Establishment and characterization of an epithelial cell line from thymus of Catla catla (Hamilton, 1822)

Establishment and characterization of an epithelial cell line from thymus of Catla catla (Hamilton, 1822)

Gene 512 (2013) 546–553 Contents lists available at SciVerse ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Short Communication ...

2MB Sizes 3 Downloads 45 Views

Gene 512 (2013) 546–553

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Short Communication

Establishment and characterization of an epithelial cell line from thymus of Catla catla (Hamilton, 1822) Dharmendra K. Chaudhary a, Neeraj Sood a,⁎, T. Raja Swaminathan a, Gaurav Rathore a, P.K. Pradhan a, N.K. Agarwal b, J.K. Jena a a b

National Bureau of Fish Genetic Resources, Canal Ring Road, P.O. Dilkusha, Lucknow-226 002, Uttar Pradesh, India Department of Zoology, H.N.B. Garhwal University (Campus), Badshaithaul, Tehri Garhwal, Uttarakhand, India

a r t i c l e

i n f o

Article history: Accepted 12 September 2012 Available online 28 September 2012 Keywords: Catla catla Cell line Karyotype Immunocytochemistry Thymus Transfection

a b s t r a c t A cell line, CTE, derived from catla (Catla catla) thymus has been established by explant method and subcultured for more than 70 passages over a period of 400 days. The cell line has been maintained in L-15 (Leibovitz) medium supplemented with 10% fetal bovine serum. CTE cell line consists of homogeneous population of epithelial-like cells and grows optimally at 28 °C. Karyotype analysis revealed that the modal chromosome number of CTE cells was 50. Partial amplification, sequencing and alignment of fragments of two mitochondrial genes 16S rRNA and COI confirmed that CTE cell line originated from catla. Significant green fluorescent signals were observed when the cell line was transfected with phrGFP II-N mammalian expression vector, indicating its potential utility for transgenic and genetic manipulation studies. The CTE cells showed strong positivity for cytokeratin, indicating that cell line was epithelial in nature. The flow cytometric analysis of cell line revealed a higher number of cells in S-phase at 48 h, suggesting a high growth rate. The extracellular products of Vibrio cholerae MTCC 3904 were toxic to the CTE cells. This cell line was not susceptible to fish betanodavirus, the causative agent of viral nervous necrosis in a large variety of marine fish. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The thymus is a paired lymphoid organ, situated in the dorsolateral region of the gill chamber in teleosts. It is the primary site for the development and maturation of T lymphocytes. Thymic parenchyma consists of leukocytic cells called thymocytes, majority of which belong to T lymphoid lineage, and various stromal cells including thymic epithelial cells (TEC) (Le Douarin and Jotereau, 1975). The stromal cells provide signals to support diverse processes of thymocytes development that are essential for the supply of circulating T cells (Williams et al., 1986). In response to these signals, developing thymocytes undergo proliferation, differentiation, and relocation to generate mature T cells that carry a diverse yet self-tolerant repertoire of T cell antigen receptors (Scollay et al., 1988; von Boehmer, 1988). Thymic stromal cells are composed of TEC, macrophages, interdigitating/dendritic cells, myoid cells and also other cell types in fewer numbers (Zapata et al., 1996). There are reports that fish thymus has heterogeneous populations of epithelial cells (Castillo Abbreviations: CTE cell line, catla thymus epithelial cell line; CPE, cytopathic effect; ECPs, extracellular products; MTCC, microbial type culture collection; TEC, thymic epithelial cells. ⁎ Corresponding author. Tel.: +91 5222442441; fax: +91 5222442403. E-mail addresses: [email protected] (D.K. Chaudhary), [email protected] (N. Sood), [email protected] (T.R. Swaminathan), [email protected] (G. Rathore), [email protected] (P.K. Pradhan), [email protected] (N.K. Agarwal), [email protected] (J.K. Jena). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.09.081

et al., 1991; Pulsford et al., 1991; Zapata et al., 1996). These TEC are believed to provide epigenetic influences to developing thymocytes, presumably through production of cytokines, and direct cell to cell and extracellular matrix-mediated interaction. Therefore, the thymic cell lines particularly of epithelial origin can be critical to evaluate the role of these cells in the induction and/or regulation of thymocyte differentiation and maturation. In addition, the cell lines are useful tools in virological, immunological, toxicological and nutritional studies. There are reports of development of epithelial cell lines from thymus in humans (Fernandez et al., 1994; Hibi et al., 1991), rats (Itoh, 1979; Masuda et al., 1990) and mice (Colic et al., 1991; Itoh et al., 2001; Mizuochi et al., 1992). In teleosts, the thymic cell lines have only been developed in common carp (KoT) and ginbuna carp (GTS6 and GTS9) and these consist of fibroblast-like cells (Katakura et al., 2009). Till date, there is no report of development of epithelial cell lines from thymus of teleosts to the best of our knowledge. Catla catla is an important Indian major carp endemic to the riverine system in northern India, Indus plain and adjoining hills of Pakistan, Bangladesh, Nepal and Myanmar. Catla, commonly known as Bhakur, is used as the surface feeder component in Indian major carp polyculture systems. The production of catla has been increasing in India and in 2010, catla contributed about 88.3% of total IMC production in the country and approximately 93% of world catla production in terms of quantity (3598348 t) and value (6.69 billion US $) (FAO, 2012). A few cell lines have been developed from eye tissue, heart, brain and blood mononuclear cells of catla (Chaudhary et al.,

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

2012; Ishaq Ahmed et al., 2008, 2009a,b). Here we report the development of a cell line from catla thymus, designated catla thymus epithelial cell line (CTE). 2. Materials and methods 2.1. Preparation of tissue for primary cell culture Catla catla were procured from a fish farm and acclimatized in FRP tanks for 1 week. An apparently healthy catla weighing 800 g was euthanized with an overdose of MS222 (Sigma-Aldrich, St. Louis, USA) and thymi were aseptically removed. The tissues were washed twice with phosphate buffer saline (PBS) containing 2× concentration of antibiotic–antimycotic solution (Invitrogen, Carlsbad, USA) and transferred to a petri dish containing L-15 medium supplemented with 20% fetal bovine serum (FBS) and 1× concentration of antibiotic–antimycotic solution. The tissues were cut into small pieces (approximately 1 mm3) with the help of sterile scissors and transferred to a 25 cm2 flask and incubated overnight at 28 °C. The tissues adhered to the surface of the flask. About 50% of the medium was replaced every 4th day. After formation of monolayer, the cells were trypsinized with trypsin–EDTA solution (Invitrogen) and subcultured at a split ratio of 1:2 in L-15 medium. The concentration of FBS in medium was gradually reduced from 20 to 10% between 10th and 15th subculture. The subcultures were stored in the liquid nitrogen after every 10th passage in the freezing medium, which consisted of L-15 supplemented with 20% FBS and 10% dimethyl sulphoxide. For revival, cryovial was thawed quickly in water bath at 28 °C and transferred to a 25 cm2 tissue culture flask. About 10 ml of L-15 medium was added to the flask. The viability of the revived cells was estimated by trypan blue staining using a Neubarr hemocytometer. After overnight incubation, the medium in the flasks was replaced with fresh medium. 2.2. Effect of temperature and FBS concentration on cell growth Growth studies were carried out to determine the optimum temperature and FBS concentration for CTE cell line. A total of 1 × 10 5 cells ml −1 at passage 25 were inoculated into 25 cm 2 cell culture flasks and incubated at 28 °C for 2 h for attachment of cells. Afterwards, the batches of culture flasks were incubated at selected temperatures of 24, 28, 32 and 37 °C for growth studies. The study was performed using L-15 medium supplemented with 20% FBS. Every day, three flasks at each temperature were trypsinized to measure cell density. The study was carried out for 5 days. A similar study was carried out to study the effect of different concentrations of FBS (5, 10, 15 and 20%) on cell growth with passage 27 cells at 28 °C. 2.3. Plating efficiency (PE) The plating efficiency of CTE cell line was determined at passage 45. Tissue culture flasks (25 cm 2) were seeded with CTE cells at density of 100, 500 and 1,000 cells flask –1 and cultured in L-15 medium at 28 °C. Half of the medium was replaced every 4th day. After 10 days, the medium was discarded and cells were washed with PBS. Thereafter, the cells were fixed with methanol and stained with crystal violet. The individual colonies were counted under the microscope, and plating efficiency was calculated using the following formula: PE (%) = number of cell colonies/number of cells seeded × 100 (Freshney, 2005). 2.4. Chromosomal analysis Standard procedure was followed for preparing the karyotype (Freshney, 2005). Briefly, the cells at 35th passage were incubated in a 25 cm 2 tissue culture flask until 70–80% confluency was attained. Colchicine solution (Invitrogen) was added to the cells at a final

547

concentration of 0.2 μg ml −1. The cells were incubated for 2 h at 28 °C. After gentle pipetting, detached cells were collected by centrifugation at 200g for 5 min at 4 °C and treated with a hypotonic solution of 0.56% potassium chloride for 20 min. Thereafter, the cells were fixed in acetic acid:methanol solution (1:3) for 5 min at room temperature. Slides were prepared using a conventional drop technique and stained with 5% Giemsa solution. Chromosomes were observed and counted under a light microscope. 2.5. PCR for confirmation of origin of cell line The origin of the CTE cell line was authenticated by partial amplification and sequencing of 16S rRNA and COI genes from CTE cells following Swaminathan et al. (2012). Briefly, DNA was isolated from 5 × 10 6 CTE cells at passage 42 and fragments of the two genes were amplified by PCR using the published primers (Table 1). The thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 30 cycles of 95 °C for 45 s (s), annealing temperature of 50 °C for 30 s, 72 °C for 45 s and a final extension of 5 min at 72 °C. The amplified PCR products were sequenced in Applied Biosystems ABI 3730xl capillary sequencer through a commercial sequencing facility. The DNA sequences were aligned against known sequences from the National Center for Biotechnology Information (NCBI) database. DNA from muscle of C. catla was used as positive control for PCR amplification and sequencing of the above two mitochondrial genes. 2.6. Transfection The CTE cell line at the 66th passage was propagated in a 6-well plate at a density of 1 × 10 5 cells well −1 for attachment the cells. After 24 h, the sub-confluent monolayers were transfected with 2 μg of phrGFP II-N mammalian expression vector (Stratagene, La Jolla, California) using SatisFection transfection reagent (Stratagene), and the green fluorescence signals were observed under a fluorescent microscope 48 h after transfection (Qin et al., 2006). 2.7. Antibodies and immunofluorescence Immunophenotyping of CTE cell line was carried out as per Mauger et al. (2009). Briefly, CTE cells were grown on sterile cover slips for 24 h. The cells were subsequently fixed and permeabilized with methanol at −20 °C for 30 min. For immunostaining, the cover slips were pre-incubated with PBS containing 1% BSA for 1 h at 37 °C, and then incubated overnight at 4 °C with mouse anticytokeratin (pan), clone AE1/AE3 antibodies (Invitrogen) or mouse anti-vimentin antibodies (Invitrogen). In control cover slips, only PBS with 1% BSA was used in place of primary antibodies. After PBS washing, cells were incubated for 1 h with rabbit anti-mouse IgG FITC conjugate (diluted 1:50 in PBS containing 1% BSA). The cover slips were washed again in PBS, mounted in VECTASHIED mounting medium (Vector Laboratories, Burlingame, CA) and observed under fluorescent microscope. 2.8. Cell cycle analysis Flow cytometric analysis of CTE cells was carried out twice at intervals of 24 h with a plating cell count of 1 × 10 5 ml −1 in 25 cm 2 flask, following Ishaq Ahmed et al. (2009a). Briefly, the cells were trypsinized at passage 52 and washed twice with cold PBS. The cell pellets were suspended in 1 ml of ice-cold ethanol for 1 h at 4 °C and centrifuged at 250g for 5 min. The pellets were again washed twice with cold PBS and resuspended in 100 μl RNase (5 mg ml−1) for 30 min at 37 °C. Thereafter, 300 μl propidium iodide (50 μg ml−1) was added and the mixture was incubated on ice for 1 h. Finally, the cells were analyzed on flow cytometer FACS CALIBER (Becton Dickinson).

548

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

Table 1 List of mtDNA primers. Sl. Primers no. 1

COI

2

16S rDNA

F R L H

Sequence (5′–3′)

No. of bases

Reference

TCAACCAACCACAAAGACATTGGCAC TAGACTTCTGGGTGGCCAAAGAATCA CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT

26 26 20 22

Ward et al. (2005) Palumbi let al. (1991)

2.9. Cytotoxicity test of bacterial extracellular products The cytotoxicity of bacterial extracellular products (ECPs) from Vibrio cholerae MTCC 3904 was tested with CTE cells. The ECPs from V. cholerae were prepared according to the protocol described by Balebona et al. (1998). Briefly, 0.5 ml of a 24 h old broth culture of V. cholerae was spread on sterile cellophane sheet, overlaying brain heart infusion agar plate and incubated at 37 °C for 48 h. Bacterial cells were harvested from cellophane sheet with PBS. The cell suspension was centrifuged at l3,000g for 20 min. The supernatant was filtered through a 0.22 μm membrane filter (Millipore, Billerica, MA) and used as crude extracellular product preparations. The CTE cells were grown as a monolayer in 24 well plate using L-15 medium and inoculated with 0.1 ml serial dilutions of crude ECPs. For negative controls, sterile saline was used in place of ECPs. Plates were incubated at 28 °C and the effects of ECPs on the cells were observed up to 72 h. 2.10. Viral susceptibility and cytopathic effect (CPE) The viral susceptibility of the cell line was tested with betanodavirus (the only finfish virus reported from India) causing viral nervous necrosis in Asian seabass, Lates calcarifer. The larvae of Asian sea bass were collected from Nagapattinam, Tamil Nadu and were screened by RT PCR for the presence of betanodavirus following Nishizawa et al.

(1994). The two primers, a forward primer 5′-CGTGTCAGTCATGT GTCGCT-3′ and a reverse primer 5′-CGAGTCAACACGGGTGAAGA-3′ were used for PCR amplification. A PCR product of 430 bases was considered positive for betanodavirus. The positive samples were homogenized in L-15 medium supplemented with antibiotic–antimycotic solution. The homogenate was frozen and thawed three times before centrifuging at 13000g for 1 h at 4 °C. The supernatant was filtered using a 0.22 μm membrane and 0.1 ml of the filtrate was inoculated into CTE cells grown to 60–80% confluency. After 1 h of adsorption at room temperature, the supernatant was discarded and the cells were washed with phosphate buffer three times. Following this, L-15 medium with 10% FBS was added to the cells and incubated at 28 °C and the cells were examined daily up to 10 days for the CPE and subcultured up to 10 passages.

3. Results 3.1. Primary culture and subculture The outgrowth of cells from thymus explants was observed after 24 h (Fig. 1A). These cells continued to grow and formed a monolayer within 15 days. Morphologically, the monolayer consisted of a heterogeneous population of fibroblast-like and epithelial-like cells (Fig. 1B). The cells were subcultured in L-15 medium with 20% FBS at a ratio of 1:2 every 7–8 days for the initial 15 passages. After 15 passages, the cells were subcultured in a ratio of 1:2 every 5 days. After 18 passages, the cultures were comprised of predominantly epithelial-like cells. This cell line has been subcultured for 70 passages over nearly 400 days and has been designated as catla thymus epithelial cell (CTE) cell line. The CTE cell line consists of a homogeneous population of epithelial-like cells (Fig. 1C and D). The CTE cells revived after 3 months of storage in liquid nitrogen showed 80.3 ±4.04% viability (n = 3) and grew to confluency within 5 days. There was no alteration in morphology of cells after freezing and thawing.

Fig. 1. Photomicrographs of CTE cells of Catla catla; (A) Thymus explant showing radiation of cells. (B) Heterogeneous populations of epithelial-like and fibroblast-like cells at passage 5. (C) The cells were predominantly epithelial-like at passage 20. (D) CTE cells at passage 70 which were composed of epithelial cells.

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

(A)

24 oC

28 oC

32 oC

28 °C. At 37 °C, the cells showed vacuolation and started detaching by 72 h. The growth of CTE cell line in L-15 medium supplemented with different concentration of FBS at 28 °C is shown in Fig. 2B. The growth rate increased with increasing concentration of FBS up to 20%. The cells grown in medium with 5% FBS grew significantly slower than in medium with higher concentration of serum.

37 oC

9 8

Number of cells (105 cells ml-1)

549

7 6 5 4

3.3. Plating efficiency

3 2

Plating efficiency of CTE cell line was determined at seeding concentrations of 100, 500 and 1000 cells flask − 1. The PE was 4.3 ± 1.53, 14.2 ± 1.83 and 16.6 ± 1.21, respectively. The efficiency improved with increase in seeding density.

1 0 0

1

2

3

4

5

Number of days

(B)

10%

5%

15%

3.4. Chromosome analysis

20%

9

Chromosomal counts of 100 metaphase plates at passage 35 of CTE cell line revealed that the number of chromosomes in the cells varied from 36 to 82 (Fig. 3A). The majority of the cells (66%) had a diploid chromosome number (2N = 50) and the distribution was symmetrical. The metaphase spread with a normal diploid number (Fig. 3B) revealed a normal karyotype morphology, consisting of 5 pairs of metacentrics, 8 pairs of submetacentrics, 4 pairs of subtelocentrics and 8 pairs of telocentrics (2n = 10 m + 16sm + 8st + 16 t) (Fig. 3C).

Number of cells (105 cells ml-1)

8 7 6 5 4 3 2 1

3.5. PCR for confirmation of origin of cell line

0 0

1

2

3

4

5

To verify the origin of CTE cell line, DNA was isolated from the cells at passage 42. Amplification of the 16S rRNA and COI gene from the cell line and C. catla muscle tissue yielded PCR products of ~ 600 and ~ 700 bp, respectively (Fig. 4). The sequenced fragments of 16 s rRNA and COI genes from CTE cells and catla muscle showed a 100% identity. The gene sequences also showed 99% match to known C. catla mitochondrial DNA sequences in the GenBank. The gene sequences from CTE cell line were submitted to NCBI GenBank (GenBank accession number: JQ801754 and JQ801755).

Number of days Fig. 2. Growth response of CTE cells at different temperatures at 25th passage (A) and different concentrations of serum at passage 27.

3.2. Effect of Temperature and FBS concentration of growth of CTE cells CTE cells were able to grow at 24–32 °C with passage 25 cells (Fig. 2A). However, the maximum growth of cells was observed at

(A) Number of cells

70 60 50 40 30 20 10 0

30

34

36

42

46

48

50

56

60

74

82

Number of chromosomes

(B)

(C)

Fig. 3. Karyotype analysis of CTE cells at passage 35. (A) Chromosome number distribution. (B) Metaphase spread. (C) Diploid karyotype of CTE cell. The main chromosome number was 50 which consisted of 5 pairs of metacentrics, 8 pairs of submetacentrics, 4 pairs of subtelocentrics and 8 pairs of telocentrics (2n = 10 m + 16 sm + 8 st + 16 t).

550

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

3.9. Cytotoxicity test

1

2

3

4

5

6

7 The ECPs from V. cholerae MTCC 3904 were cytotoxic for the CTE cell line. Cytotoxic effects were observed after 24 h of inoculation of ECPs. CTE cells became rounded, shrunken and detached from the surface leading to the destruction of the monolayer by 72 h (Fig. 8). 3.10. Viral susceptibility and CPE No CPE was observed in the cells up to 10 days of virus inoculation, and even after 10 blind passages. This indicates that CTE cells were not susceptible to betanodavirus 4. Discussion

Fig. 4. PCR amplification of ~600 and ~700 bp sequences of the Catla catla genome using universal oligonucleotide primers of the 16S rRNA and COI genes, respectively. Mitochondrial DNA amplification with 16S rRNA primers. Lane 1, negative control; lane 2, C. catla muscle; lane 3, CTE cells; lane 4,100 bp DNA ladder (Fermentas); mitochondrial DNA amplification with COI primers; lane 5, CTE cells; lane 6, C. catla muscle; lane 7, negative control.

3.6. Cell transfection The cells at 66th passage were transfected with 2 μg of phr GFP-II N vector. Strong green fluorescent signals were observed after 48 h of transfection (Fig. 5). The transfection efficiency was up to 30–35%. It indicated that reporter gene GFP could be expressed in CTE cell line. 3.7. Immunostaining All the CTE cells were strongly positive for cytokeratin, an epithelial cell marker (Fig. 6). No reactivity was observed in control cover slips and in cover slips incubated with anti-vimentin antibodies. 3.8. Cell cycle analysis The DNA content of CTE cells was determined in 24 and 48 h cultured cells. A representative histogram of the DNA content and the number of cells obtained using flow cytometric analysis is shown in Fig. 7. At 24 h, two distinct peaks corresponding to the G0–G1 fraction and G2–M fraction of the cells were observed (Fig. 7A). The histogram of the cells at 48 h showed only one peak corresponding to G0–G1 fraction (Fig. 7B). The highest percentage of mitotic cells was observed in the 24 h culture (19.38%) with maximum in G0–G1 (67.07%). Higher number of cells in S-phase was observed at 48 h (32.08%) (Table 2).

Thymic epithelial cells are unique in their ability to support positive selection and are essential throughout thymocyte development (Anderson et al., 1998). The fish TEC cell lines can provide useful tool for the study of TEC biology and for the understanding of the precise role played by TEC in teleost T cell development. In addition, stromal cell lines from the lympho-haematopoietic tissues including thymus can be used as efficient tools for investigating haematopoietic cell development in fish (Ganassin and Bols, 1999). There are reports of development of stromal cell lines from kidney and spleen of rainbow trout (Diago et al., 1998; Ganassin and Bols, 1999), and thymus of common carp and ginbuna carp having fibroblast-like morphology (Katakura et al., 2009). In the present study, a cell line has been established from thymus of C. catla using explant method. In the initial passages, the cultures were composed of a mixture of fibroblast-like and epithelial-like cells but comprised predominantly of epithelial-like cells by 18 passages. The CTE cell line has been subcultured for 70 passages. This appears to be the first report on establishment of an epithelial cell line from thymus in teleosts. The highest growth rate of CTE cell line was observed at 28 °C in L-15 medium supplemented with 20% FBS. A number of cell lines derived from carps and other fishes are known to grow best at 28–30 °C (Ishaq Ahmed et al., 2009a; Ku et al., 2009; Luc Rougee et al., 2007; Tong et al., 1997). Ossum et al. (2004) also reported that cells from warm water fishes can grow at 15–37 °C incubation temperature with 25–35 °C as the optimal range. In addition, FBS was required for growth of CTE cells and better growth was observed with increase in concentration of FBS (up to 20%). However, even 10% FBS concentration in L-15 medium also supported growth of CTE cell line and hence can be used for growth and maintenance of this cell line at low cost. Cryopreservation of cell lines is essential to avoid loss by contamination and to prevent genetic changes in continuous cell line. The feasibility of cryopreservation of CTE cell line was demonstrated by

Fig. 5. The expression of GFP gene in CTE cells at passage 66 transfected with phrGFP II-N mammalian expression vector (scale bar = 200 μm).

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

551

Fig. 6. Photomicrograph of CTE cells showing presence of cytokeratin (A and B).

80.3 ± 4.04% cell viability after thawing and it was comparable to that reported earlier for many fish cell lines (Ishaq Ahmed et al., 2009a; Swaminathan et al., 2012). Plating efficiency, the preferred method of analyzing cell proliferation and survival, indicated that the CTE cell line performed better when seeded at a relatively higher density, i.e. 500 and 1000 cells ml −1. These results are in accordance with earlier reports (Swaminathan et al., 2010, 2012). The karyotyping revealed a diploid chromosomal count of 50 in majority of cells, which has been documented in literature for this species (Patel et al., 2009). This also indicates that CTE cells are normal catla cells. The origin of the CTE cell line was further authenticated by partial amplification and sequencing of two mitochondrial genes viz. 16S rRNA and COI of the C. catla. The alignment of sequencing data confirmed that CTE cell line is truly derived from catla. The

mitochondrial 12 S rRNA, 16S rRNA and COI gene sequence alignment has been used to confirm the origin of fish cell lines (Ishaq Ahmed et al., 2009a,b; Ku et al., 2009; Swaminathan et al., 2010, 2012; Zhao and Lu, 2006). COI gene sequence has been suggested as the core of global bio-identification system for animals (Hebert et al., 2003) and has been used to identify species and study phylogenetic relationships among organisms including fish (Ward et al., 2005). A global programme using COI as a barcode to identify fish species has been initiated (Marshall, 2005). This also suggests that COI gene sequence is a valid and universal marker for species identification of established fish cell lines. The high transfection efficiency of CTE cell line in the present study indicates that a heterologous promoter such as the cytomegalovirus promoter can drive the transient expression of foreign genes in

Fig. 7. Comparative analysis of DNA content of CTE cells at 24 h (A) and 48 h (B) with the peaks marked on the x-axis. The large peak depicts cells in G0–G1 phase and the smaller peak represents the cell population in G2–M phase, whereas intervening CTE cell population is in S-phase.

552

D.K. Chaudhary et al. / Gene 512 (2013) 546–553

Table 2 Frequency distribution of the stages of cell cycle estimated by flow cytometry at 24 and 48 h for the CTEC cell line. Hours

Dip Go-G1

Dip G1–M

Dip% CV

Total S-phase

24 h 48 h

67.07 66.72

19.38 1.22

5.2 5.74

13.54 32.08

this cell line. In addition, it is also possible to conduct studies on functional genomic studies such as RNA interference and gene knockout, and pathogenesis studies on catla infectious agents using this cell line. The lineage of CTE cell line was determined by immunostaining with antibodies to epithelial and fibroblastic markers. The cells showed reactivity to cytokeratin antibodies confirming that the CTE cell line is epithelial in nature, as reported earlier (Ishaq Ahmed et al., 2008; Parameswaran et al., 2007). The flow cytometric analysis showed that higher content of DNA was found in cells that were in S-phase on 2nd day of culture. The diploid cell population as observed in the present study can be of great interest for cytogenetic studies. The ECPs from V. cholerae were cytotoxic to the CTE cell line. Previously, many fish cells have proven suitable for demonstrating the cytotoxic effects of pathogenic bacteria including V. cholerae (Swaminathan et al., 2010, 2012), and other genera (Ishaq Ahmed et al., 2009b; Ku et al., 2009). Thus, CTE cells are ideal for testing the cytotoxic factors of fish bacteria. The susceptibility of cell lines to viral infection is the basis for isolating and characterizing fish viruses. Till date, no viral diseases have been reported from Indian major carps. The only fish virus reported from the country is nodavirus from Asian seabass (Azad et al., 2005) and CTE cell line was not susceptible to this virus. It has been reported that in vitro viral replication generally requires permissive cell lines

derived from the same host species (Lu et al., 1999). Therefore, CTE cell line may be of use for isolation of viruses from disease outbreaks of cyprinids, especially Indian major carps. In conclusion, a continuous cell line has been developed from thymus of catla. The developed epithelial cell line can be a useful tool to understand the in vivo functions of fish thymic epithelial cells, and to gain an insight into their involvement in the critical selection process of thymocytes. In addition, molecular studies particularly host functional genomics and pathogenesis studies of carp pathogens may also be conducted using this established cell line. Acknowledgments The authors are thankful to Dr. S. Ayyappan, DG, ICAR and Dr. B. Meenakumari, DDG (Fy.) for the guidance and encouragement. The help and cooperation extended by Dr. A. L. Vishwakarma, CDRI, Lucknow in flow cytometry is duly acknowledged. References Anderson, K.L., Moore, N.C., McLoughlin, D.E., Jenkinson, E.J., Owen, J.J., 1998. Studies on thymic epithelial cells in vitro. Dev. Comp. Immunol. 22, 367–377. Azad, I.S., et al., 2005. Nodavirus infection causes mortalities in hatchery produced larvae of Lates calcarifer: first report from India. Dis. Aquat. Org. 63, 113–118. Balebona, M.C., Andreu, M.J., Bordas, M.A., Zorrilla, I., Morinigo, M.A., Borrego, J.J., 1998. Pathogenicity of Vibrio alginolyticus for cultured gilt-head sea bream (Sparus aurata L.). Appl. Environ. Microbiol. 64, 4269–4275. Castillo, A., Lopez-Fierro, P., Alvarez, F., Zapata, A., Villena, A.J., Razquin, B.E., 1991. Posthatching development of the thymic microenvironment in the rainbow trout. Salmo gairdneri: an ultrastructural study. Am. J. Anat. 190, 299–307. Chaudhary, D.K., et al., 2012. Establishment of a macrophage cell line from adherent peripheral blood mononuclear cells of Catla catla. In Vitro Cell. Dev. Biol. Anim. 48, 340–348. Colic, M., Pejnovic, N., Kataranovski, M., Stojanovic, N., Terzic, T., Dujic, A., 1991. Rat thymic epithelial cells in culture constitutively secrete IL-1 and IL-6. Int. Immunol. 3, 1165–1174.

Fig. 8. Cytotoxic effects of extracellular products (ECPs) of Vibrio cholerae MTCC 3904. (A) A monolayer of CTE cells. (B) CTE cells at 24 h following inoculation of ECPs. (C) CTE cells at 48 h post-inoculation of ECPs. (D) CTE cells at 72 h following inoculation of ECPs.

D.K. Chaudhary et al. / Gene 512 (2013) 546–553 Diago, M.L., LoPez-Fierro, P., Razquin, B., Villena, A., 1998. In vitro haemopoiesis induced in a rainbow trout pronephric stromal cell line (TPS). Fish Shellfish Immunol. 8, 101–119. FAO, 2012. Aquaculture Production (Quantities and values) 1950–2010 (Release date: March 2012). Fernandez, E., et al., 1994. Establishment and Characterization of Cloned Human Thymic Epithelial Cell Lines. Analysis of Adhesion Molecule Expression and Cytokine Production. Blood 83, 3245–3254. Freshney, R.I., 2005. Culture of Animal Cells—A Manual of Basic Techniques. Wiley- Liss, NewYork. Ganassin, R.C., Bols, N.C., 1999. A stromal cell line from rainbow trout spleen, RTS34st, that supports the growth of rainbow trout macrophages and produces conditioned medium with mitogenic effects of leukocytes. In Vitro Cell. Dev. Biol. Anim. 35, 80–86. Hebert, P.D.N., Cywinska, A., Ball, S.L., deWaard, J.R., 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. Sci. 270, 313–321. Hibi, T., et al., 1991. Establishment of epithelial cell lines from human and mouse thymus immortalized by the 12S adenoviral E1a gene product. Thymus 18, 155–167. Ishaq Ahmed, V.P., et al., 2008. A new epithelial-like cell line from eye muscle of catla (Catla catla): development and characterization. J. Fish Biol. 72, 2026–2038. Ishaq Ahmed, V.P., et al., 2009a. A new fibroblastic-like cell line from heart muscle of the Indian major carp (Catla catla): development and characterization. Aquaculture 293, 180–186. Ishaq Ahmed, V.P., et al., 2009b. Development and characterization of cell lines derived from rohu, Labeo rohita (Hamilton), and catla, Catla catla (Hamilton). J. Fish Dis. 32, 211–218. Itoh, T., 1979. Establishment of an epithelial cell line from rat thymus. Am. J. Anat. 156, 99–104. Itoh, T., et al., 2001. Establishment of a mouse thymic epithelial cell line, IT-76MHC and a brief review on cultured thymic epithelial cells. Cell. Mol. Biol. 47, 1–18. Katakura, F., et al., 2009. Co-culture of carp (Cyprinus carpio) kidney haematopoietic cells with feeder cells resulting in long-term proliferation of T-cell lineages. Vet. Immunol. Immunopathol. 131, 127–136. Ku, C.C., Teng, Y.C., Wang, C.S., Lu, C.H., 2009. Establishment and characterization of three cell lines derived from the rockfish grouper Epinephelus quoyanus: use for transgenic studies and cytotoxicity testing. Aquaculture 294, 147–151. Le Douarin, N.M., Jotereau, F.V., 1975. Tracing of cells of the avian thymus through embryonic life in interspecific chimeras. J. Exp. Med. 142, 17–40. Lu, Y., Nerurkar, V.R., Aguirre, A.A., Work, T.M., Balazs, G.H., Yanagihara, R., 1999. Establishment and characterization of 13 cell lines from a Green Turtle (Chelonia mydas) with fibropapillomas. In Vitro Cell. Dev. Biol. Anim. 35, 389–393. Luc Rougee, G.K., Ostrander, R.H., Richmond, Y.L., 2007. Establishment, characterization and viral susceptibility of two cell lines derived from goldfish Carassius auratus muscle and swim bladder. Dis. Aquat. Org. 77, 127–135. Marshall, E., 2005. Will DNA bar codes breathe life into classification? Science 307, 1037. Masuda, A., Ohtsuka, K., Matsuyama, M., 1990. Establishment of functional epithelial cell lines from a rat thymoma and a rat thymus. In Vitro Cell. Dev. Biol. Anim. 26, 713–721. Mauger, P.E., et al., 2009. Characterization of goldfish fin cells in culture: some evidence of an epithelial cell profile. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 152, 205–215.

553

Mizuochi, T., Kasai, M., Kokuho, T., Kakiuchi, T., Hirokawa, K., 1992. Medullary but Not Cortical Thymic Epithelial Cells Present Soluble Antigens to Helper T Cells. J. Exp. Med. 175, 1601–1605. Nishizawa, T., Mori, K., Nakai, T., Furusawa, I., Muroga, K., 1994. Polymerase chain reaction (PCR) amplification of RNA of striped jack nervous necrosis virus (SJNNV). Dis. Aquat. Org. 18, 103–107. Ossum, G.C., Hoffmann, E.K., Vijayan, M.M., Holt, S.E., Bols, N.C., 2004. Characterization of a novel fibroblast-like cell line from rainbow trout and responses to sublethal anoxia. J. Fish Biol. 64, 1103–1116. Palumbi, S., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., 1991. The Simple Fool's Guide to PCR. University of Hawaii, Honolulu, HI, USA. Parameswaran, V., Ahmed, V.P.I., Shukla, R., Bhonde, R.R., Hameed, A.S.S., 2007. Development and characterization of two new cell lines from milkfish (Chanos chanos) and grouper (Epinephelus coioides) for virus isolation. Mar. Biotechnol. 9, 281–291. Patel, A., Das, P., Barat, A., Sarangi, N., 2009. Estimation of genome size in Indian major carps Labeo rohita (Hamilton), Catla catla (Hamilton), Cirrhinus mrigala (Hamilton) and Labeo calbasu (Hamilton) by Feulgen microdensitometry method. Ind. J. Fish. 56, 65–67. Pulsford, A., Fange, R., Zapata, A.G., 1991. The thymic microenvironment of the common sole, Solea solea. Acta Zool. (Stockholm) 72, 209–216. Qin, Q.W., Wu, T.H., Jia, T.L., Hegde, A., Zhang, R.Q., 2006. Development and characterization of a new tropical marine fish cell line from grouper, Epinephelus coioides susceptible to iridovirus and nodavirus. J. Virol. Methods 131, 58–64. Scollay, R., et al., 1988. Developmental status and reconstitution potential of subpopulations of murine thymocytes. Immunol. Rev. 104, 81–120. Swaminathan, T.R., Lakra, W.S., Gopalakrishnan, A., Basheer, V.S., Kushwaha, B., Sajeela, K., 2010. Development and characterization of a new epithelial cell line PSF from caudal fin of Green chromide, Etroplus suratensis (Bloch, 1790). In Vitro Cell. Dev. Biol. Anim. 46, 647–656. Swaminathan, T.R., Lakra, W.S., Gopalakrishnan, A., Basheer, V.S., Kushwaha, B., Sajeela, K., 2012. Development and characterization of a fibroblastic-like cell line from caudal fin of the red-line torpedo, Puntius denisonii (Day) (Teleostei: Cyprinidae). Aquacult. Res. 43, 498–508. Tong, S.L., Lee, H., Miao, H.Z., 1997. The establishment and partial characterization of a continuous fish cell line FG-9307 from the gill of flounder. Paralichthys olivaceus. Aquaculture 156, 327–333. von Boehmer, H., 1988. The developmental biology of T lymphocytes. Annu. Rev. Immunol. 6, 309–326. Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R., Hebert, P.D.N., 2005. DNA barcoding Australia's fish species. Philos. Trans. R Soc. Lond. B Biol. Sci. 360, 1847–1857. Williams, G.T., Kingston, R., Owen, M.J., Jenkinson, E.J., Owen, J.J., 1986. A single micromanipulated stem cell gives rise to multiple T-cell receptor gene rearrangements in the thymus in vitro. Nature 324, 63–64. Zapata, A.G., Chiba, Á., Varas, A., 1996. Cells and tissues of the immune system of fish. In: Iwama, G., Nakanishi, T. (Eds.), The Fish Immune System. : Organism, Pathogen and Environment. Academic Press, San Diego, pp. 1–62. Zhao, Z., Lu, Y., 2006. Establishment and characterization of two cell lines from bluefin trevally Caranx melampygus. Dis. Aquat. Organ. 68, 91–100.