Bullone and Lavoie, 2017; Katila, 2012; Leise, 2018; Troedsson et al., 2001).

Jo

Mesenchymal stem/stromal cells (MSCs) are a population of cells originally obtained from bone marrow (BM), forming part of the hematopoietic niche (Friedenstein et al., 1966; Pittenger et al., 1999). MSCs are a heterogeneous population of cells that proliferate in vitro as plastic-adherent cells, have fibroblast-like morphology, form colonies and can differentiate into bone, cartilage, and adipose cells. Currently, MSCs have been isolated from almost every connective tissue, with similar properties (da Silva Meirelles et al., 2006). MSCs have been postulated for the treatment

of many conditions in animals; in equine medicine, they have been especially shown to contribute to the healing process by limiting tissue damage and promoting tissue repair (Ball et al., 2018; Bogers, 2018; Cassano et al., 2018; Lo Monaco et al., 2018; Muttini et al., 2012). It seems clear that a critical property of MSCs is modulation of the inflammatory response, since they can regulate both innate and adaptive immune responses, interacting with PMN and all neighboring cells of the immune system (Caplan and Sorrell, 2015; Carrade et al., 2012; Fontaine et al., 2016;

of

Li and Hua, 2017; Najar et al., 2016; Peroni and Borjesson, 2011; Remacha et al., 2015; Shi et al., 2018). Furthermore, MSCs suppress proliferation and function of T lymphocytes, through

ro

mechanisms that differ between species (Francois et al., 2012; Ling et al., 2014; Su et al., 2014).

-p

Additionally, MSCs promote proliferation of regulatory T cells (Treg), which have a critical role in the modulation of the immune response in many diseases in humans and animals (Henriquez et

re

al., 2014; Kadle et al., 2018; Lee et al., 2017). MSCs also inhibit the function and proliferation of B

lP

lymphocytes, promoting the induction of regulatory B lymphocytes (Breg). However, it is the immunological environment that dictates the effect of MSCs on B cell function (Blair et al., 2010;

ur na

Luk et al., 2017; Traggiai et al., 2008). MSCs can also modulate the link between innate and adaptive immune responses, suppressing differentiation of and antigen presentation by dendritic cells (English et al., 2008), and promoting the shift from pro-inflammatory M1 to anti-

Jo

inflammatory M2 macrophages (Francois et al., 2012; Nemeth et al., 2009).

The interaction of MSCs with PMN has been explored in some species, showing that MSCs may limit neutrophilic inflammation in some disease models where polymorphonuclears are the primary effector cells (Gupta et al., 2007; Mittal et al., 2018). In this study, the in vitro modulation of equine BM-derived MSCs on different functions of equine PMN, such as phagocytosis, ROS

production, and NETs generation, was addressed in order to explore the potential of this cell therapy in PMN-mediated inflammatory conditions.

Material and Methods. Horses Twelve clinically healthy mixed-breed adult horses (body weight 420-450 kg, age 8-12 years),

of

belonging and housed at Universidad Austral de Chile veterinary teaching hospital were enrolled in this study. All animals were kept on pasture, fed grass with free access to water. Physical

ro

examinations were performed before sample collection for the duration of the study by qualified

-p

veterinarians, to ensure that the animals were healthy. All procedures were approved by the Bioethics Committee for the Use of Animals in Biomedical Research of Universidad Austral de

ur na

Cell isolation and culture

lP

re

Chile.

MSCs isolation

Aspirates from BM were collected aseptically from the study subjects (five mares and one gelding) as described previously (Kasashima et al., 2011). Mononuclear cells were enriched from

Jo

aspirates by using Percoll (Percoll® GE Healthcare) gradient. This gradient was performed by diluting 9 volumes of Percoll in 1 volume of phosphate-buffered saline (PBS) citrate 10X. The Percoll was subsequently diluted to 70% with PBS citrate 1X (10 mM sodium phosphate, 2.7 mM KCl and 137 mM NaCl, pH 7.4; 0,4% w/v trisodium citrate). The gradient was constructed by adding 5 mL of BM aspirate over a 4 mL 70% Percoll cushing into a 15 mL conical tube. After centrifugation (25 min, 400 x g) the mononuclear cells were obtained and seeded in culture

flasks (T175) in low glucose (1 g/dL) Dulbecco modified Eagles minimal essential medium (DMEM) containing 10% heat-inactivated fetal bovine serum (FBS; Biological Industries, Israel) and penicillin (100 units/mL) with streptomycin (100 μg/mL)], at 37°C in an atmosphere of 5% CO2. After 48 h, non-adherent cells and cellular debris were removed by washing thrice with phosphate-buffered saline (PBS) and the culture medium DMEM was replaced. The same procedure was repeated every other day, until colony forming units (CFU) were evident

of

approximately at day 14 of culture. At this point, cells were trypsinized in order to distribute the cells in the bottle and promote a homogeneous growth. Finally, MSCs were trypsinized when

-p

liquid nitrogen. All MSCs were used at passage 4 or lower.

ro

cultures reached 70% of confluence, counted and cryopreserved for subsequent experiments in

re

Characterization of MSCs

lP

In order to characterize the cells obtained from the BM samples, mRNA was isolated with E.Z.N.A. Total RNA kit (OMEGA bio-tek). For DNA digestion, RNA samples were treated with TURBO DNAse

ur na

free-kit (Life technologies). Amplification of cDNAs was performed from 1μg of RNA using 200 U of M-MLV reverse Transcriptase (Promega) and 50 μM Oligo(dT)15 primer (Promega). PCRs were performed using 0.5 μM of specific primers, for CD44, CD90, CD105, CD45, and glyceraldehyde-3-

Jo

phosphate dehydrogenase (GAPDH) (table 1).

Table 1. Primers used for MSCs cultures characterization. Genbank code

Gene

Name

XM_005598023.2

CD44

Homing cell adhesion molecule

XM_001503225.3

CD90

Thy-1 cell surface antigen

XM_003364144.3

CD105

Endoglin

Sequence Primer 5'→3' F: ATCCTCACGTCCAACACCTC R: CTCGCCTTTCTTGGTGTAGC F: TGCCTGAGCACACATACCGCTC R: GCTTATGCCCTCGCACTTGACC F: GACGGAAAATGTGGTCAGTAATGA R: GCGAGAGGCTCTCCGTGTT

XM_005608047.2

CD45

Protein tyrosine phosphatase receptor type C

NM_001163856.1

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

F: TGATTCCCAGAAATGACCATGTA R: ACATTTTGGGCTTGTCCTGTAAC F: TGGCATGGCCTTCCGTGTCC R: GCCCTCCGATGCCTGCTTCAC

MSCs trilinear differentiation To determine the MSCs potential, trilineage differentiation was performed using commercial differentiation kit (StemPro Chondrogenesis, Adipogenesis and Osteogenesis Differentiation kit,

of

Gibco, life technologies) as described elsewhere (Barberini et al., 2014). Osteogenic

ro

differentiation was confirmed by positive staining of the extracellular calcium matrix using 2% Alizarin Red S staining (Sigma-Aldrich Corp., USA), adipogenic differentiation was confirmed by

-p

the deposition of lipid droplets in the cytoplasm using 0.5% Oil Red O staining (Sigma-Aldrich Corp., USA), and chondrogenic differentiation was confirmed by staining with Alcian Blue (pH =

re

2.5). Cells obtained from all study subjects showed ability to differentiate into the three cell

ur na

Proliferation Assay

lP

types.

In order to determine the effect of MSCs on lymphocyte proliferation, a Succinimidyl Carboxyfluorescein Ester (CFSE) dilution assay was performed. For this, equine peripheral blood mononuclear cells (PBMC) were loaded with CFSE, as described previously (Quah and Parish,

Jo

2010). To induce lymphocyte proliferation, 100 μL of PBMC (1x106 / mL) were placed per well in a 96-well culture plate, stimulated by adding 100 μL of concanavalin A (ConA, Sigma-Aldrich Corp., USA) to a concentration of 5 μg/mL, and incubated for 4 days at 37°C with 5% CO2. Unlabelled cells with and without ConA and unstimulated labeled cells were used as controls of the technique. Dilution of the CFSE label was evaluated by flow cytometry (BD FACS Canto II), for which the cells were transferred to cytometry tubes, washed and labeled with LIVE / DEAD®

(FixableNear-IR Dead Cell Stain, ThermoFisher Scientific, USA), according to the manufacturer's instructions. Once the incubation was finished, the cells were washed twice with 1 mL of cytometry buffer and resuspended in 200 μL of it.

Equine neutrophil isolation The isolation of PMN from peripheral blood samples was done as previously described (Siemsen

of

et al., 2007). Briefly, 10 mL of blood obtained from 6 different horses by jugular venipuncture was placed in sterile tubes containing 1 mL of 3.8% w/v trisodium citrate. Blood was placed on a

ro

discontinuous density gradient (Percoll, GE Healthcare, USA), with 3 mL of 85% Percoll in the

-p

bottom of a 15 mL tube and 3 mL of 70% Percoll above. After centrifugation (30 min, 400 g), the upper layer contained mononuclear cells and the lower layer contained granulocytes. Both layers

lP

re

were aspirated for further processing. Cells were subsequently prepared for bioassays.

Preparation of MSCs supernatant (SN-MSCs).

ur na

In order to obtain the products released by MSCs, cells were plated in 6-well plates at a density of 3×105 cells in a final volume of 2 mL per well of DMEM supplemented medium. Twenty-four hours later, the medium was replaced with fresh RPMI-1640 (with no FBS or antibiotic) without phenol red. The cells were cultured for 48 h at 37ºC in an atmosphere of 5% CO2. After this

Jo

culture time, the medium was collected, filtered using a 0.2 μm filter, and was considered MSCs supernatant (SN-MSCs). All SN-MSC was pooled into a single batch, aliquoted and stored at -80ºC for further usage.

Neutrophil respiratory burst

In order to determine whether contact with MSCs conditions PMN oxidative function, 2x105 MSCs were seeded in 24 well plates during 12 h in order allow cell adhesion, after which wells were washed and DMEM medium replaced with RPMI-1640 (supplemented with 10% of FBS and antibiotics) containing 2x106 PMN, thus obtaining a PMN:MSCs ratio of 10:1. Control PMN were cultured alone in similar plates. Both co-cultured and singly cultured PMN were incubated for 4 h at 37ºC in an atmosphere of 5% CO2. Thereafter, PMN were recovered, labeled with the redox-

of

sensitive dye dihydroethidium (DHE) and stimulated with 100 ng/ml phorbol 12-myristate 13acetate (PMA) (Sigma-Aldrich Corp., USA) at 37ºC for 30 minutes. Median intensity fluorescence

ro

(MFI) was measured using a FACS Canto II cytometer and Flowjo v10 software (FlowJo, LLC.,

re

Unstained cells served as background control.

-p

USA), within the neutrophil gate before and 5, 15, and 30 minutes after stimuli with PMA.

lP

The production of ROS by equine PMN cultured in presence of MSCs or supernatant (SN)-MSCs, was evaluated by luminol oxidation. For the determination of the effect of SN-MSCs on ROS

ur na

production, PMN were seeded at a density of 3x105 cells per well in 160 μL of RPMI-1640 alone or different concentrations of SN-MSCs (0.05%, 5%, 25%, or 50%). The PMNs were cultured for 1 h at 37ºC in an atmosphere of 5% CO2. Thereafter, luminol (Sigma-Aldrich Corp., USA) was added to the plates at a final concentration of 5.4 mM, and respiratory burst was stimulated with

Jo

opsonized zymosan (OZ) (0.1 mg/mL). Chemiluminescence was obtained by the interaction of O2 or a dismutation product with luminol, which results in the emission of light that was measured by the luminometer (Perkin Elmer, Victor 2030) during approximately 1 h of incubation at a temperature of 37 °C.

Neutrophil phagocytic activity

Phagocytosis assay was performed using pHrodo Green E.coli Bioparticles kit (Molecular probes, ThermoFisher Scientific, USA). For determination of SN-MSCs effect on phagocytic capacity, 5x105 PMN were cultured with 100 μL of SN-MSCs or RPMI-1640 alone without phenol red during 1 h at 37ºC in an atmosphere of 5% CO2. Thereafter, 100 μL of PBS containing 1 mg/mL of E.coli Bioparticles was added to each condition. Cells were maintained during 30 min at 37ºC in an atmosphere of 5% CO2, and thereafter the percentage of phagocytosis was evaluated by flow

of

cytometry and Flowjo v10 software (FlowJo, LLC., USA).

ro

Neutrophil NETs release

-p

Neutrophil extracellular traps were quantitated by measuring the amount of extracellular DNA that was stained by the cell-permeant fluorescent dye PicoGreen® (Invitrogen, USA) as described

re

elsewhere (Alarcon et al., 2017). Briefly, 1x106 PMN were incubated with incomplete RPMI 1640

lP

without phenol red or SN-MSCs for 1 h, after which 50 uL of OZ at a final concentration of 1 mg/mL was added to the well for NETosis induction. Micrococcal nucleases were added (5

ur na

U/well, New England Biolabs, USA) (15 min, 37°C), followed by centrifugation (300 x g, 5 min). The supernatants were transferred (100 ml per 96-well) and PicoGreen® (50 µl/well, diluted 1:200 in 10 mM Tris/1 mM EDTA) was added. NETs formation was determined by spectrofluorometric analysis (484 nm excitation/520 nm emission) using an automated reader

Jo

(Varioskan Flash; ThermoFisher Scientific, USA).

Neutrophil apoptosis For the evaluation of the effect of co-culture between PMN and MSCs (10:1) on spontaneous apoptosis, Alexa Fluor® 488 annexin V/Dead Cell Apoptosis Kit (Molecular Probes, ThermoFisher Scientific, USA) was used according to the manufacturer’s protocol. After 4 hours

of PMN single culture or PMN-MSCs co-culture, cells were recovered by washing with PBS, and resuspended in annexin V binding buffer at a concentration of 1x106 cells/mL. Five μL of annexin V and 1 μL PI (1 μg/mL) were added and incubated with cells at room temperature for 15 min. Next, 400 μL of annexin V binding buffer was added to each tube and data were acquired immediately by flow cytometry.

of

Data analysis GraphPad Prism (GraphPad Software Inc., version 5.0) was used for graph generation and

ro

statistical analysis. Results are presented as means ± standard deviation (SD). Area under the

-p

curve values were obtained for respiratory burst production. Kolmogorov–Smirnov tests showed that the data were not normally distributed for all three experiments (respiratory burst,

re

phagocytosis and NETosis). Kruskal Wallis test was performed to compare the differences

lP

between groups in each assay, and this was followed by a Tukey test for respiratory burst and NETosis. For phagocytosis assays, differences between groups were determined using an

Results

ur na

unpaired Student's two-tailed t-test. Overall, p values <0.05 were considered as significant.

Jo

Characterization of equine BM-derived Mesenchymal Stem Cells. The cells obtained from the BM samples were attached to plastic and adopted a fibroblastic shape, generating colony-forming units within a week in all animals. In addition, they were able to undergo osteogenic, chondrogenic and adipogenic differentiation (figure 1a). Expression of equine MSCs markers CD44, CD90 and CD105 (Barberini et al., 2014) was determined by

conventional PCR, being consistently positive in all animals; the cultured cell population was negative for the hematopoietic marker CD45 (Figure 1b).

Inhibition of nonantigen-specific polyclonal allogeneic T cell proliferation is a hallmark of BM-derived MSCs function. In order to further functionally characterize the isolated population, a proliferation assay based on the dilution of CFSE was performed. In this

of

experiment, MSCs isolated from BM samples from all study subjects were able to significantly inhibit the proliferation of PBMC, with similar potency, when they were co-cultured in a 10:1

MSCs modulate neutrophil respiratory burst.

-p

ro

ratio (PBMC:MSC) (p<0.05) (Figure 1c).

re

The capacity of MSCs to modulate some key microbicidal functions of equine PMN was assessed.

lP

One of the main mechanisms involved in the destruction of pathogens by PMN is the production of ROS in the respiratory burst. When PMN were co-cultured with MSCs during 4 h in a 10:1 ratio,

ur na

the percentage of PMN that produced ROS in the absence of stimulus was significantly lower (2.88%  1.43) compared with PMN in single culture (5.89%  2.63) (p<0.05) (Figure 2a), suggesting that MSCs exerted a modulatory effect by preventing oxidative metabolism and ROS production by the PMN. Additionally, this conditioning effect persisted after cells were stimulated

Jo

with PMA, since PMN cultured alone were capable of producing more ROS than those co-cultured with MSCs, 20 and 30 minutes after stimulation (p<0.05 and p<0.01, respectively) (Figure 2b). Early and late apoptosis were determined after 24 hours of culture with and without MSCs, in order to determine whether there was an increase in PMN death due to co-culture with MSCs or not. These results showed a moderate increase of live PMN in the case of co-culture with MSCs (79.23%  2.13), in comparison with single culture (63.80%  10.57), mainly explained by an

increase in early apoptosis (29.02%  12.31 PMN-MSCs co-culture versus 17.17  1.76 PMN single culture) (p<0.05 in all cases) (Figure 2c).

Next, whether or not molecules released by the MSCs and accumulated in the culture medium are capable of modulating PMN respiratory burst was assessed. To this end, PMN were incubated during 1 h with different concentrations of MSCs supernatant (SN-MSCs) and then stimulated

of

with OZ. As is shown in Figure 3b, PMN cultured in presence of SN-MSCs produce significant less

ro

ROS than those cultured with control RPMI-1640 (p<0.01).

-p

SN-MSCs does not affect phagocytic capacity and NETosis of equine neutrophils. Phagocytosis is one of the fundamental mechanisms that allow PMN and macrophages to

re

eliminate pathogens and cellular debris, controlling infections and allowing the resolution of

lP

inflammation. Phagocytosis and NETs formation of PMN in single culture or in co-culture with SN-MSCs for 1 h were compared. Incubation of PMN with different concentrations of SN-MSCs did

ur na

not affect phagocytic capacity (p>0.05) (Figure 4a).

Another mechanism used by PMN to eliminate microbes is the extrusion of a meshwork of chromatin fibers decorated with antimicrobial peptides and enzymes, called PMN NETs

Jo

(Brinkmann et al., 2004). Since the formation of NETs seems to be importantly regulated by the production of ROS, the possibility that the decrease in respiratory burst observed by incubating PMN with SN-MSCs could also modify the ability of the PMN to release NETs was explored. However, SN-MSCs did not modify equine PMN NETosis (p>0.05), suggesting a ROS-independent mechanism (Figure 4b).

Discussion

The immunoregulatory properties of MSCs obtained from different sources has been pointed out in a number of in vitro and in vivo studies in many different species. The main cellular functions modulated by MSCs are proliferation of NK cells and lymphocytes, cytokine secretion and Th1/Th2 balance, maturation of dendritic and B cells, switching macrophages from pro-

of

inflammatory to anti-inflammatory profiles, antigen presentation, and induction of Treg (Gao et al., 2016). In this study, MSCs isolated from BM samples of 5 horses showed stem cell phenotypic

ro

and functional characteristics, and inhibited constitutive and stimulated ROS production by

-p

equine PMN, without affecting other important PMN anti-microbicidal functions.

re

ROS production in the respiratory burst is a potent antimicrobial weapon, and a major

lP

component of the innate immune defense against bacterial and fungal infections. Activated PMN are highly effective at generating ROS almost exclusively by an NADPH oxidase belonging to the

ur na

family of NOX proteins. This leukocyte NADPH oxidase is a multi-subunit enzyme with membrane-bound and soluble components that assemble into a heteromeric complex when cells are stimulated. While some of the components of the NADPH are present at the plasma membrane at the time of phagocytosis, most are delivered through fusion with intracellular

Jo

vesicles (Lee et al., 2003). Previous studies have proven the modulatory potential of MSCs on important functions of PMN in other species, including ROS production, phagocytosis, and NETosis. These cellular functions are essential for the control of infectious diseases (DupreCrochet et al., 2013; Rebordao et al., 2014), but can be deleterious when dysregulated in other, immune-mediated conditions, such as neutrophilic asthma in the equine species (Robinson, 2001; Uberti and Moran, 2018). However, research on the immuno-modulatory capability of

MSC has yielded different results depending on species, the source of MSCs, and whether these were preconditioned or unstimulated. Raffaghelo et al (2008) demonstrated that both unstimulated and N-formyl-methionyl-leucyl-phenylalanine (f-MLP) stimulated PMN co-cultured with human BM-derived MSCs produced less ROS. These results are in agreement with the findings of this study, where PMNs co-cultured with MSCs produced less ROS in the absence of stimuli. One mechanism explaining this observation could be that direct cellular interactions

of

between MSCs and other cells allow mitochondrial transfer from the MSCs, effectively lowering cellular ROS production (Jiang et al., 2016a; Melcher et al., 2017). However, the same authors

ro

describe that co-incubation with MSCs supernatant can also significantly limit ROS production by

-p

the target cell, which suggests that mitochondrial transfer is not the sole mechanism involved in

re

the capacity of MSCs to modulate ROS production by other cell types (Melcher et al., 2017).

lP

In addition, equine PMN co-cultured with MSCs remain conditioned to produce fewer ROS after stimulation in comparison to PMN in single culture. This inhibition of ROS production helps

ur na

explain the observed increased lifespan of PMN co-cultured with MSCs, knowing that activation of NADPH oxidase and ROS is necessary for neutrophil necroptosis (Wang et al., 2018). Additionally, these results could be linked with the fact that MSCs have been shown to induce an increase of PMN lifespan due to their constitutive secretion of cytokines like IL-6 and GM-CSF,

Jo

which induce cytokine-driven rescue of neutrophils from apoptosis through rapid modulation of pro- and anti-apoptotic proteins (Moulding et al., 1998; Raffaghello et al., 2008). However, even if both cytokines are expressed by unstimulated human MSCs (Kogler et al., 2005), equine MSCs do have shown to not produce measurable amounts of IL-6 in the supernatant (Carrade et al., 2012). These discrepancies increase the importance of continuing to evaluate the secretome produced

by the MSCs, in order to complete the gap of knowledge and find other potential mediators that explains some of the effects of the equine MCSs.

These results also concur with Jiang et al (Jiang et al., 2016b), who described a strong inhibition of O2- production, dependent on the upregulation of SOD3 by the MSCs in response to high concentration of O2-. This would minimize production of peroxynitrite and hydroxyl radicals, and

of

potentially prevent tissue damage in vivo. However, it is unlikely that SOD3 is the only mechanism by which MSCs modulate the oxidative metabolism of PMN, because even though

ro

MSCs constitutively release SOD3, its upregulation only occurs 2 hours after stimulation (Jiang et

-p

al., 2016b).

re

Prostaglandin E2 (PGE2) is a well-known lipid mediator involved in the onset and resolution of

lP

every inflammatory process. It is synthetized by prostaglandin-endoperoxide synthase 2 (PTGS2), previously known as cyclooxygenase-2 (COX-2), and which historically has been

ur na

perceived as a pro-inflammatory enzyme, because its expression is increased by inflammatory stimuli, leading to the synthesis of a number of molecules that modulate inflammation and nociception (Woodward et al., 2007). While PGE2 is known to have pro-inflammatory properties, it has also been shown to have anti-inflammatory functions, such as inhibition of lymphocyte

Jo

proliferation, and promotion of macrophagic switch towards a pro-resolutive phenotype (Carrade et al., 2012; Nakanishi et al., 2011). Inhibition of PGE2 synthesis produces an impaired response against infections and limits bacterial clearance in the lung (Agard et al., 2013). On the other hand, PTGS2 blockade has been shown to worsen inflammation or delay its resolution, which could be relevant in deregulated inflammatory conditions (Blaho et al., 2008; Chan and Moore, 2010; Fukunaga et al., 2005). Equine MSCs constitutively express PTGS2 and secrete

measurable amounts of PGE2 (Levy et al., 2001; Yaneselli et al., 2019), particularly upon stimulation with inflammatory cytokines (Carrade et al., 2012). Since PGE2 has been shown to modulate neutrophil functions, such as ROS production, NET formation and chemotaxis (Armstrong, 1995; Kalmar and Gergely, 1983; Talpain et al., 1995), it could be involved in the effect of inhibition of ROS production seen in this work. In order to address the role of PGE2, one might suggest the use of pharmacological inhibitors other than nonsteroidal anti-inflammatory,

of

as these act as scavengers of ROS (Costa et al., 2006). To avoid this, the synthesis pathway of the PGE2 could be inhibited downstream, by using inhibitors of the microsomal prostaglandin E2

ro

synthase-1 (mPGES-1) which is the terminal enzyme in the biosynthesis of PGE2 (Hara et al.,

-p

2010).

re

Additionally, in the present work, the effect of unstimulated SN-MSCs on equine PMN resulted on

lP

a strong inhibition of ROS production upon stimulation with OZ. This effect could also be due to the accumulation of SOD3 in SN, even in the absence of stimulation (Jiang et al., 2016b). Despite

ur na

this, other modulatory molecules, such as Tumor necrosis factor-inducible gene 6 (TSG-6), could not be ruled out as potential regulators of the neutrophil respiratory burst. In fact, TSG-6 expressed by MSCs has been shown to modulate the inflammatory process in vitro and in vivo (Choi et al., 2011), inhibiting the arrival of PMN to damaged tissue by impairing IL-8 mediated

Jo

neutrophil chemotaxis (Dyer et al., 2014), and also strongly inhibiting NETs release in response to LPS.

PMN have other important microbicidal mechanisms besides ROS production, including production of antimicrobial peptides (e.g., defensins) and broadly acting proteases, NETs formation, and phagocytosis, all of which are important killing mechanisms against most

invading pathogens (Dale et al., 2008). The results presented here show that PMN phagocytosis was not affected by co-culture with SN-MSCs. However, other authors have demonstrated that PMN incubated with SN-MSCs showed a significant increase in the number of cells that engulfed E. coli, and this number increased further when the SN was obtained from MSCs stimulated with LPS (Brandau et al., 2014).

of

High ROS concentrations are responsible for the release and activation of neutrophil-derived proteases, and the formation of NETs with the expulsion of chromatin fibers from the nucleus of

ro

PMN is an additional strategy to effectively combat and kill invading microorganisms (Nishinaka

-p

et al., 2011; Remijsen et al., 2011). The putative role of NETs in host defense is exemplified by their conserved nature in various vertebrates (Chuammitri et al., 2009; Ermert et al., 2009; Palic

re

et al., 2007; Wardini et al., 2010) . While the initial observation of NETs formation placed the

lP

process within the context of innate immune responses to infections, recent evidence suggests that these structures also figure prominently at the center of various pathologic states

ur na

(Papayannopoulos, 2018). Interestingly, a recent study showed that SN from amniotic membrane MSCs (hAMSC) inhibited NETs release by murine PMN in a TSG-6 dependent manner (MaganaGuerrero et al., 2017). The same authors also show that SN partially inhibited ROS production, and that this inhibition is also dependent on the expression of TSG-6 by hAMSC. According to the

Jo

authors, this inhibition in O2- is produced by the loss in mitochondrial membrane potential, therefore causing a decrease in the amount of ATP and low ROS production capacity. These results contradict those obtained in our study, since SN-MSCs strongly inhibits PMN respiratory burst, their NETs-releasing ability was not impaired.

Conclusions

In conclusion, the results presented here suggest that equine BM-derived MSCs have a modulatory effect on PMN respiratory burst, without impairing other important microbicidal functions. This could support the use of therapies involving MSCs in immune-mediated pathologies, in which neutrophils have an important role without affecting their function to

of

protect against infections.

ro

Acknowledgements

-p

We thank Dr. Rafael Burgos for providing access to his lab and equipment. We also thank Dr.

re

Hugo Folch for his guidance and invaluable mentoring.

lP

Ethics approval and consent to participate

This study was approved by the Bioethics Committee for the Use of Animals in Biomedical

ur na

Research of Universidad Austral de Chile.

Consent for publication

Jo

Not applicable.

Competing interests The authors declare that they have no competing interests.

Availability of data and materials Data can be obtained by contacting the corresponding author.

Funding This study was supported by FONDECYT grant 11160418, Chilean Government. The author confirm that the funders had no role in the study design, data collection and analysis, decision to publish, preparation of the manuscript or selection of this journal.

of

Authors’ contributions GE and AS obtained and processed the biological samples, and performed the majority of the

ro

experimental procedures with neutrophils. PA: performed the NETosis experiments. GG: took

-p

part in the bone marrow sampling and isolation of the mesenchymal stem cells. AP: participated in the experimental design and performed MSCs isolation and characterization. BU helped to

re

draft the manuscript and data interpretation. GM helped to draft the manuscript and data

Jo

ur na

and processing.

lP

interpretation. CH conceived the study, participated in the design of the study, sample obtaining

References

Jo

ur na

lP

re

-p

ro

of

Agard, M., Asakrah, S., Morici, L.A., 2013. PGE(2) suppression of innate immunity during mucosal bacterial infection. Front Cell Infect Microbiol 3, 45. Alarcon, P., Manosalva, C., Conejeros, I., Carretta, M.D., Munoz-Caro, T., Silva, L.M.R., Taubert, A., Hermosilla, C., Hidalgo, M.A., Burgos, R.A., 2017. d(-) Lactic Acid-Induced Adhesion of Bovine Neutrophils onto Endothelial Cells Is Dependent on Neutrophils Extracellular Traps Formation and CD11b Expression. Front Immunol 8, 975. Anderson, S.L., Singh, B., 2018. Equine neutrophils and their role in ischemia reperfusion injury and lung inflammation. Cell Tissue Res 371, 639-648. Armstrong, R.A., 1995. Investigation of the inhibitory effects of PGE2 and selective EP agonists on chemotaxis of human neutrophils. Br J Pharmacol 116, 2903-2908. Ball, A.N., Phillips, J.N., McIlwraith, C.W., Kawcak, C.E., Samulski, R.J., Goodrich, L.R., 2018. Genetic modification of scAAV-equine-BMP-2 transduced bone-marrow-derived mesenchymal stem cells before and after cryopreservation: an "off-the-shelf" option for fracture repair. J Orthop Res. Barberini, D.J., Freitas, N.P., Magnoni, M.S., Maia, L., Listoni, A.J., Heckler, M.C., Sudano, M.J., Golim, M.A., da Cruz Landim-Alvarenga, F., Amorim, R.M., 2014. Equine mesenchymal stem cells from bone marrow, adipose tissue and umbilical cord: immunophenotypic characterization and differentiation potential. Stem Cell Res Ther 5, 25. Blaho, V.A., Mitchell, W.J., Brown, C.R., 2008. Arthritis develops but fails to resolve during inhibition of cyclooxygenase 2 in a murine model of Lyme disease. Arthritis Rheum 58, 1485-1495. Blair, P.A., Norena, L.Y., Flores-Borja, F., Rawlings, D.J., Isenberg, D.A., Ehrenstein, M.R., Mauri, C., 2010. CD19(+)CD24(hi)CD38(hi) B cells exhibit regulatory capacity in healthy individuals but are functionally impaired in systemic Lupus Erythematosus patients. Immunity 32, 129-140. Bogers, S.H., 2018. Cell-Based Therapies for Joint Disease in Veterinary Medicine: What We Have Learned and What We Need to Know. Front Vet Sci 5, 70. Brandau, S., Jakob, M., Bruderek, K., Bootz, F., Giebel, B., Radtke, S., Mauel, K., Jager, M., Flohe, S.B., Lang, S., 2014. Mesenchymal stem cells augment the anti-bacterial activity of neutrophil granulocytes. PLoS One 9, e106903. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., Weiss, D.S., Weinrauch, Y., Zychlinsky, A., 2004. Neutrophil extracellular traps kill bacteria. Science 303, 1532-1535. Bullone, M., Lavoie, J.P., 2017. The Contribution of Oxidative Stress and Inflamm-Aging in Human and Equine Asthma. Int J Mol Sci 18. Caplan, A.I., Sorrell, J.M., 2015. The MSC curtain that stops the immune system. Immunol Lett 168, 136-139. Carrade, D.D., Lame, M.W., Kent, M.S., Clark, K.C., Walker, N.J., Borjesson, D.L., 2012. Comparative Analysis of the Immunomodulatory Properties of Equine Adult-Derived Mesenchymal Stem Cells(). Cell Med 4, 1-11. Cassano, J.M., Schnabel, L.V., Goodale, M.B., Fortier, L.A., 2018. Inflammatory licensed equine MSCs are chondroprotective and exhibit enhanced immunomodulation in an inflammatory environment. Stem Cell Res Ther 9, 82. Chan, M.M., Moore, A.R., 2010. Resolution of inflammation in murine autoimmune arthritis is disrupted by cyclooxygenase-2 inhibition and restored by prostaglandin E2-mediated lipoxin A4 production. J Immunol 184, 6418-6426.

Jo

ur na

lP

re

-p

ro

of

Choi, H., Lee, R.H., Bazhanov, N., Oh, J.Y., Prockop, D.J., 2011. Anti-inflammatory protein TSG-6 secreted by activated MSCs attenuates zymosan-induced mouse peritonitis by decreasing TLR2/NF-kappaB signaling in resident macrophages. Blood 118, 330-338. Chuammitri, P., Ostojic, J., Andreasen, C.B., Redmond, S.B., Lamont, S.J., Palic, D., 2009. Chicken heterophil extracellular traps (HETs): novel defense mechanism of chicken heterophils. Vet Immunol Immunopathol 129, 126-131. Costa, D., Moutinho, L., Lima, J.L., Fernandes, E., 2006. Antioxidant activity and inhibition of human neutrophil oxidative burst mediated by arylpropionic acid non-steroidal antiinflammatory drugs. Biol Pharm Bull 29, 1659-1670. da Silva Meirelles, L., Chagastelles, P.C., Nardi, N.B., 2006. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 119, 2204-2213. Dabrowska, D., Jablonska, E., Garley, M., Ratajczak-Wrona, W., Iwaniuk, A., 2016. New Aspects of the Biology of Neutrophil Extracellular Traps. Scand J Immunol 84, 317-322. Dale, D.C., Boxer, L., Liles, W.C., 2008. The phagocytes: neutrophils and monocytes. Blood 112, 935-945. Dupre-Crochet, S., Erard, M., Nubetae, O., 2013. ROS production in phagocytes: why, when, and where? J Leukoc Biol 94, 657-670. Dyer, D.P., Thomson, J.M., Hermant, A., Jowitt, T.A., Handel, T.M., Proudfoot, A.E., Day, A.J., Milner, C.M., 2014. TSG-6 inhibits neutrophil migration via direct interaction with the chemokine CXCL8. J Immunol 192, 2177-2185. English, K., Barry, F.P., Mahon, B.P., 2008. Murine mesenchymal stem cells suppress dendritic cell migration, maturation and antigen presentation. Immunol Lett 115, 50-58. Ermert, D., Urban, C.F., Laube, B., Goosmann, C., Zychlinsky, A., Brinkmann, V., 2009. Mouse neutrophil extracellular traps in microbial infections. J Innate Immun 1, 181-193. Fontaine, M.J., Shih, H., Schafer, R., Pittenger, M.F., 2016. Unraveling the Mesenchymal Stromal Cells' Paracrine Immunomodulatory Effects. Transfus Med Rev 30, 37-43. Francois, M., Romieu-Mourez, R., Li, M., Galipeau, J., 2012. Human MSC suppression correlates with cytokine induction of indoleamine 2,3-dioxygenase and bystander M2 macrophage differentiation. Mol Ther 20, 187-195. Friedenstein, A.J., Piatetzky, S., II, Petrakova, K.V., 1966. Osteogenesis in transplants of bone marrow cells. J Embryol Exp Morphol 16, 381-390. Fukunaga, K., Kohli, P., Bonnans, C., Fredenburgh, L.E., Levy, B.D., 2005. Cyclooxygenase 2 plays a pivotal role in the resolution of acute lung injury. J Immunol 174, 5033-5039. Gao, F., Chiu, S.M., Motan, D.A., Zhang, Z., Chen, L., Ji, H.L., Tse, H.F., Fu, Q.L., Lian, Q., 2016. Mesenchymal stem cells and immunomodulation: current status and future prospects. Cell Death Dis 7, e2062. Gupta, N., Su, X., Popov, B., Lee, J.W., Serikov, V., Matthay, M.A., 2007. Intrapulmonary delivery of bone marrow-derived mesenchymal stem cells improves survival and attenuates endotoxin-induced acute lung injury in mice. J Immunol 179, 1855-1863. Hara, S., Kamei, D., Sasaki, Y., Tanemoto, A., Nakatani, Y., Murakami, M., 2010. Prostaglandin E synthases: Understanding their pathophysiological roles through mouse genetic models. Biochimie 92, 651-659. Henriquez, C., Perez, B., Morales, N., Sarmiento, J., Carrasco, C., Moran, G., Folch, H., 2014. Participation of T regulatory cells in equine recurrent airway obstruction. Vet Immunol Immunopathol 158, 128-134. Jiang, D., Gao, F., Zhang, Y., Wong, D.S., Li, Q., Tse, H.F., Xu, G., Yu, Z., Lian, Q., 2016a. Mitochondrial transfer of mesenchymal stem cells effectively protects corneal epithelial cells from mitochondrial damage. Cell Death Dis 7, e2467.

Jo

ur na

lP

re

-p

ro

of

Jiang, D., Muschhammer, J., Qi, Y., Kugler, A., de Vries, J.C., Saffarzadeh, M., Sindrilaru, A., Beken, S.V., Wlaschek, M., Kluth, M.A., Ganss, C., Frank, N.Y., Frank, M.H., Preissner, K.T., Scharffetter-Kochanek, K., 2016b. Suppression of Neutrophil-Mediated Tissue Damage-A Novel Skill of Mesenchymal Stem Cells. Stem Cells 34, 2393-2406. Kadle, R.L., Abdou, S.A., Villarreal-Ponce, A.P., Soares, M.A., Sultan, D.L., David, J.A., Massie, J., Rifkin, W.J., Rabbani, P., Ceradini, D.J., 2018. Microenvironmental cues enhance mesenchymal stem cell-mediated immunomodulation and regulatory T-cell expansion. PLoS One 13, e0193178. Kalmar, L., Gergely, P., 1983. Effect of prostaglandins on polymorphonuclear leukocyte motility. Immunopharmacology 6, 167-175. Kasashima, Y., Ueno, T., Tomita, A., Goodship, A.E., Smith, R.K., 2011. Optimisation of bone marrow aspiration from the equine sternum for the safe recovery of mesenchymal stem cells. Equine Vet J 43, 288-294. Katila, T., 2012. Post-mating inflammatory responses of the uterus. Reprod Domest Anim 47 Suppl 5, 31-41. Kogler, G., Radke, T.F., Lefort, A., Sensken, S., Fischer, J., Sorg, R.V., Wernet, P., 2005. Cytokine production and hematopoiesis supporting activity of cord blood-derived unrestricted somatic stem cells. Exp Hematol 33, 573-583. Lee, H.J., Kim, S.N., Jeon, M.S., Yi, T., Song, S.U., 2017. ICOSL expression in human bone marrowderived mesenchymal stem cells promotes induction of regulatory T cells. Sci Rep 7, 44486. Lee, W.L., Harrison, R.E., Grinstein, S., 2003. Phagocytosis by neutrophils. Microbes Infect 5, 12991306. Leise, B., 2018. The role of neutrophils in equine laminitis. Cell Tissue Res 371, 541-550. Levy, B.D., Clish, C.B., Schmidt, B., Gronert, K., Serhan, C.N., 2001. Lipid mediator class switching during acute inflammation: signals in resolution. Nat Immunol 2, 612-619. Li, N., Hua, J., 2017. Interactions between mesenchymal stem cells and the immune system. Cell Mol Life Sci 74, 2345-2360. Ling, W., Zhang, J., Yuan, Z., Ren, G., Zhang, L., Chen, X., Rabson, A.B., Roberts, A.I., Wang, Y., Shi, Y., 2014. Mesenchymal stem cells use IDO to regulate immunity in tumor microenvironment. Cancer Res 74, 1576-1587. Lo Monaco, M., Merckx, G., Ratajczak, J., Gervois, P., Hilkens, P., Clegg, P., Bronckaers, A., Vandeweerd, J.M., Lambrichts, I., 2018. Stem Cells for Cartilage Repair: Preclinical Studies and Insights in Translational Animal Models and Outcome Measures. Stem Cells Int 2018, 9079538. Luk, F., Carreras-Planella, L., Korevaar, S.S., de Witte, S.F.H., Borras, F.E., Betjes, M.G.H., Baan, C.C., Hoogduijn, M.J., Franquesa, M., 2017. Inflammatory Conditions Dictate the Effect of Mesenchymal Stem or Stromal Cells on B Cell Function. Front Immunol 8, 1042. Magana-Guerrero, F.S., Dominguez-Lopez, A., Martinez-Aboytes, P., Buentello-Volante, B., Garfias, Y., 2017. Human Amniotic Membrane Mesenchymal Stem Cells inhibit Neutrophil Extracellular Traps through TSG-6. Sci Rep 7, 12426. Melcher, M., Danhauser, K., Seibt, A., Degistirici, O., Baertling, F., Kondadi, A.K., Reichert, A.S., Koopman, W.J.H., Willems, P., Rodenburg, R.J., Mayatepek, E., Meisel, R., Distelmaier, F., 2017. Modulation of oxidative phosphorylation and redox homeostasis in mitochondrial NDUFS4 deficiency via mesenchymal stem cells. Stem Cell Res Ther 8, 150. Mittal, S.K., Mashaghi, A., Amouzegar, A., Li, M., Foulsham, W., Sahu, S.K., Chauhan, S.K., 2018. Mesenchymal Stromal Cells Inhibit Neutrophil Effector Functions in a Murine Model of Ocular Inflammation. Invest Ophthalmol Vis Sci 59, 1191-1198.

Jo

ur na

lP

re

-p

ro

of

Moulding, D.A., Quayle, J.A., Hart, C.A., Edwards, S.W., 1998. Mcl-1 expression in human neutrophils: regulation by cytokines and correlation with cell survival. Blood 92, 24952502. Muttini, A., Salini, V., Valbonetti, L., Abate, M., 2012. Stem cell therapy of tendinopathies: suggestions from veterinary medicine. Muscles Ligaments Tendons J 2, 187-192. Najar, M., Raicevic, G., Fayyad-Kazan, H., Bron, D., Toungouz, M., Lagneaux, L., 2016. Mesenchymal stromal cells and immunomodulation: A gathering of regulatory immune cells. Cytotherapy 18, 160-171. Nakanishi, Y., Nakatsuji, M., Seno, H., Ishizu, S., Akitake-Kawano, R., Kanda, K., Ueo, T., Komekado, H., Kawada, M., Minami, M., Chiba, T., 2011. COX-2 inhibition alters the phenotype of tumor-associated macrophages from M2 to M1 in ApcMin/+ mouse polyps. Carcinogenesis 32, 1333-1339. Nemeth, K., Leelahavanichkul, A., Yuen, P.S., Mayer, B., Parmelee, A., Doi, K., Robey, P.G., Leelahavanichkul, K., Koller, B.H., Brown, J.M., Hu, X., Jelinek, I., Star, R.A., Mezey, E., 2009. Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)-dependent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med 15, 42-49. Nishinaka, Y., Arai, T., Adachi, S., Takaori-Kondo, A., Yamashita, K., 2011. Singlet oxygen is essential for neutrophil extracellular trap formation. Biochem Biophys Res Commun 413, 75-79. O'Neill, S., Brault, J., Stasia, M.J., Knaus, U.G., 2015. Genetic disorders coupled to ROS deficiency. Redox Biol 6, 135-156. Palic, D., Ostojic, J., Andreasen, C.B., Roth, J.A., 2007. Fish cast NETs: neutrophil extracellular traps are released from fish neutrophils. Dev Comp Immunol 31, 805-816. Papayannopoulos, V., 2018. Neutrophil extracellular traps in immunity and disease. Nat Rev Immunol 18, 134-147. Peroni, J.F., Borjesson, D.L., 2011. Anti-inflammatory and immunomodulatory activities of stem cells. Vet Clin North Am Equine Pract 27, 351-362. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., Marshak, D.R., 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284, 143-147. Quah, B.J., Parish, C.R., 2010. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. Raffaghello, L., Bianchi, G., Bertolotto, M., Montecucco, F., Busca, A., Dallegri, F., Ottonello, L., Pistoia, V., 2008. Human mesenchymal stem cells inhibit neutrophil apoptosis: a model for neutrophil preservation in the bone marrow niche. Stem Cells 26, 151-162. Rebordao, M.R., Carneiro, C., Alexandre-Pires, G., Brito, P., Pereira, C., Nunes, T., Galvao, A., Leitao, A., Vilela, C., Ferreira-Dias, G., 2014. Neutrophil extracellular traps formation by bacteria causing endometritis in the mare. J Reprod Immunol 106, 41-49. Remacha, A.R., Barrachina, L., Alvarez-Arguedas, S., Ranera, B., Romero, A., Vazquez, F.J., Zaragoza, P., Yanez, R., Martin-Burriel, I., Rodellar, C., 2015. Expression of genes involved in immune response and in vitro immunosuppressive effect of equine MSCs. Vet Immunol Immunopathol 165, 107-118. Remijsen, Q., Vanden Berghe, T., Wirawan, E., Asselbergh, B., Parthoens, E., De Rycke, R., Noppen, S., Delforge, M., Willems, J., Vandenabeele, P., 2011. Neutrophil extracellular trap cell death requires both autophagy and superoxide generation. Cell Res 21, 290-304. Robinson, N.E., 2001. International Workshop on Equine Chronic Airway Disease. Michigan State University 16-18 June 2000. Equine Vet J 33, 5-19.

Jo

ur na

lP

re

-p

ro

of

Shi, Y., Wang, Y., Li, Q., Liu, K., Hou, J., Shao, C., Wang, Y., 2018. Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases. Nat Rev Nephrol 14, 493507. Siemsen, D.W., Schepetkin, I.A., Kirpotina, L.N., Lei, B., Quinn, M.T., 2007. Neutrophil isolation from nonhuman species. Methods Mol Biol 412, 21-34. Su, J., Chen, X., Huang, Y., Li, W., Li, J., Cao, K., Cao, G., Zhang, L., Li, F., Roberts, A.I., Kang, H., Yu, P., Ren, G., Ji, W., Wang, Y., Shi, Y., 2014. Phylogenetic distinction of iNOS and IDO function in mesenchymal stem cell-mediated immunosuppression in mammalian species. Cell Death Differ 21, 388-396. Talpain, E., Armstrong, R.A., Coleman, R.A., Vardey, C.J., 1995. Characterization of the PGE receptor subtype mediating inhibition of superoxide production in human neutrophils. Br J Pharmacol 114, 1459-1465. Trachootham, D., Lu, W., Ogasawara, M.A., Nilsa, R.D., Huang, P., 2008. Redox regulation of cell survival. Antioxid Redox Signal 10, 1343-1374. Traggiai, E., Volpi, S., Schena, F., Gattorno, M., Ferlito, F., Moretta, L., Martini, A., 2008. Bone marrow-derived mesenchymal stem cells induce both polyclonal expansion and differentiation of B cells isolated from healthy donors and systemic lupus erythematosus patients. Stem Cells 26, 562-569. Troedsson, M.H., Loset, K., Alghamdi, A.M., Dahms, B., Crabo, B.G., 2001. Interaction between equine semen and the endometrium: the inflammatory response to semen. Anim Reprod Sci 68, 273-278. Uberti, B., Moran, G., 2018. Role of neutrophils in equine asthma. Anim Health Res Rev 19, 65-73. Wang, X., Yousefi, S., Simon, H.U., 2018. Necroptosis and neutrophil-associated disorders. Cell Death Dis 9, 111. Wardini, A.B., Guimaraes-Costa, A.B., Nascimento, M.T., Nadaes, N.R., Danelli, M.G., Mazur, C., Benjamim, C.F., Saraiva, E.M., Pinto-da-Silva, L.H., 2010. Characterization of neutrophil extracellular traps in cats naturally infected with feline leukemia virus. J Gen Virol 91, 259-264. Witko-Sarsat, V., Rieu, P., Descamps-Latscha, B., Lesavre, P., Halbwachs-Mecarelli, L., 2000. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 80, 617-653. Woodward, D.F., Krauss, A.H., Wang, J.W., Protzman, C.E., Nieves, A.L., Liang, Y., Donde, Y., Burk, R.M., Landsverk, K., Struble, C., 2007. Identification of an antagonist that selectively blocks the activity of prostamides (prostaglandin-ethanolamides) in the feline iris. Br J Pharmacol 150, 342-352. Yaneselli, K., Barrachina, L., Remacha, A.R., Algorta, A., Vitoria, A., Cequier, A., Romero, A., Vazquez, F.J., Maisonnave, J., Rodellar, C., 2019. Effect of allogeneic platelet lysate on equine bone marrow derived mesenchymal stem cell characteristics, including immunogenic and immunomodulatory gene expression profile. Vet Immunol Immunopathol 217, 109944.

of ro -p re lP ur na

Figure 1. Characterization of isolated bone marrow-derived mesenchymal stromal cells (MSCs). (a)Representative example of trilinear differentiation of isolated bone marrow-derived MSCs,

Jo

showing the osteogenic (upper left panel), chondrogenic (upper middle panel) and adipogenic (upper right panel) lineages. (b) Representative gel of the isolated subpopulations, indicating the expression of MSCs markers CD44, CD90, and CD105; hematopoietic marker CD45 expression was absent in MSCs. PBMC cDNA was used as a control of CD45 expression. (c) Functional assay showing the inhibitory effect of MSCs on PBMC proliferation when were co-cultured in a 16 to 1

ratio (PBMC:MSCs). Proliferation was induced by incubation with 5 µg/mL de concanavalin A

Jo

ur na

lP

re

-p

ro

of

(ConA) and determined by CFSE dilution (*p<0.05; n=6).

Figure 2. Co-culture between neutrophils (PMN) and bone marrow-derived equine mesenchymal stromal cells (MSCs) inhibits PMN intracellular ROS production. (a) Intracellular ROS production by PMN in single culture or in co-culture with MSCs of each donor during 1 h in a 10:1 ratio,

measured by Dihydroethidium (DHE) fluorescence. (b) ROS production by PMN in single culture or in co-culture with MSCs during 1 h in a 10:1 ratio, after stimulation with 100 ng/mL of PMA. (c) Viability of PMN in single culture or co-cultured with MSCs of each donor in a 10:1 ratio

lP

re

-p

ro

of

during 24 h (*p<0.05; **p<0.01; n=6).

ur na

Figure 3. Bone marrow-derived equine mesenchymal stromal cells (MSCs) modulate respiratory burst by PMN induced with opsonized zymosan (OZ). Representative image of chemiluminescence determination produced by luminol (L) oxidation due to respiratory burst by PMN incubated during 1 h with RPMI-1640 or different concentrations of MSCs supernatant (SN-

Jo

MSC) pool and stimulated with OZ (1 mg/mL) (left panel). The area under the curve (AUC) of each experiment were determined and the raw data plotted and compared between the PMN incubated during 1 h with RPMI-1640 or different concentrations of the SN-MSC pool (middle panel). Additionally, each experiment data was normalized according to the respective control (100%) and plotted in order to compare between each condition (right panel). CPS= Counts per second. (*p<0.05; **p<0.01; ***p<0.001; n=6).

of ro -p re lP

ur na

Figure 4. Bone marrow-derived equine mesenchymal stromal cells supernatant (SN-MSC) does not affect phagocytosis or neutrophil extracellular trap (NETs) formation. (a) Flow cytometry gating strategy for PMN selection and E. coli bioparticles uptake determination (upper left panels). Effect of different concentrations of the SN-MSC pool on phagocytic index (upper right

Jo

panel) (n= 6). (b) A representative fluorescence microscopy image of NETs release induced with 1 mg/mL of opsonized zymosan (OZ), showing a comparison between equine PMN incubated during 1 h with RPMI-1640 or SN-MSC pool (upper left and right panel respectively). Effect of SNMSC on NETosis by equine PMN induced with OZ (lower panel) (n=4).

of

ro

-p

re

lP

ur na

Jo