Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins

Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins

Accepted Manuscript Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins Kimberly D ...

1MB Sizes 5 Downloads 17 Views

Accepted Manuscript Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins

Kimberly D Mackenzie, Yoon Lim, Michael D Duffield, Timothy Chataway, Xin-Fu Zhou, Damien J Keating PII: DOI: Reference:

S0898-6568(17)30069-4 doi: 10.1016/j.cellsig.2017.02.023 CLS 8864

To appear in:

Cellular Signalling

Received date: Revised date: Accepted date:

10 January 2017 16 February 2017 28 February 2017

Please cite this article as: Kimberly D Mackenzie, Yoon Lim, Michael D Duffield, Timothy Chataway, Xin-Fu Zhou, Damien J Keating , Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Cls(2016), doi: 10.1016/j.cellsig.2017.02.023

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins.

Kimberly D Mackenzie1, Yoon Lim2, Michael D Duffield1, Timothy Chataway1, Xin-Fu

1

PT

Zhou2, Damien J Keating1, 3

Department of Human Physiology and Centre for Neuroscience, Flinders University,

RI

Adelaide, SA, Australia

Sansom Institute, University of South Australia, Adelaide, SA, Australia

3

South Australian Health and medical Research Institute, Adelaide, SA, Australia

NU

SC

2

MA

Corresponding author: Professor Damien Keating, Department of Human Physiology and Centre for Neuroscience, School of Medicine, Flinders University, GPO Box 2100, Adelaide,

D

SA 5001, Australia.

PT E

Email: [email protected]

AC

exocytosis

CE

Keywords: Huntingtin-associated protein-1; vesicles; receptors; endocytosis; clathrin;

1

ACCEPTED MANUSCRIPT Abstract Huntingtin-associated protein 1 (HAP1) was initially identified as a binding partner of huntingtin, mutations in which underlie Huntington’s disease. Subcellular localization and protein interaction data indicate that HAP1 may be important in vesicle trafficking, cell signalling and receptor internalization. In this study, a proteomics approach was used for the identification of novel HAP1-interacting partners to attempt to shed light on the physiological

PT

function of HAP1. Using affinity chromatography with HAP1-GST protein fragments bound to Sepharose columns, this study identified a number of trafficking-related proteins that bind

RI

to HAP1. Interestingly, many of the proteins that were identified by mass spectrometry have trafficking-related functions and include the clathrin light chain B and Sec23A, an ER to

SC

Golgi trafficking vesicle coat component. Using co-immunoprecipitation and GST-binding assays the association between HAP1 and clathrin light chain B has been validated in vitro.

NU

This study also finds that HAP1 co-localizes with clathrin light chain B. In line with a physiological function of the HAP1-clathrin interaction this study detected a dramatic

MA

reduction in vesicle retrieval and endocytosis in adrenal chromaffin cells. Furthermore, through examination of transferrin endocytosis in HAP1-/- cortical neurons, this study has determined that HAP1 regulates neuronal endocytosis. In this study, the interaction between

D

HAP1 and Sec23A was also validated through endogenous co-immunoprecipitation in rat

PT E

brain homogenate. Through the identification of novel HAP1 binding partners, many of which have putative trafficking roles, this study provides us with new insights into the mechanisms underlying the important physiological function of HAP1 as an intracellular

CE

trafficking protein through its protein-protein interactions. 1. Introduction The huntingtin-associated protein-1 (HAP1) was the first identified interacting partner of the

AC

huntingtin protein (Htt), mutations in which underlie the neurodegenerative pathologies seen in Huntington’s disease (Li et al. 1995). HAP1 is primarily classed as a neuronal protein (Li et al. 1995), but expression is also seen in a variety of endocrine cells (Cape et al. 2012, Lumsden et al. 2016, Mackenzie et al. 2014). The protein interaction partners of HAP1 suggests that it may act as a scaffold to stabilize protein complexes required for protein trafficking and/or as an adaptor protein that links cargos to intracellular transporters. In rodents, two isoforms of HAP1 are present; HAP1A (599 aminoacids (aa)) which is enriched in growth cones and neuritic puncta of developing neurons, and HAP1B (629aa) which is diffusely distributed in the cytoplasm (Li et al. 2000b). HAP1 interacts with the microtubuledependent trafficking proteins dynactin p150 (Engelender et al. 1997, Li et al. 1998), kinesin

2

ACCEPTED MANUSCRIPT light chain 2 (KLC2) (McGuire et al. 2006) and kinesin family motor protein 5 (KIF5) (Twelvetrees et al. 2010). Dynactin p150 and KLC2 in turn associate with microtubule motors kinesin and dynein to mediate intracellular anterograde (from soma to axon terminal) and retrograde (from axon terminal to soma) transport, respectively. Interestingly, sucrose gradient fractionation studies of brain samples from HAP1-/- animals shows a reduction of HAP1 interacting partners KLC2, dynactin p150 and Htt in synaptosomal fractions indicating

PT

that the lack of HAP1 causes a disruption in their stabilization or transport (Lin et al. 2010). HAP1 has also been found to interact with Bcr, a Rho GTPase regulator, on taxol-precipitated microtubules further supporting its involvement in microtubule-dependant trafficking (Huang

RI

et al. 2015). The interaction of HAP1 with microtubule-dependent transporters and receptors,

SC

along with its subcellular localization, is consistent with the theory that HAP1 participates in vesicular trafficking and/or endocytosis. HAP1 is found on the plasma membrane, clathrin-

NU

coated vesicles, budding vesicles, multivesicular bodies and small vesicles (Li et al. 1995). It is enriched in synaptosomal membrane fractions (Li et al. 1996) and is prevalent in microtubule-enriched preparations from rat brain (Li et al. 1998). In our previous studies the

MA

loss of HAP1 has been found to reduce the levels of exocytosis in neurons (Mackenzie et al. 2016) and adrenal chromaffin cells (Mackenzie et al. 2014).

D

HAP1 is also implicated in the trafficking of membrane receptors through receptor

PT E

internalization and recycling, however the molecular mechanisms involved in these processes are unknown. HAP1 stabilizes internalized epidermal growth factor (EGF) and γaminobutyric acid type A (GABAA) receptors by preventing their lysosomal degradation

CE

(Kittler et al. 2004, Li et al. 2002). Overexpression of HAP1 inhibits GABAA receptor (GABAAR) degradation and consequently increases receptor recycling (Kittler et al. 2004).

AC

Recently, HAP1 has been shown to play a key role in the modulation of GABA AR traffic during brain ischemia (Mele et al. 2017). GABAAR trafficking mediates synaptic inhibition (Jacob et al. 2008) and is facilitated by a complex of HAP1 and KIF5 (Twelvetrees et al. 2010). Suppressing HAP1 expression attenuates GABAAR trafficking and synaptic inhibition (Twelvetrees et al. 2010) and consistent with these results GABAA-mediated synaptic transmission was impaired in a Huntington’s disease mouse model (Yuen et al. 2012). HAP1 also maintains the normal levels of the membrane nerve growth factor (NGF) receptor, tropomyosin-related kinase A receptor tyrosine kinase (TrkA) by preventing the degradation of internalized TrkA (Rong et al. 2006). Many synaptic receptors including EGFR and GABAAR undergo clathrin-dependent endocytosis (Herring et al. 2003, Kittler et al. 2000a).

3

ACCEPTED MANUSCRIPT The internalized receptors either get recycled rapidly to the cell surface or are targeted for lysosomal degradation. Recent studies implicate HAP1 in the endocytosis of BDNF and its receptor TrkB in neurons (Lim et al. 2017). However, an involvement of HAP1 in clathrinmediated endocytosis has not been previously demonstrated. HAP1 has also been implicated in endosomal trafficking (Wu & Zhou 2009). HAP1 interacts both in vivo and in vitro with hepatocyte growth factor-regulated tyrosine kinase substrate

PT

(Hrs) (Li et al. 2002), a protein involved in endosome-to-lysosome trafficking of membrane proteins (Clague & Urbe 2003). HAP1 co-localizes with Hrs on early endosomes and HAP1

RI

overexpression induces the formation of enlarged early endosomes (Li et al. 2002) similarly seen with Hrs overexpression (Chin et al. 2001, Komada et al. 1997, Raiborg et al. 2001).

SC

Overexpression of HAP1 inhibits the early to late endosome trafficking of endocytosed

NU

EGFR resulting in the accumulation of internalized EGF on early endosomes (Li et al. 2002). To gain insights into the physiological function of HAP1, this study attempted to identify novel HAP1-binding proteins using a proteomics approach involving affinity purification.

MA

This study reports that HAP1 directly associates with the clathrin-light chain B, a component of the clathrin coat involved in endocytosis, as well as endosomal trafficking protein Sec23A

D

and other trafficking-related proteins. Validation of the interaction between HAP1 and clathrin light chain B was carried out using co-immunoprecipitation as well as GST-pull

PT E

down experiments. A high degree of co-localization exists between HAP1 and clathrin light chain B. Interestingly, the loss of HAP1 decreases endocytosis in cortical neurons. This study also validated the interaction between HAP1 and Sec23A using co-immunoprecipitation

CE

experiments with endogenous proteins. This manuscript also reports on the high confidence interacting partners of HAP1 identified by the non-biased approach used in this study, which

AC

interestingly, consists of predominantly trafficking-related proteins. In the same study HAP1 was identified as a binding partner of the synaptic vesicle trafficking protein synapsin 1 which has been described in a previous report (Mackenzie et al. 2016). This study demonstrates the role of HAP1 in endocytosis, possibly through its association with the clathrin-light chain B. The identities of additional possible interacting partners of HAP1 identified through this screening approach have been provided.

2. Methods

4

ACCEPTED MANUSCRIPT 2.1 Mice All procedures involving animals were approved by the Animal Welfare Committee of Flinders University and undertaken according to the guidelines of the National Health and Medical Research Council of Australia. HAP1 mice were obtained from the Li group (Li et al. 2003). Male Hooded-Wistar rats bred in-house were kept under standardized breeding conditions with free access to water and food at Flinders University. Both male and female

PT

HAP1 wild-type and knockout mice were used at P0. Animal breeding and genotyping

RI

followed methods previously published (Mackenzie et al. 2014).

SC

2.2 Plasmids

PCR amplification of 1-365aa HAP1 fragment was carried out using Vent DNA polymerase

NU

(NEB, US) from a HAP1-EGFP construct (gift from Prof. Xiao-Jiang Li, Department of Human Genetics, Emory University School of Medicine) using the primers with EcoRI restriction enzyme sites: Forward primer 5’ GGGAATTCATGCGCCCGAAGGACCAGG-3’

MA

and reverse primer 3’-GGGAATTCACTGCTGCTGCAGTTTCTCCG-5’. The PCR was performed with Pfu Turbo (Agilent Technologies, La Jolla, CA, USA) for 1 cycle at 94°C for

D

3 mins, 25 cycles at 94°C for 30 seconds, 60°C for 30 seconds , and 72°C for 2 mins and 1 cycle at 72°C for 2 mins. The fusion protein of HAP1 (PC43) (middle portion of HAP1, 280-

PT E

445aa) was subcloned into pGEX-4T-2 vector (from Prof. Xiao-Jiang Li, Department of Human Genetics, Emory University School of Medicine). The vector only pGEX-4T-1 was used for GST protein production. GST-HAP1 construct (371-599 aa) was a gift from Prof.

CE

Josef Kittler (Department of Neuroscience, Physiology, and Pharmacology, University College London, London, UK) and the GST-rat HAP1 construct (HAP1 153 – 599) was

AC

kindly gifted from Prof. Josef Kittler (University College London, London, UK). Synthesis of recombinant proteins in BL21 cells (Invitrogen Life Technologies, Carlsbad, CA, USA) was induced with 0.5-1 mM isopropyl-b-D-thiogalactopyranoside for 2 h at 30º C. GST fusion proteins were purified on glutathione–Sepharose 4B beads (GE Healthcare Australia, NSW, Australia) according to the manufacturer’s instructions. GST-rat HAP1 1-365 and rat HAP1A-myc was constructed by subcloning a PCR product which was generated from PRK-HAP1A (a gift from Prof. Xiao-Jiang Li, Emory University, Atlanta,

GA,

USA

)

using

PCR

primers

GGGAATTCATGCGCCCGAAGGACCAGG-3’

(GST-HAP1 (Forward)

1-365

set: and

;

5’5’-

5

ACCEPTED MANUSCRIPT GCCTCTTTGACGTCGTCGTCACTTAAGGG-3’ (Reverse) rat HAP1A-myc set 5’TACTCGAGGCCACC ATG CGC CCG AAG GAC CAG -3’(Forward) and 5’AAGAATTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTAGGGTTGATGATCGG TA -3’ (Reverse) ) into the XbaI and EcoRI of pGEX-4T-1 vector (Life Technology, Mulgrave, VIC, Australia) and XhoI and EcoRI sites of pcDNA3.1 vector (Life Technology, Mulgrave, VIC, Australia), respectively. .

PT

For rat clathrin light chain B (CLCb) cloning, rat cDNA was synthesized using SuperScript® III First-Strand Synthesis System (Life Technology, Mulgrave, VIC, Australia) and the open reading frame of rat CLCb was amplified with PCR primers (Forward: 5’-3’

and

RI

aaGAATTCgccaccATGGCTGAGGACTTCGG

Reverse:

5’-

SC

aaGGATCCgcGCGGGACAGTGGCGTCTGC -3’). The obtained PCR product and plasmid were then cut with EcoRI and BamHI and ligated into pEYFP-N1 vector (Clontech, Mountain

MA

DNA sequence analysis in both directions.

NU

View, CA, USA). All cloned constructs were confirmed by DNA restriction enzyme and

2.3 Affinity purification of HAP1 interacting proteins

D

Six Hooded-Wistar rat brains were minced in liquid nitrogen and homogenized in cold homogenisation buffer (PBS, pH 7.4, 10 mM HEPES pH 7.2, 2 mM EDTA) containing

PT E

protease inhibitors (protease inhibitor cocktail, Roche Molecular Biochemicals, Indianapolis, IN, USA) using a hand held homogenizer and centrifuged at 5000 g for 25 minutes at 4°C. The crude homogenate was centrifuged again at 15,000 g for 30 mins at 4°C and filtered

CE

through 0.45 µm filters to prevent blockage of the column. Glutathione–Sepharose columns containing the immobilized HAP1 280-445aa, HAP1 371-599aa and control columns (GST

AC

and only beads) were equilibrated with 10 ml of PBS with protease inhibitors. Equal volumes of rat brain homogenate were passed through the columns using gravity flow and PBS washes were carried out until the absorbance of the outflow was approximately 0.001 OD units at 280 nm. Elution fractions of 300 µl were collected by eluting with 0.1 M glycine-HCl, pH 2.5 and the pH was adjusted immediately to 7.2 with 1.5M Tris (pH 8.8). Each protein preparation was cleaned by using PlusOne 2-D clean up kit (GE Healthcare Life Sciences, Piscataway, NJ, USA).

6

ACCEPTED MANUSCRIPT 2.4 Mass spectrometry-compatible silver staining of 1D gels to identify HAP1 interacting proteins Each sample (15 µl) was boiled at 95°C for 5 mins with 4X sample buffer and separated on Any kD pre-cast resolving Gels (Bio-Rad Laboratories, Hercules, CA, USA) run at 200 V and 80 mA. Unstained protein molecular weight standards (Bio-Rad Laboratories, Hercules, CA, USA) were used as the markers for protein molecular weight. Proteins were visualized

PT

using a mass spectrometry compatible EBT silver stain protocol using freshly prepared solutions. Briefly, the gels were fixed 2 times for 20 mins in fixative/stop solution (30%

RI

ethanol, 10% acetic acid in distilled water) followed by sensitization for 2 mins in sensitizer solution (0.006% w/v EBT, 30% ethanol in distilled water). The gels were then destained for

SC

2 mins in destain solution (30% ethanol in distilled water) and washed twice for 2 mins in distilled water. Silver solution (0.25% w/v silver nitrate, 0.037% w/v formaldehyde in

NU

distilled water) was added to the gels for 5 mins. The gels were washed briefly in distilled water, allowed to develop in developer solution (2% w/v potassium carbonate, 0.04% w/v

MA

sodium hydroxide, 0.002% w/v sodium thiosulphate, 0.007% w/v formaldehyde in distilled water) until the bands of interest were visualized. Finally, fixative/stop solution was added to

PT E

D

stop the developing reaction.

2.5 Sample preparation for mass spectrometric analysis The silver stained gels containing the elution fractions from the immobilized HAP1-GST

CE

fusion protein and control columns were visually compared and unique protein bands present in the experimental columns (absent in the control columns) were manually excised with a

AC

scalpel. The gel pieces were washed with 50/50 mixture of acetonitrile and distilled water for 15 mins following incubation with neat acetonitrile for 15 mins at room temperature. The gel pieces were rehydrated with 100 mM ammonium bicarbonate and following 5 mins, acetonitrile was added and the sample was incubated for a further 15 mins. The gel pieces were dried in a rotary evaporator and the samples were reduced and alkylated with 10mM dithiothreitol, incubated at 65°C for 45 mins, followed by addition of 50 mM iodoacetamide and incubated for 30 mins at 30°C in the dark. The gel pieces were then washed three times with a 50/50 solution of acetonitrile and distilled water and dried in a rotary evaporator. Proteolytic digestion was carried out on ice for 45 mins with 12.5 ng/μl trypsin-gold (Promega, Madison, WI, USA), freshly diluted in 100 mM ammonium bicarbonate and 0.5 7

ACCEPTED MANUSCRIPT mM calcium chloride. The gel pieces were incubated overnight in a 37°C oven with 100mM ammonium bicarbonate, the supernatant removed and each sample concentrated to 3-5 µl using a rotary evaporator.

2.6 LC MS/MS

PT

The approach here was similar to that previously reported (Mackenzie et al. 2016). Briefly, the supernatants containing the digested peptides were analysed with a Thermo Orbitrap XL

RI

linear ion trap mass spectrometer fitted with a nanospray source (Thermo Electron Corp, Madison, WI, USA). The samples were applied to a 300 mm i.d. x 5 mm C18 PepMap 100

SC

precolumn (Dionex Corp) and separated on a 75 μm x 150 mm C18 5 μm 100 Å column (Nikkyo Technos, Tokyo, Japan), using a Dionex Ultimate 3000 HPLC (Dionex Corp,

NU

Sunnyvale, CA, USA) with a 55 min gradient from 2% ACN to 45% ACN containing 0.1% formic acid at a flow rate of 200 nl/min followed by a step to 77% ACN for 9 mins. The mass

MA

spectrometer was operated in positive ion mode with one FTMS scan of m/z 300-2000 at 60,000 resolution followed by ITMS or FTMS product ion scans of the 6 most intense ions with dynamic exclusion of 15 seconds with 10 ppm low and high mass width relative to the

D

reference mass, an exclusion list of 500 and collision induced dissociation energy of 35%.

PT E

Only multiply charged ions were selected for MS/MS of trypsin digested peptides. The spectra were searched with an in-house MASCOT search engine version 2.3.01 (www.matrixscience.com) against the rat Swissprot database 57.15 using trypsin as the

CE

digesting protease, allowing for a maximum of two missed cleavages. Briefly, the MASCOT search engine assigns an ‘ion score’ to each peptide query when searching the MS/MS data

AC

queries against a protein database. Searches were performed under the parameters of variable modifications for carbamidomethylation of cysteines, phosphorylated threonine, or tyrosine and oxidated methionine. The mass tolerance for identification of precursor ions was 15 ppm and 0.6 Da for product ions and all protein mass spectra was manually verified against its assigned score. The significance threshold was set at p<0.05. Proteins that have at least two unique peptides sequenced with significance thresholds of p<0.05 were considered to be high confidence interactors while proteins that had at least one unique statistically significant peptide was considered a lower probability match.

8

ACCEPTED MANUSCRIPT 2.7 In vitro binding assays In vitro binding assays were performed as described previously (Twelvetrees et al. 2010) with minor modifications. Briefly, GST-HAP1 (1-365 and 153-599) and GST (control) proteins were expressed and purified from E.coli BL21 (Life Technology, Mulgrave, VIC, Australia) as described previously (Kittler et al. 2005) and HEK293T cells were transfected with rat CLCb-pEYFP and the cell lysates were prepared in RIPA buffer. GST-fusion proteins

PT

purified from E. Coli, were performed as described previously (Kittler et al. 2005, Kittler et al. 2000). The CLCb lysates (500 μg) were incubated with 20 μg of GST-HAP1 proteins

RI

immobilized on glutathione sepharose beads (GE Healthcare Australia, NSW, Australia) at 4°C overnight with rotation. After four times washing with RIPA buffer, the beads were

SC

boiled in 40 µl of 2X SDS PAGE loading buffer and the supernatants were subjected to Western blot analysis with anti-GFP antibody. The transferred membrane was stained with

MA

2.8 Co-immunoprecipitation (Co-IP)

NU

Ponceau before membrane blocking to show each GST protein.

For the co-IP assay, HEK293T cells (ATCC, Rockville, MD, USA) were co-transfected with

D

ratHAP1A-myc-pcDNA3.1 and ratCLCb-pEYFP-N1. After 24 hours of transfection, the cells

PT E

were prepared with RIPA buffer ( 50mM Tris-HCl, 0.5% Sodium deoxycholate ,1% NP-40, 0.1% SDS, 150mM NaCl, 2mM EDTA, pH7.4) containing protease inhibitor cocktail (Roche, Castle Hill, NSW, Australia), followed by sonication and centrifugation at 12,000 g

CE

for 10 mins at 4°C. The protein concentrations of the supernatants were determined by BCA protein assay (Thermo Fisher Scientific, Rockford, IL, USA). The lysates were incubated

AC

with 2 µg of goat anti-GFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4°C overnight. Protein G beads (20 μl; Thermo Fisher Scientific, Rockford, IL, USA) were added to the mixture and incubated for two hours at 4°C, followed by washing with PBST (PBS, 0.1% Tween-20) and boiled in 40 µl of 2X SDS PAGE loading buffer (0.1M Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, 10% β-mercaptoethanol, 0.004% bromophenol blue) for 4 mins. The samples and cell lysates were then subjected to Western blotting to detect HAP1Amyc with rabbit anti-HAP1 (a gift from Prof. Marian DiFiglia, Harvard Medical School, Boston, MA, USA) and anti-GFP antibody to detect rat CLCb-pEYFP as input control. To determine whether endogenous HAP1 and Sec23A interact, rat brain homogenate was prepared as described earlier, pre-cleared with protein G plus agarose beads (Santa Cruz

9

ACCEPTED MANUSCRIPT Biotechnology, Santa Cruz, CA, USA) for 1 hour at 4°C and Rb anti-Sec23A (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or control Rb IgG (in-house) was added and incubated overnight at 4°C. Additional control beads only were also used. The following day, 20 μl of protein G plus agarose beads (Santa Cruz Biotechnology, US) was added to each tube and incubated with rotation for 2 hours at 4°C. The beads were washed three times in cold homogenization buffer containing 0.4% Tween 20 and protease inhibitors and the bound

PT

proteins were detached and collected by adding Laemmli sample buffer (Bio-Rad Laboratories Hercules, CA, USA ) containing 350 mM dithiothreitol and heated the samples

SC

RI

to 95ºC for 5 mins.

2.9 Western blotting

NU

Denatured protein samples were run on TGX Stainfree Any kD midi gels (Bio-rad Laboratories, Hercules, CA, USA) at 200V for 35 mins in running buffer (250 mM Tris, 192

MA

mM Glycine, 0.06% SDS) or on 10% SDS-PAGE homemade gels. The Hoefer SemiPhor semi dry transfer unit was used for protein transfer onto PVDF membrane (GE Healthcare Australia, NSW, Australia) according to the manufacturer’s instructions using transfer buffer

D

(25 mM Tris, 192 mM Glycine, 20% methanol, 0.05% SDS). For blots that were Ponceau

PT E

stained, the membrane was incubated in Ponceau S Staining Solution (0.1% (w/v) Ponceau S in 5% (v/v) acetic acid) for 5 mins, followed by rinsing for 5 mins in distilled water before taking a picture. Blots were incubated in blocking buffer (TBS (20 mM Tris, 150 mM NaCl

CE

pH 7.4-7.6), 0.05% Tween 20, 5% (w/v) skim milk powder (Diploma)) for 1 h, then rinsed in TBS, and incubated overnight at 4°C with the appropriate primary antibody. The following

AC

primary antibodies were used: Mouse anti-HAP1 antibody (1:200, Thermo Scientific, Rockford, IL, USA), goat anti-GFP (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and rabbit anti-HAP1 (1:200, a gift from Prof. Marian DiFiglia, Harvard Medical School, Boston, MA, USA). Blots were washed for 3x 5 mins in TBST (TBS + 0.1% Tween 20) and incubated at room temperature with horse radish peroxidase (HRP) donkey antirabbit and HRP-donkey anti-mouse, both from Jackson ImmunoResearch Laboratories (USA) according to manufacturer’s instructions. Following 3x 5 mins washes in TBST, the blots were developed with Enhanced Chemi-Luminescence (ECL) reagent (Pierce Chemical Co., Rockford, IL, USA), and the signal was detected and digitally imaged using a Fuji LAS4000 System (GE Healthcare, Uppsala, Sweden).

10

ACCEPTED MANUSCRIPT

2.10 Transferrin-endocytosis assay in primary cortical neurons Mouse cortical neurons were prepared from P0 HAP1+/+and HAP1-/-animals as described previously (Mackenzie et al. 2016). For the transferrin-endocytosis assay, primary cortical neurons from HAP1-/-and HAP1+/+mice were prepared as described previously (Sun et al.

PT

2012, Wang et al. 2010). Briefly, mice pups at postnatal day 0 or 1 were humanely killed by decapitation and the whole brain was dissected. The meninges were removed and the cortex

RI

part was separated from each hemisphere. The separated tissues were digested with 2 ml of 0.5% trypsin/EDTA (Life Technology, Mulgrave, VIC, Australia) including 0.1% DNaseI

SC

(NEB, Ipswich, MA, USA) for 20 mins at 37ºC with gentle shaking every 5 mins, followed by passing through a 10ml serological pipette. After tissue debris settled down, the

NU

supernatant was transferred to new tube and centrifuged at 2,000 rpm for 2 mins at 4°C. Purified primary cortical neurons (2.5 x 104 cells) were seeded on 13mm coverslips (Thermo Fisher Scientific, Rockford, IL, USA) in cortical neuron culture media (Neurobasal medium

MA

containing B27 supplement (2%), L-glutamine (2 mM) and penicillin/streptomycin (100 IU/ml) (Life Technology, Mulgrave, VIC, Australia) and β-mercaptoethanol (0.1 mM)) and

D

incubated at 37ºC supplemented with 95% O2, 5% CO2 incubator for 72 hours. The

PT E

transferrin-endocytosis assay was performed as described previously (Fu et al. 2011) with minor modifications. Before transferrin-biotin treatment, neurons were incubated in neurobasal medium for 2 hours and media was changed to cortical neuron culture medium containing 5 μg/ml human transferrin-biotin (Sigma-Aldrich, St Louis, MO, USA) and

CE

incubated at 37ºC supplemented with 95% O2, 5% CO2 incubator for 30 mins. Neurons were then washed with ice-cold 1x PBS three times, ice-cold acid wash buffer (0.5M NaCl, 0.2M

AC

sodium acetate, pH 4.5) two times to remove membrane bound transferrin and ice-cold 1x PBS three times. Neurons were then fixed with 4% paraformaldehyde in 1 X PBS and subjected to immunocytochemistry with mouse anti-TuJ1 (1:200, Abcam, Cambridge, MA, USA) to detect beta tubulin III and streptavidin-Cy3 (1:500, Abcam, Cambridge, MA, USA) to detect transferrin-biotin. The images were taken by LSM 700 confocal microscope (Zeiss, Germany) and fluorescence intensity was analyzed by Image J software (NIH, Bethesda, MD, USA).

2.11 Immunocytochemistry and confocal imaging HEK293T cells grown in RPMI-1640 supplemented with 10% fetal calf serum and 1% 11

ACCEPTED MANUSCRIPT penicillin/streptomycin and grown at 37°C with 5% CO2 were seeded onto fibronectin coated coverslips. HEK293T were transiently transfected using FuGENE HD (Promega Promega, Madison, WI, USA) according to the manufacturer’s instructions. Twenty four hours following transfection, the cells were fixed in 4% paraformaldehyde for 10 mins at room temperature and permeabilized in 0.1% Triton X-100 in PBS for 2 mins. The primary antibodies goat anti-Myc and rabbit anti-GFP (both used at 1:500, Abcam, Cambridge, MA,

PT

USA) were diluted in 5% skim milk in PBS and incubated overnight at 4ºC. Following 3x 5 min washes in PBS secondary Alexa Fluor antibodies anti-rabbit 488 and anti-goat 568 (both used at 1:1000, Life Technology, VIC, Australia) were incubated for 2 hours at room

RI

temperature. Following 3x5 mins PBS washes, nuclear stain DAPI (Sigma-Aldrich, St

SC

Louis, MO, USA) was added and the cells were mounted in SlowFade® Gold antifade reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). All confocal images were

NU

acquired on a Zeiss LSM 700 confocal microscope.

2.12 Capacitance experiments

MA

Mouse chromaffin cells were prepared as previously described (Mackenzie et al. 2014). For capacitance measurements, whole-cell patch clamp recording was performed using an EPC-

D

10 patch clamp amplifier and PatchMaster software (HEKA Elektronik GmbH). Patch pipettes were pulled from borosilicate glass and fire polished, with resistance of 3–5 MΩ.

PT E

Patch clamping was performed in the perforated patch configuration for capacitance measurements, with internal solution containing 135 mM CsCl, 10 mM NaCl and 10 mM Hepes, adjusted to pH 7.2, and with 500 μg ml−1 amphotericin B. External solution contained 2.8 mM KCl,

CE

150 mM NaCl,

10 mM Hepes,

2 mM MgCl2,

10 mM CaCl2 and

10 mM glucose, adjusted to pH 7.4 with NaOH. Capacitance measurements utilized the

AC

Lock-in module of the PatchMaster software, with capacitance change measured in response to a pulse of 20 ms duration to 10 mV from a resting membrane potential of −80 mV. All experiments were carried out at room temperature (22–24°C).

2.13 Statistical analysis Data are shown as mean ± SEM. Statistical significance was evaluated using two-tailed unpaired t tests (GraphPad Prism 6). Statistical significance is indicated as *p<0.05 and ***p<0.001.

12

ACCEPTED MANUSCRIPT 3. Results 3.1 Affinity purification of HAP1-binding proteins To gain more clues about the physiological role of HAP1, this study used an affinity purification approach followed by mass spectrometry analysis to identify novel protein interacting partners of HAP1.The purified GST-HAP1 fusion proteins were used as “bait proteins” for a pull-down assay against rat brain homogenate. HAP1 interacting proteins were

PT

eluted from two experimental sepharose affinity columns bound to either HAP1 280-445 aa or HAP1 371-599 aa. Control columns with bound GST or beads alone were used

RI

simultaneously to prevent the identification of false positives. Following separation of the bound proteins on SDS-PAGE gels and MS-compatible silver staining, the uniquely

SC

identified protein bands which were present in the experimental columns but absent in the control columns were excised and digested with trypsin (Figure 1). The samples were

NU

analyzed by a Thermo Orbitrap XL linear ion trap mass spectrometer for protein identification and a number of novel HAP1-interacting proteins were identified, many of

MA

which have putative roles in intracellular trafficking. Known interacting partners of HAP1 like the 14-3-3 proteins were also identified. Table 1 lists the identities, accession numbers and functions of the high probability HAP1-interacting proteins as defined by the selection

PT E

D

criteria (refer Materials and Methods).

3.2 Identification of the clathrin light chain B as a HAP1-interacting protein by mass spectrometry analysis

CE

The clathrin light chain B (GenBank accession number P08082) was identified as a potential HAP1-binding protein by digestion and mass spectrometry analysis of a unique protein band

AC

from the affinity purification of binding proteins from rat brain homogenate using a truncated HAP1 (280-445aa) GST fusion protein. Seven clathrin-light chain B peptides were sequenced by MS analysis, five of which were unique peptides (in red) providing 23% sequence coverage (Figure 2A). Examples of two representative peptides are shown in Figure 2B.

3.3 Validation of clathrin-light chain B as a novel HAP1-interacting protein through coimmunoprecipitation, in vitro binding and imaging approaches HEK293T cells were co-transfected with HAP1A-myc and Clathrin light chain B (CLCb)YFP, lysed and immunoprecipitated with anti-GFP antibody bound to beads to pull down CLCb-YFP. Western blotting of the samples with an anti-HAP1 antibody showed specific

13

ACCEPTED MANUSCRIPT pull down of HAP1 with CLCb, with no bands present in the control (Figure 3A). To further test whether HAP1 interacts directly with clathrin light chain B, an in vitro binding assay was carried out. HAP1-GST (1-365 and 153-599aa) and control GST were bound to beads through which lysate from CLCb-YFP transfected HEK293T was incubated. Following several washes, the supernatant was subjected to western blotting with an anti-GFP antibody to detect CLCb-YFP. An interaction between CLCb and both the HAP1-GST fusion proteins

PT

were detected (lane 1 and lane 2) with no non-specific pull down of CLCb with GST alone (lane 3) (Figure 3B). Ponceau staining prior to probing the blot shows the presence of the GST proteins. It appears that the interaction between CLCb and HAP1 is stronger with the

RI

HAP1 fragment containing the 156-599aa region compared to the 1-365aa region (compare

SC

lanes 1 and 2 of Figure 3B), with the region between 280-335aa which is rich in coiled-coiled domains being the region shared between the HAP1 fragment used for the initial

NU

identification of CLCb as an interacting partner (280-445aa) and the two HAP1-fusion proteins used for the in vitro binding assay (1-365aa and 156-599aa) (Figure 3C). We also found that co-transfected HAP1-myc and CLCb-YFP in HEK293T cells co-localized in

MA

punctate regions using confocal microscopy (Figure 3D).

D

3.4 Loss of HAP1 decreases transferrin and vesicle endocytosis As clathrin light chain B is a component of the clathrin coat involved in endocytosis, this

PT E

study tested whether the loss of HAP1 had an effect on the endocytosis of transferrin, which is well characterized to undergo clathrin-dependant endocytosis. A transferrin-endocytosis assay in primary cortical neurons cultured from HAP1+/+ and HAP1-/- animals clearly showed

CE

a significant reduction in transferrin endocytosis in HAP1-/- cortical neurons (Figure 4). This data shows that HAP1 plays a role in endocytosis and the loss of the interaction between

AC

HAP1 and clathrin light chain B may underlie this defect. This phenomena was examined further by patch clamping adrenal chromaffin cells and utilizing a voltage pulse protocol known to elicit a small amount of exocytosis with a rapid endocytosis following. Using such an approach endocytosis was reliably observed to occur in HAP1+/+ cells (Figure 5A), but not in HAP1-/- cells over the period of observation. Across all of the recordings significant differences were observed in the return to baseline capacitance at both 10 and 15 seconds post-stimulus (Figure 5B).

14

ACCEPTED MANUSCRIPT 3.5 Identification and validation of Sec23A as an interacting partner of HAP1 Sec23A (Genbank accession number Q01405), an integral subunit of the COPII vesicle cages that function in endocytic trafficking was identified as a potential HAP1-binding protein in the proteomic screen for novel HAP-binding partners. Fourteen Sec23A peptides were sequenced by MS analysis, ten of which were unique peptides (in red) providing 30% sequence coverage (Figure 6A). Examples of two representative peptides are shown in Figure

PT

6B. With co-IP experiments using endogenous proteins the interaction between HAP1 and Sec23A was validated. An anti-Sec23A antibody is able to specifically precipitate endogenous HAP1 from rat brain homogenate (lane 6) with no non-specific bands detected in

RI

the controls (lanes 8 and 9) (Figure 6C). Anti-synapsin 1 antibody is also able to co-

SC

immunoprecipitate HAP1 (lane 5) and our group has reported on this interaction previously

NU

(Mackenzie et al. 2016).

MA

4. Discussion

HAP1 is thought to act either as a scaffold protein to stabilize large protein complexes or as a linker or adaptor protein facilitating vesicle attachment to molecular motors to enable vesicle

D

trafficking along microtubules (Wu & Zhou 2009). However, the intricacies regarding how

PT E

HAP1 may function in these capacities remain undetermined. Thus, this study aimed to discover novel interacting partners of HAP1 to gain more information regarding the normal physiological function of HAP1. Interestingly, the proportion of HAP1 interacting proteins

CE

identified with putative roles in trafficking, particularly in synaptic function, is considerably large given that using samples like whole brain tissue from rat typically results in quite a

AC

limited number of identified proteins from the synaptic vesicle fraction (Fountoulakis et al. 1999, Krapfenbauer et al. 2003). Some of the major HAP1 interacting partners identified include clathrin light chain B, Sec23A, synapsin 1, actin, collapsin response mediator protein 2 (CRMP2) and annexins A1 and A2. A previous study from our group has reported on the interaction between HAP1 and synapsin 1 and showed that loss of HAP1 causes disruptions to synapsin localization and transport (Mackenzie et al. 2016). As validation of the MS hits in this study, the interaction between HAP1 and clathrin light chain B and also with Sec23A was determined.

4.1 HAP1 interacts with clathrin light chain B

15

ACCEPTED MANUSCRIPT The interaction between HAP1 and clathrin light chain B is particularly interesting given that HAP1 is localized to clathrin-coated vesicles (Li et al. 1995), has been linked to endocytic protein trafficking (Mackenzie et al. 2016, Li et al. 2002, Li et al. 1995) and is involved in the endocytosis of membrane receptors (Wu and Zhou, 2009). HAP1 is also important in the endocytosis of membrane receptors, including EGF receptors (Li et al. 2003, Li et al. 2002) synaptic GABAA receptors (Kittler et al. 2004) and TrkB receptors (Lim et al. 2017) , all of

PT

which undergo clathrin-dependent endocytosis (Herring et al. 2003, Vieira et al. 1996, Zheng et al. 2008). The binding of HAP1 to the GABAA receptor stabilizes the internalized receptor and facilitates its recycling to the cell membrane. In line with this finding, HAP1

RI

overexpression increases GABAA receptor activity (Kittler et al. 2004). This study shows that

SC

the loss of HAP1 in cortical neurons significantly reduces the internalization of transferrin which is well characterized to occur through clathrin-dependant endocytosis. This finding

NU

demonstrates that HAP1 plays a role in endocytosis, possibly through its interaction with the clathrin light chain B. Also in support of a role in endocytosis, patch clamping experiments on HAP1-/- chromaffin cells illustrate a significant defect in the retrieval of secretory vesicles

MA

following their stimulated release. Release from chromaffin cells, like other non-neuronal cells, is similar in many ways to that in neurons (Thorn et al. 2016). Vesicle exocytosis and

D

endocytosis are inter-dependent and tightly linked. Multiple neurodegenerative disorders are associated with defects in both (Keating et al. 2012, Keating 2008) and aspects of this

PT E

signalling alter with age (Zanin et al. 2011). HAP1 is not the first protein to be associated with regulation of both vesicle exocytosis and endocytosis (Sudhof & Jahn 1991, Zanin et al. 2013, Keating et al. 2008).

CE

Single clathrin triskelia consists of the three clathrin heavy chains (CHCs), each of which are associated with either of the two clathrin light chains (CLCs) (CLCa and CLCb) in a 1:1

AC

stoichiometric ratio (Li et al. 2000a, Li et al. 2000b). CLCs are critical regulators for clathrinmediated trafficking between the trans-golgi and endosomal system via actin assembly regulation (Lumsden et al. 2016). Interestingly, huntingtin-interacting protein family members (mammalian Hip1 and Hip1R) also bind the CLCs to promote clathrin assembly (Thorn et al. 2016, Millar et al. 2002) which acts as a negative regulator for their interactions with actin (Keating 2008). The CLCs are positioned on the outside of the clathrin cage model based on electron cryomicroscopy studies (Zanin et al. 2011) allowing for their interaction with cytosolic proteins like HIP1R and perhaps HAP1. Furthermore, Htt is also involved in clathrin-mediated endocytosis and it is possible that Htt, HIP1 and HAP1 link clathrin-coated vesicles to the cytoskeleton (Sudhof & Jahn 1991). Both HAP1 and Htt have been localized 16

ACCEPTED MANUSCRIPT to spindle poles during mitosis (Zanin et al. 2013, Li et al. 1995) similar to clathrin (Yang et al. 2012, Lim et al. 2017, Wu & Zhou 2009) which has been ascribed a role in mitosis (Lim et al. 2017).

4.2 HAP1 interacts with Sec23A Co-immunoprecipitation experiments verified that HAP1 interacts with Sec23A, an integral

PT

subunit of the COPII vesicle cages. The COPII coatamer mediates trafficking between the ER to the downstream compartments of the secretory pathway and for cell surface delivery and endocytic pathways. Cranio-lenticulo-sutural dysplasia (CLSD) is a rare disease caused by a

RI

mutation in the Sec23A subunit which results in defective recruitment of Sec13-31 complex

SC

leading to defective ER to Golgi trafficking (Boyadjiev et al. 2006, Fromme et al. 2007). CLSD patients have abnormalities in skeletal development with malformations in their

NU

craniofacial structure (Boyadjiev et al. 2006). The affected regions in CLSD patients show insufficient levels of Sec23B to compensate for the loss of Sec23A function (Fromme et al. 2008). The COPII complex consists of at least five proteins: two heterodimers of Sec23-24

MA

and Sec13-Sec31 and a small GTPase Sar1. Sec23 also has GTPase activating protein (GAP) activity and hydrolyses the GTPase Sar1 allowing vesicle coat dissociation for fusion with

D

the target membrane (Yoshihisa et al. 1993, Antonny et al. 2001). The complex Sec23/24 interacts with cargo proteins exiting the ER directly or through adaptors (Dominguez et al.

PT E

1998, Matsuoka et al. 2001). The yeast Sec23A homologue, Sec23p is involved in the sorting of membrane cargos into a COPII (Aridor et al. 1998) and also interacts with the v-SNAREs Bet1p and Bos1p (Springer & Schekman 1998). Studies show that sorting of SNAREs into

CE

vesicles as they bud from the ER is mediated by the Sec23p/Sec24p coat complex. Interestingly, similar to HAP1, Sec23p interacts with the p150 subunit of dynactin (Watson et

AC

al. 2005) and is implicated in linking the microtubule motor to the vesicle membrane (Watson & Stephens 2006, Fromme et al. 2008). Sec23p sequentially interacts with different binding partners (tethering factors TRAPPI and GRASP65, and dynein-dynactin motor complex) to control the direction of ER-Golgi traffic and surprisingly, vesicle tethering, as it was presumed that tethering occurred after coat disassembly (Cai et al. 2007, Lord et al. 2011). Defects in the trafficking of APP between the ER and Golgi are observed in HAP1-/cortical neurons (Yang et al. 2012). Thus it is possible that the interaction between HAP1 and Sec23A allows for coupling between the coat of a budding vesicle and vesicle movement along microtubules from the ER to Golgi.

17

ACCEPTED MANUSCRIPT 4.3 Other potential HAP1 interactors- CRMP2, the annexins and actin This study identified several potential interacting partners of HAP1 and this section will discuss the functions of three of these trafficking-related proteins. The CRMP (collapsin response mediator protein) family is highly expressed in the developing nervous system and is homologous to the C.elegans UNC-33 (Herring et al. 2003, Zheng et al. 2008). Unc-33 mutants display severely uncoordinated movements and abnormalities in neuronal axon

PT

guidance and growth (Arimura & Kaibuchi 2007). CRMP2 directly binds to KLC1 (Kimura et al. 2005) and functions as a cargo adaptor, linking cargo vesicles or molecules with kinesin 1 similar to the putative role of HAP1 (Kawano et al 2005, Kimura et al 2005). CRMP2 is

RI

involved in the stabilization of the mitotic apparatus during cell division (Lin et al 2011),

SC

promoting neurite elongation and maintaining neuronal polarity (Inagaki et al 2001), regulating microtubule assembly (Fukata et al 2002), reorganization of actin filaments

NU

(Kawano et al 2005) and also binds to numb proteins involved in clathrin-mediated endocytosis (Berdnik et al 2002, Santolini et al 2000).

MA

The annexins are Ca2+ regulated phospholipid membrane binding proteins that have been implicated in cytoskeleton rearrangements and membrane trafficking events, particularly in

D

the processes of exocytosis, endocytosis and cell-to-cell adhesion (Gerke et al 2005, Gerke & Moss 2002, Moss & Morgan 2004, Raynal & Pollard 1994). The annexins A1 and A2 are

PT E

implicated in intracellular trafficking based on their association with plasma membrane phospholipids, vesicles and cytoskeletal proteins such as F-actin (Gerke et al 2005). Annexin A2 is an actin-binding and bundling protein (Jones et al 1992) that also binds to PIP2 in vivo

CE

(Hayes et al 2004, Rescher et al 2004) and promotes the formation of lipid microdomains required for Ca2+ regulated exocytosis of LDCVs (Chasserot-Golaz et al 2005). Annexin A2

AC

forms a part of the F-actin structures that act to transport newly endocytosed vesicles from the plasma membrane to the interior of the cell (Merrifield et al 1999). Interestingly, annexin A2 is implicated in membrane fusion and Ca2+ regulated exocytosis in permeabilized chromaffin cells (Ali et al 1989, Sarafian et al 1991). This protein is also involved in Ca 2+dependent aggregation of membranes (Gerke & Moss 2002), can facilitate in vitro membrane fusion (Drust & Creutz 1988, Raynor et al 1999, Regnouf et al 1995) and is also implicated in endocytosis (Emans et al 1993, Harder & Gerke 1993, Jost et al 1997). Annexin A1 is involved in multivesicular endosome biogenesis and in inward vesicle budding (Futter et al 1993).

18

ACCEPTED MANUSCRIPT Actin is involved in the modulation of pre- and postsynaptic terminals of the synapse. Actin is critical for the regulation of exocytosis and endocytosis. Actin maintains the RP and through synapsin interactions mediates SV translocation to the RRP (Cingolani & Goda 2008, Greengard et al 1994, Hilfiker et al 1999, Jensen et al 2007). Actin has also been implicated in positively regulating the size of the RRP by guiding vesicle docking at the active zone (Cingolani & Goda 2008). Actin may also regulate SV endocytosis with

PT

dynamin, Abp1 and synapsin (Bloom et al 2003, Dillon & Goda 2005, Engqvist-Goldstein & Drubin 2003, Evergren et al 2007, Kessels et al 2001, Shupliakov et al 2002). Actin anchors receptors to the postsynaptic density (Kuriu et al 2006) with studies implicating actin in the

SC

RI

trafficking of receptors (Zhou et al 2001).

5. Conclusions

This study used a proteomics approach to identify an array of HAP1-binding proteins

NU



in rat brain, all associated with vesicle trafficking, exocytosis or endocytosis. This study has validated the interaction between HAP1 and clathrin light chain B and

MA



HAP1 and Sec23A, and that HAP1 and that clathrin light chain B co-localise. 

This study demonstrates functional implications for such interactions as the deletion

D

of HAP1 reduced clathrin-dependant transferrin endocytosis as well as vesicle 

PT E

endocytosis.

Thus, HAP1 plays a significant role in endocytosis through its interaction with the major endocytosis protein clathrin and likely regulates cell signalling through

AC

CE

numerous other interactions with trafficking-related proteins.

The authors declare no conflict of interest.

Acknowledgements This work was supported by the Australian Research Council (ARC) Discovery Grant (DP110105101) and NHMRC Career Development Fellowship to DJK. We thank Prof. Christopher A. Ross (John Hopkins Medicine, Baltimore, US) and Prof. Josef Kittler (University College London, London, UK) for the gift of the HAP1-PC43 (280-445aa) construct and GST-HAP1 construct (371-599 aa), respectively.

19

ACCEPTED MANUSCRIPT Table 1: Mass spectrometric analysis of HAP1 interacting proteins. The most abundant proteins in each band are listed in descending order with the major interacting partners emphasized in bold. Known binding partner is highlighted in gray. The proteins found in bands 1, 2 and 3 interact with HAP1 in the 280-445 aa region while those in bands 4 and 5 interact with HAP1 between 371-599 aa.

Band number

Accession

Protein name

T P

Function

I R

# significant unique peptide matches

SC

1

P09951

Synapsin 1

reserve pool regulation/endocytosis

1

Q9EPH8

Polyadenylate-binding protein 1

RNA processing

1

P16884

Neurofilament heavy polypeptide

1

P55063

Heat shock 70 kDa protein 1-like

1

P9495

Tropomyosin alpha-4 chain

1

P47942

collapsin response mediator protein-2

2

Q01405

Protein transport protein Sec23A

2

P07150

2

Sequence coverage %

18

58.4

8

21.7

Neurofilament fiber

2

7.2

chaperone

2

14.5

Actin binding protein

2

21

Microtubule associated, axonal growth and guidance, endocytotic pathway

2

13.3

component COPII vesicle coat, trafficking

10

30

Annexin A1

plasma membrane phospholipids linkage with actin and cytoskeleton

6

22.8

P16884

Neurofilament heavy polypeptide

Neurofilament fiber

2

9.1

2

P63259

Actin

cytoskeleton

9

50.9

2

Q07936

Annexin A2

plasma membrane phospholipids linkage with actin and cytoskeleton, exocytosis

5

22.4

U N

T P E

D E

C C

A

A M

20

ACCEPTED MANUSCRIPT Band number

Accession

Protein name

Function

# significant unique peptide matches

Sequence coverage %

2

P04797

8.4

P62989

glycolytic enzyme, GABAA receptor kinase Multi-functional protein

2

2

Glyceraldehyde-3-phosphate dehydrogenase Ubiquitin

2

P62804

Histone H4

developmental protein

2

P07824

Arginase-1

neurotrophic protein

2

P63102

14-3-3 protein zeta/delta

Multifunctional regulatory protein

2

P62630

Elongation factor 1-alpha 1

2

Q641Y8

ATP-dependent RNA helicase DDX1

3

P08082

Clathrin light chain B

3 3

Q07936 P54311

3

P09330

Annexin A2 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 Ribose-phosphate pyrophosphokinase 2

4

Q07936

4

P07150

4

P60711

4

P62630

4

P07824

4 5

T P 4

59.2

3

27.2

2

5.9

2

26.1

cytoskeleton dynamics, protein translation helicase, transcriptional co-activator

2

14.1

3

6.2

Endocytosis

5

23.1

2 2

9.4 13.2

3

23

plasma membrane phospholipids linkage with actin and cytoskeleton, exocytosis plasma membrane phospholipids linkage with actin and cytoskeleton, exocytosis cytoskeleton

5

29.5

4

14.5

5

26.4

2

10.2

Arginase-1

cytoskeleton dynamics, protein translation Neurotrophic protein

2

14.6

P16884

Neurofilament heavy polypeptide

Neurofilament fiber

2

11.8

Q07936

Annexin A2

plasma membrane phospholipids linkage with actin and cytoskeleton, exocytosis

3

13.9

C S U

N A

T P E

C C

Annexin A1

A

Actin, cytoplasmic 1

Elongation factor 1-alpha 1

M

plasma membrane phospholipids linkage with actin and cytoskeleton, exocytosis G protein subunit, signal transducer activity nucleotide synthesis pathway

D E

Annexin A2

I R

21

ACCEPTED MANUSCRIPT 5

P07824

Ubiquitin

Multi-functional protein

2

52.6

T P

I R

C S U

N A

D E

M

T P E

C C

A

22

ACCEPTED MANUSCRIPT Figure Legends: Figure 1: Pull-down of potential HAP1 interacting partners. Equal amounts of rat brain homogenate was passed through a sepharose columns bound to either HAP1 280-445 aa, HAP1 371-599 aa and controls GST and no attached protein. Bound proteins were eluted in ten elution fractions. The elution fractions (E1-E10) were run on a SDS-PAGE gel for (A) HAP1 280-445 aa (B) HAP1 371-599 aa, (C) GST and (D) no attached protein along with a

PT

protein marker (M) and were silver stained with a mass spectrometry compatible protocol which enabled the identification of unique protein bands (in boxes 1-5). The bands were

RI

excised, digested with trypsin, and the digested peptides were analyzed with a Thermo

SC

Orbitrap XL linear ion trap mass spectrometer.

NU

Figure 2: Identification of clathrin light chain B as a HAP1-interacting protein by MS analysis. (A) Clathrin light chain B peptide sequence coverage map showing the sequence

MA

fragments identified by MS/MS spectra in red and underlined. (B) The MS/MS spectra of two representative peptides sequences by the Thermo Orbitrap XL mass spectrometer. The b (blue) and y (red) ion series for the peptides are shown. For peptide EETPGTEWEK the

D

precursor ion m/z, charge state and ion score was 1204.5248 Da, 2 and 23, respectively. For

PT E

peptide VTEQEWR the precursor ion m/z, charge state and peptide probability was 946.4508

CE

Da, 2 and 38, respectively.

Figure 3: HAP1 interacts and co-localizes with clathrin light chain B in vitro. (A) Coimmunoprecipitation assay in transfected HEK293T cells shows pull down of HAP1-myc

AC

with clathrin light chain B-YFP using anti-GFP antibody bound to beads. (B) Incubation of clathrin-light chain B-YFP transfected lysate with HAP1-GST-bound beads prepared with fragments 1-365aa and 156-599aa shows pull down of clathrin-light chain B with both fragments with an absence of non-specific interaction with GST alone. Arrows indicate the GST fusion proteins in the Ponceau stained membrane. (C) Schematic diagram of the structure of HAP1 showing the fragments able to interact with clathrin-light chain B. Region 280-335aa rich in coiled-coiled domains is shared among all truncated proteins and mediates HAP1 binding to clathrin-light chain B. (D) Confocal images showing co-localization of

23

ACCEPTED MANUSCRIPT HAP1-myc and CLCb-YFP in transfected HEK293T cells. HAP1 and CLCb staining is punctate and they colocalize, particularly in the perinuclear region. Scale bar=5µm.

Figure 4: The loss of HAP1 decreases clathrin-mediated endocytosis in cortical neurons. The endocytosis of transferrin which is clathrin-dependant is significantly decreased in cortical neurons from HAP1-/- mice compared to HAP1+/+ mice. (A) Cortical neurons were

PT

incubated with transferrin-biotin and immunostained for transferrin (red), TUJ1 (green) as immature neuronal marker and DAPI (blue). Scale bar=5µm. (B) Bar graphs indicating mean

RI

fluorescence intensity of endocytosed transferrin. Data are represented as mean ± SEM (n=4

NU

SC

per group, Student’s t-test, ***p < 0.001).

Figure 5: HAP1 regulates vesicle endocytosis. (A) Capacitance traces in single chromaffin cells demonstrate endocytosis is reduced in HAP1-/- cells. A single voltage pulse (20ms

MA

duration from -80mV to 10mV) triggers a small but equitable amount of exocytosis in HAP1+/+ and HAP1-/- chromaffin cells. The exocytosis-mediated increase in membrane

D

capacitance occurring during stimulation is observed to reverse in HAP1+/+ but not HAP1-/cells, indicating a defect in endocytosis in the absence of HAP1. This is quantified across all

PT E

recordings. (B) There is significantly less membrane retrieval in the HAP1-/- cells at 10 and 15s post-stimulation . Data are represented as mean ± SEM, *p<0.05. Data from > 3 separate

CE

cell cultures and n=9 HAP1+/+ and n=6 HAP1-/-.

AC

Figure 6: Sec23A is validated to be a HAP1-interacting protein. (A) Sec23A peptide sequence coverage map showing the sequence fragments identified by MS/MS spectra in red and underlined. (B) The MS/MS spectra of two representative peptides sequences by the Thermo Orbitrap XL mass spectrometer. The b (blue) and y (red) ion series for the peptides are shown. For peptide GPQVQQPPPSNR the precursor ion m/z, charge state and peptide probability was 652.8 Da, 2 and 51.4, respectively. For peptide MGFGGTLEIK the precursor ion m/z, charge state and peptide probability was 526.7 Da, 2 and 25.35, respectively. (C) Endogenous Sec23A co-immunoprecipitates HAP1. Precleared rat brain homogenate endogenously enriched with neuronal HAP1 was incubated with Sec23A antibody or nonspecific control antibody bound to protein G agarose beads or beads alone. After extensive

24

ACCEPTED MANUSCRIPT washes, the bound proteins were eluted, separated on a SDS-PAGE gel and probed for HAP1. The two bands visible in the input lanes correspond to the two isoforms of HAP1; HAP1-A and HAP1-B. A previous study by our group has shown that HAP1 interacts with synapsin 1

AC

CE

PT E

D

MA

NU

SC

RI

PT

(Syn1) and non-specific bands are absent in control IP lanes.

25

ACCEPTED MANUSCRIPT References

AC

CE

PT E

D

MA

NU

SC

RI

PT

Antonny, B., Madden, D., Hamamoto, S., Orci, L. and Schekman, R. (2001) Dynamics of the COPII coat with GTP and stable analogues. Nat Cell Biol, 3, 531-537. Aridor, M., Weissman, J., Bannykh, S., Nuoffer, C. and Balch, W. E. (1998) Cargo selection by the COPII budding machinery during export from the ER. J Cell Biol, 141, 61-70. Arimura, N. and Kaibuchi, K. (2007) Neuronal polarity: from extracellular signals to intracellular mechanisms. Nat Rev Neurosci, 8, 194-205. Boyadjiev, S. A., Fromme, J. C., Ben, J. et al. (2006) Cranio-lenticulo-sutural dysplasia is caused by a SEC23A mutation leading to abnormal endoplasmic-reticulum-to-Golgi trafficking. Nat Genet, 38, 1192-1197. Cai, H., Yu, S., Menon, S., Cai, Y., Lazarova, D., Fu, C., Reinisch, K., Hay, J. C. and FerroNovick, S. (2007) TRAPPI tethers COPII vesicles by binding the coat subunit Sec23. Nature, 445, 941-944. Cape, A., Chen, X., Wang, C. E. et al. (2012) Loss of huntingtin-associated protein 1 impairs insulin secretion from pancreatic beta-cells. Cell Mol Life Sci, 69, 1305-1317. Chin, L. S., Raynor, M. C., Wei, X., Chen, H. Q. and Li, L. (2001) Hrs interacts with sorting nexin 1 and regulates degradation of epidermal growth factor receptor. J Biol Chem, 276, 7069-7078. Clague, M. J. and Urbe, S. (2003) Hrs function: viruses provide the clue. Trends Cell Biol, 13, 603-606. Dominguez, M., Dejgaard, K., Fullekrug, J., Dahan, S., Fazel, A., Paccaud, J. P., Thomas, D. Y., Bergeron, J. J. and Nilsson, T. (1998) gp25L/emp24/p24 protein family members of the cis-Golgi network bind both COP I and II coatomer. J Cell Biol, 140, 751-765. Engelender, S., Sharp, A. H., Colomer, V., Tokito, M. K., Lanahan, A., Worley, P., Holzbaur, E. L. and Ross, C. A. (1997) Huntingtin-associated protein 1 (HAP1) interacts with the p150Glued subunit of dynactin. Hum Mol Genet, 6, 2205-2212. Fountoulakis, M., Schuller, E., Hardmeier, R., Berndt, P. and Lubec, G. (1999) Rat brain proteins: two-dimensional protein database and variations in the expression level. Electrophoresis, 20, 3572-3579. Fromme, J. C., Orci, L. and Schekman, R. (2008) Coordination of COPII vesicle trafficking by Sec23. Trends Cell Biol, 18, 330-336. Fromme, J. C., Ravazzola, M., Hamamoto, S., Al-Balwi, M., Eyaid, W., Boyadjiev, S. A., Cosson, P., Schekman, R. and Orci, L. (2007) The genetic basis of a craniofacial disease provides insight into COPII coat assembly. Dev Cell, 13, 623-634. Fu, X., Yang, Y., Xu, C., Niu, Y., Chen, T., Zhou, Q. and Liu, J. J. (2011) Retrolinkin cooperates with endophilin A1 to mediate BDNF-TrkB early endocytic trafficking and signaling from early endosomes. Mol Biol Cell, 22, 3684-3698. Herring, D., Huang, R., Singh, M., Robinson, L. C., Dillon, G. H. and Leidenheimer, N. J. (2003) Constitutive GABAA receptor endocytosis is dynamin-mediated and dependent on a dileucine AP2 adaptin-binding motif within the beta 2 subunit of the receptor. J Biol Chem, 278, 24046-24052. Huang, P. T., Chen, C. H., Hsu, I. U., Salim, S. A., Kao, S. H., Cheng, C. W., Lai, C. H., Lee, C. F. and Lin, Y. F. (2015) Huntingtin-associated protein 1 interacts with breakpoint cluster region protein to regulate neuronal differentiation. PLoS One, 10, e0116372. Jacob, T. C., Moss, S. J. and Jurd, R. (2008) GABA(A) receptor trafficking and its role in the dynamic modulation of neuronal inhibition. Nat Rev Neurosci, 9, 331-343. Keating, D. J. (2008) Mitochondrial dysfunction, oxidative stress, regulation of exocytosis and their relevance to neurodegenerative diseases. J Neurochem, 104, 298-305.

26

ACCEPTED MANUSCRIPT

AC

CE

PT E

D

MA

NU

SC

RI

PT

Keating, D. J., Dubach, D., Zanin, M. P. et al. (2008) DSCR1/RCAN1 regulates vesicle exocytosis and fusion pore kinetics: implications for Down syndrome and Alzheimer's disease. Hum Mol Genet, 17, 1020-1030. Keating, D. J., Winter, M. A., Hemsley, K. M., Mackenzie, K. D., Teo, E. H., Hopwood, J. J., Brooks, D. A. and Parkinson-Lawrence, E. J. (2012) Exocytosis is impaired in mucopolysaccharidosis IIIA mouse chromaffin cells. Neuroscience, 227, 110-118. Kimura, T., Watanabe, H., Iwamatsu, A. and Kaibuchi, K. (2005) Tubulin and CRMP-2 complex is transported via Kinesin-1. J Neurochem, 93, 1371-1382. Kittler, J. T., Chen, G., Honing, S. et al. (2005) Phospho-dependent binding of the clathrin AP2 adaptor complex to GABAA receptors regulates the efficacy of inhibitory synaptic transmission. Proc Natl Acad Sci U S A, 102, 14871-14876. Kittler, J. T., Delmas, P., Jovanovic, J. N., Brown, D. A., Smart, T. G. and Moss, S. J. (2000) Constitutive endocytosis of GABAA receptors by an association with the adaptin AP2 complex modulates inhibitory synaptic currents in hippocampal neurons. J Neurosci, 20, 7972-7977. Kittler, J. T., Thomas, P., Tretter, V., Bogdanov, Y. D., Haucke, V., Smart, T. G. and Moss, S. J. (2004) Huntingtin-associated protein 1 regulates inhibitory synaptic transmission by modulating gamma-aminobutyric acid type A receptor membrane trafficking. Proc Natl Acad Sci U S A, 101, 12736-12741. Komada, M., Masaki, R., Yamamoto, A. and Kitamura, N. (1997) Hrs, a tyrosine kinase substrate with a conserved double zinc finger domain, is localized to the cytoplasmic surface of early endosomes. J Biol Chem, 272, 20538-20544. Krapfenbauer, K., Fountoulakis, M. and Lubec, G. (2003) A rat brain protein expression map including cytosolic and enriched mitochondrial and microsomal fractions. Electrophoresis, 24, 1847-1870. Li, S. H., Gutekunst, C. A., Hersch, S. M. and Li, X. J. (1998) Interaction of huntingtinassociated protein with dynactin P150Glued. J Neurosci, 18, 1261-1269. Li, S. H., Lam, S., Cheng, A. L. and Li, X. J. (2000a) Intranuclear huntingtin increases the expression of caspase-1 and induces apoptosis. Hum Mol Genet, 9, 2859-2867. Li, S. H., Li, H., Torre, E. R. and Li, X. J. (2000b) Expression of huntingtin-associated protein-1 in neuronal cells implicates a role in neuritic growth. Mol Cell Neurosci, 16, 168-183. Li, S. H., Yu, Z. X., Li, C. L., Nguyen, H. P., Zhou, Y. X., Deng, C. and Li, X. J. (2003) Lack of huntingtin-associated protein-1 causes neuronal death resembling hypothalamic degeneration in Huntington's disease. J Neurosci, 23, 6956-6964. Li, X. J., Li, S. H., Sharp, A. H., Nucifora, F. C., Jr., Schilling, G., Lanahan, A., Worley, P., Snyder, S. H. and Ross, C. A. (1995) A huntingtin-associated protein enriched in brain with implications for pathology. Nature, 378, 398-402. Li, X. J., Sharp, A. H., Li, S. H., Dawson, T. M., Snyder, S. H. and Ross, C. A. (1996) Huntingtin-associated protein (HAP1): discrete neuronal localizations in the brain resemble those of neuronal nitric oxide synthase. Proc Natl Acad Sci U S A, 93, 48394844. Li, Y., Chin, L. S., Levey, A. I. and Li, L. (2002) Huntingtin-associated protein 1 interacts with hepatocyte growth factor-regulated tyrosine kinase substrate and functions in endosomal trafficking. J Biol Chem, 277, 28212-28221. Lim, Y., Wu, L. L., Chen, S. et al. (2017) HAP1 Is Required for Endocytosis and Signalling of BDNF and Its Receptors in Neurons. Mol Neurobiol. Lin, Y. F., Xu, X., Cape, A., Li, S. and Li, X. J. (2010) Huntingtin-associated protein-1 deficiency in orexin-producing neurons impairs neuronal process extension and leads to abnormal behavior in mice. J Biol Chem, 285, 15941-15949.

27

ACCEPTED MANUSCRIPT

AC

CE

PT E

D

MA

NU

SC

RI

PT

Lord, C., Bhandari, D., Menon, S., Ghassemian, M., Nycz, D., Hay, J., Ghosh, P. and FerroNovick, S. (2011) Sequential interactions with Sec23 control the direction of vesicle traffic. Nature, 473, 181-186. Lumsden, A. L., Young, R. L., Pezos, N. and Keating, D. J. (2016) Huntingtin-associated protein 1: Eutherian adaptation from a TRAK-like protein, conserved gene promoter elements, and localization in the human intestine. BMC Evol Biol, 16, 214. Mackenzie, K. D., Duffield, M. D., Peiris, H., Phillips, L., Zanin, M. P., Teo, E. H., Zhou, X. F. and Keating, D. J. (2014) Huntingtin-associated protein 1 regulates exocytosis, vesicle docking, readily releasable pool size and fusion pore stability in mouse chromaffin cells. J Physiol, 592, 1505-1518. Mackenzie, K. D., Lumsden, A. L., Guo, F., Duffield, M. D., Chataway, T., Lim, Y., Zhou, X. F. and Keating, D. J. (2016) Huntingtin-associated protein-1 is a synapsin Ibinding protein regulating synaptic vesicle exocytosis and synapsin I trafficking. J Neurochem, 138, 710-721. Matsuoka, K., Schekman, R., Orci, L. and Heuser, J. E. (2001) Surface structure of the COPII-coated vesicle. Proc Natl Acad Sci U S A, 98, 13705-13709. McGuire, J. R., Rong, J., Li, S. H. and Li, X. J. (2006) Interaction of Huntingtin-associated protein-1 with kinesin light chain: implications in intracellular trafficking in neurons. J Biol Chem, 281, 3552-3559. Mele, M., Aspromonte, M. C. and Duarte, C. B. (2017) Downregulation of GABAA Receptor Recycling Mediated by HAP1 Contributes to Neuronal Death in In Vitro Brain Ischemia. Mol Neurobiol, 54, 45-57. Millar, A. L., Pavios, N. J., Xu, J. and Zheng, M. H. (2002) Rab3D: a regulator of exocytosis in non-neuronal cells. Histol Histopathol, 17, 929-936. Raiborg, C., Bremnes, B., Mehlum, A., Gillooly, D. J., D'Arrigo, A., Stang, E. and Stenmark, H. (2001) FYVE and coiled-coil domains determine the specific localisation of Hrs to early endosomes. J Cell Sci, 114, 2255-2263. Rong, J., McGuire, J. R., Fang, Z. H., Sheng, G., Shin, J. Y., Li, S. H. and Li, X. J. (2006) Regulation of intracellular trafficking of huntingtin-associated protein-1 is critical for TrkA protein levels and neurite outgrowth. J Neurosci, 26, 6019-6030. Springer, S. and Schekman, R. (1998) Nucleation of COPII vesicular coat complex by endoplasmic reticulum to Golgi vesicle SNAREs. Science, 281, 698-700. Sudhof, T. C. and Jahn, R. (1991) Proteins of synaptic vesicles involved in exocytosis and membrane recycling. Neuron, 6, 665-677. Sun, Y., Lim, Y., Li, F., Liu, S., Lu, J. J., Haberberger, R., Zhong, J. H. and Zhou, X. F. (2012) ProBDNF collapses neurite outgrowth of primary neurons by activating RhoA. PLoS One, 7, e35883. Thorn, P., Zorec, R., Rettig, J. and Keating, D. J. (2016) Exocytosis in non-neuronal cells. J Neurochem, 137, 849-859. Twelvetrees, A. E., Yuen, E. Y., Arancibia-Carcamo, I. L. et al. (2010) Delivery of GABAARs to synapses is mediated by HAP1-KIF5 and disrupted by mutant huntingtin. Neuron, 65, 53-65. Vieira, A. V., Lamaze, C. and Schmid, S. L. (1996) Control of EGF receptor signaling by clathrin-mediated endocytosis. Science, 274, 2086-2089. Wang, Y. J., Valadares, D., Sun, Y. et al. (2010) Effects of proNGF on neuronal viability, neurite growth and amyloid-beta metabolism. Neurotox Res, 17, 257-267. Watson, P., Forster, R., Palmer, K. J., Pepperkok, R. and Stephens, D. J. (2005) Coupling of ER exit to microtubules through direct interaction of COPII with dynactin. Nat Cell Biol, 7, 48-55.

28

ACCEPTED MANUSCRIPT

AC

CE

PT E

D

MA

NU

SC

RI

PT

Watson, P. and Stephens, D. J. (2006) Microtubule plus-end loading of p150(Glued) is mediated by EB1 and CLIP-170 but is not required for intracellular membrane traffic in mammalian cells. J Cell Sci, 119, 2758-2767. Wu, L. L. and Zhou, X. F. (2009) Huntingtin associated protein 1 and its functions. Cell Adh Migr, 3, 71-76. Yang, G. Z., Yang, M., Lim, Y., Lu, J. J., Wang, T. H., Qi, J. G., Zhong, J. H. and Zhou, X. F. (2012) Huntingtin associated protein 1 regulates trafficking of the amyloid precursor protein and modulates amyloid beta levels in neurons. J Neurochem, 122, 1010-1022. Yoshihisa, T., Barlowe, C. and Schekman, R. (1993) Requirement for a GTPase-activating protein in vesicle budding from the endoplasmic reticulum. Science, 259, 1466-1468. Yuen, E. Y., Wei, J., Zhong, P. and Yan, Z. (2012) Disrupted GABAAR trafficking and synaptic inhibition in a mouse model of Huntington's disease. Neurobiol Dis, 46, 497502. Zanin, M. P., Mackenzie, K. D., Peiris, H., Pritchard, M. A. and Keating, D. J. (2013) RCAN1 regulates vesicle recycling and quantal release kinetics via effects on calcineurin activity. J Neurochem, 124, 290-299. Zanin, M. P., Phillips, L., Mackenzie, K. D. and Keating, D. J. (2011) Aging differentially affects multiple aspects of vesicle fusion kinetics. PLoS One, 6, e27820. Zheng, J., Shen, W. H., Lu, T. J. et al. (2008) Clathrin-dependent endocytosis is required for TrkB-dependent Akt-mediated neuronal protection and dendritic growth. J Biol Chem, 283, 13280-13288.

29

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

30

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

31

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

32

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

33

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

34

AC

CE

PT E

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

35

ACCEPTED MANUSCRIPT Highlights Multiple trafficking-related proteins are identified as binding partners of HAP1



This includes binding to, and co-localization with, clathrin light chain B



We demonstrate that HAP1 regulates receptor-mediated and vesicle endocytosis

AC

CE

PT E

D

MA

NU

SC

RI

PT



36