Identification and expression analysis of early cold-induced genes from cold-hardy Citrus relative Poncirus trifoliata (L.) Raf.

Identification and expression analysis of early cold-induced genes from cold-hardy Citrus relative Poncirus trifoliata (L.) Raf.

Gene 512 (2013) 536–545 Contents lists available at SciVerse ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Short Communication ...

422KB Sizes 0 Downloads 1 Views

Recommend Documents

No documents
Gene 512 (2013) 536–545

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Short Communication

Identification and expression analysis of early cold-induced genes from cold-hardy Citrus relative Poncirus trifoliata (L.) Raf. Mehtap Şahin-Çevik ⁎ Department of Agricultural Biotechnology, Süleyman Demirel University, Isparta 32260, Turkey

a r t i c l e

i n f o

Article history: Accepted 13 September 2012 Available online 29 September 2012 Keywords: Citrus Early cold response Cold acclimation Gene expression Poncirus Subtractive hybridization

a b s t r a c t Citrus is one of the most economically important fruit crops growing in subtropical and tropical regions. Most commercially important Citrus varieties are susceptible to cold; therefore, low and freezing temperatures are the main limiting factors for citrus production in subtropical areas. Since Poncirus trifoliata (L.) Raf. is a cold-hardy, interfertile Citrus relative, it serves as a genetic resource for improving cold tolerance in cold sensitive commercial Citrus species. While gene induced in response to long-term cold acclimation was previously identified in Poncirus, early response of Poncirus to cold has not been explored in detail. To identify early cold-responsive genes, a subtractive cDNA library was constructed using 4-h cold-treated and untreated control Poncirus seedlings in this study. A total of 210 randomly picked clones from the subtracted library with cold-induced genes were sequenced. The sequences obtained from the majority of these clones shared homology with previously identified cold-induced and/or environmental stress-regulated genes in other plants. Reverse northern blot analysis of the expression of these cDNAs with cold-treated and untreated control probes revealed that expression of 64 cDNAs was increased two to 11 fold in response to 4-h cold treatment. While the majority of these genes were related with cell rescue, defense, cell death and aging, transcription, metabolism, protein fate, energy, cellular communication and signal transduction, transport facilitation and development, some of them did not show homology with genes with known functions. Individual expression analysis of nine selected genes by semi-quantitative RT-PCR using mRNA from cold-treated and untreated control plants confirmed that the expression of selected cDNAs was all induced in response to cold. The results demonstrated that although a few genes were commonly induced in response to both short and long-term cold acclimation in Poncirus, majority of early cold-responsive genes were different from previously identified late cold-responsive genes in Poncirus. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Agricultural production is adversely affected by unfavorable environmental conditions. Low temperature is one of the environmental conditions negatively affecting plant growth and development;

Abbreviations: SSH, suppression subtractive hybridization; CLT, citrus low temperature genes; cDNA, complementary DNA; RT-PCR, reverse-transcription polymerase chain reaction; qRT-PCR, quantitative RT-PCR; IPTG, isopropyl β-D-thiogalactopyranoside; X-gal, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; GYG2, glycogen 2; TNNT1, troponin T type 1; CT, cold-treated; UT, untreated; AS, ATP synthase; DIG, digoxigenin; SSC, saline-sodium citrate; SDS, sodium dodecyl sulfate; AP2/ERF, apetala2/ethylene response factor; EREBP, ethylene responsive element binding protein; bZIP, basic leucine zipper domain; EST, expressed sequence; ABA, abscisic acid; GRP, glycine-rich protein; NBS-LRR, nucleotide-binding site-leucine-rich repeat; LOX, lipoxygenase; CAF1, CCR4 associated factor 1; PR, pathogenesis-related; SOD, superoxide dismutase; APX, ascorbate peroxidase; GPX, glutathione peroxidase; CAT, catalase; RUBISCO, the ribulose-1,5-bisphosphate carboxylase/oxygenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PI, proteinase inhibitors; HSPs, heat shock proteins; LEA, late embryogenesis abundant proteins. ⁎ Tel.: +90 246 211 4737; fax: +90 246 237 1693. E-mail address: [email protected] 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.09.084

therefore, plants have developed different mechanisms to survive in low temperature condition. Cold acclimation is one of the mechanisms by which exposure to low non-freezing temperatures below 10 °C increases plant's tolerance to subsequent freezing temperatures (Thomashow, 1998). During cold acclimation, a series of measurable physiological and biochemical changes takes place in plants which results from induction or repression of specific gene expressions (Guy, 1990). Studies involving macroarray and microarray analysis showed that several hundred genes were regulated during cold acclimation in plants. A number of cold-regulated genes have been identified and characterized in the model plant Arabidopsis and several agriculturally important crops including rice (Rabbani et al., 2003), potato (Rensink et al., 2005), pepper (Hwang et al., 2005), sugarcane (Nogueira et al., 2003), chickpea (Mantri et al., 2007), maize (Nguyen et al., 2009), sunflower (Fernandez et al., 2008) and citrus (Şahin-Çevik and Moore, 2006a). These genes are involved in a variety of cellular functions including metabolism, transcription, protein fate, transport facilitation, biogenesis, communications and signal transduction, cell rescue and defense, and cell death and aging. Identification of these genes not only provides understanding of cold

M. Şahin-Çevik / Gene 512 (2013) 536–545

tolerance, but also allows the development of strategies for the improvement of cold-tolerant plants. Citrus is an economically important fruit crop grown in tropical and subtropical regions of the world. Since most commercial Citrus types are susceptible to low temperature, production of citrus is mostly limited by low temperature outside and even within these regions. Significant economical losses due to low freezing temperatures have been reported in subtropical citrus growing regions in the last century. Therefore, development of a cold-tolerant citrus variety has been one of the main objectives of citrus industry. Since Poncirus trifoliata which is a cold-hardy interfertile Citrus relative that can withstand temperatures of − 26 °C when it is fully cold-acclimated (Yelenosky, 1985), a number of crosses have been made between Poncirus and Citrus to integrate the cold hardiness trait into commercial Citrus varieties (Gmitter et al., 1992; Soost and Cameron, 1975). However, production of cold resistant or tolerant Citrus cultivars or rootstocks with acceptable horticultural characteristics has not been achieved up to date. To understand the molecular bases of cold tolerance in P. trifoliata, a few studies were conducted using molecular biology techniques in the last two decades. Cai et al. (1995) initiated identification of cold-induced gene in P. trifoliata and isolated six cold-induced genes, mostly encoding dehydrins from cDNA libraries of cold-acclimated and non-acclimated P. trifoliata seedlings. However, since cold response and acclimation are controlled by many genes, further studies were conducted for identification of more coldregulated genes using cold-stressed plants and control plants and applying different methods and techniques. Two citrus low temperature genes (CLT), called CLTa and CLTb were isolated from Poncirus by exposing plants from 28 °C to − 5 °C temperatures (Jia et al., 2004). However, it was later found that the expression of CLTa gene was not detected in cold-hardy Satsuma mandarin (Citrus unshiu) or cold-sensitive Mexican lime (Citrus aurantifolia) plants (Robbins and Louzada, 2005). Zhang et al. (2005a,b) identified eight cold-induced and six down-regulated genes from P. trifoliata using differential display method under gradual cold-acclimation temperature regime. Additionally, six cold-induced genes were identified from C. unshiu using mRNA differential display under the same temperature regime (Lang et al., 2005). In a more comprehensive study, about a hundred cold-induced genes were identified from 2-day cold-acclimated P. trifoliata plants using a suppression subtractive hybridization (SSH) method (Şahin-Çevik and Moore, 2006a). Genes identified in that study showed similarities with previously identified coldinduced and/or environmental stress-regulated genes in Arabidopsis and other herbaceous and woody perennial plants and gave some insight into cold tolerance mechanisms of P. trifoliata. Furthermore, cDNA-AFLP method was applied for identification of genes induced in response to 55 h low temperature treatment at 4 °C and the expression of 13 differentially expressed genes was studied in response to 10, 24 and 55 h of low temperature treatment at 4 °C using qRT-PCR. The results showed that expression of selected genes showed differential response to cold-acclimation and cold treatment at 4 °C (Meng et al., 2008). More recently, 105 cold-induced and 117 cold-repressed genes were identified from a cDNA library constructed by SSH of cDNA from control plants and bulk of plants treated with low temperature at 4 °C for different time periods ranging from 6 h to 7 d (Peng et al., 2012). However, these studies were mainly focused on identification of cold-regulated genes in response to 2 to 7 d of relatively longer period of cold treatment or combination of shorter and longer time periods of cold treatment. Thus, early cold-responsive genes which may be activated only in a shorter time period have not been studied or identified in citrus yet. Cold-regulated genes activated at different stages of cold stress were identified and genes induced or repressed at different stages of cold acclimation were compared in Arabidopsis and poplar individually. While genes induced in response to 0.5, 1, 2, 4, 5, 8, 10, 24 h cold stress were determined separately by microarray analysis in

537

Arabidopsis (Fowler and Thomashow, 2002; Seki et al., 2001, 2002) and genes induced in response to 6-h and 48-h cold-acclimation were individually determined by construction of SSH libraries in poplar plants. Both studies clearly demonstrated that different genes were induced at different time periods of cold acclimation and the level of expression of the same or similar genes was drastically changed in early and late response to cold acclimation in Arabidopsis and poplar. In the present study, a cDNA library was constructed using untreated control and 4-h cold-treated Poncirus seedlings by SSH method to identify genes induced in a shorter period of cold stress. A number of genes whose expressions significantly increased in 4-h cold treatment were identified and compared with previously identified genes induced in response to longer time periods of cold treatment in P. trifoliata. The result of this study extended our knowledge of coldinduced genes and may provide better understanding of the molecular mechanisms of cold response in cold-hardy Citrus relative, P. trifoliata. 2. Materials and methods 2.1. Plant materials Seeds of P. trifoliata cv. Rubideaux (trifoliata orange) obtained from National Clonal Germplasm Repository for Citrus & Dates in Riverside, CA were used for construction of the subtracted cDNA library. The seeds were planted in a soilless medium in pots and seedlings were grown and maintained in a controlled environmental growth chamber at 28 °C and 16-h photoperiod provided by cool white fluorescent light (100 μmol m −2 s −1). 2.2. Cold treatment Ten potted seedlings of about one-year-old Poncirus plants with two-month-old flushes were transferred from controlled environment growth chamber at 28 °C and 16-h photoperiod provided by cool white fluorescent light (100 μmol m −2 s−1) to another environment growth chamber at 4 °C and 16-h photoperiod provided by cool white fluorescent light (100 μmol m −2 s−1). The plants were maintained in this growth chamber at 4 °C for 4 h and leaf samples were taken from control plants just before cold treatment or cold-treated plants at 4 h. 2.3. RNA isolation Leaf samples from at least ten individual plants were collected before and after the cold treatment and they were bulked. Poly (A +) RNA was isolated from these leaf samples using the FastTrack 2.0 Kit for isolation of mRNA (Invitrogen, CA, USA) according to the manufacturer's instructions. Total RNA was isolated from leaf samples obtained from another cold treatment experiment using Tri-reagent, one-step RNA solution (Roche, Germany) according to the manufacturer's instructions. 2.4. Construction of the subtractive library Subtracted cDNA library was constructed with 2 μg of Poly (A+) RNA from 4-h cold-treated and untreated control Poncirus seedlings using a PCR-Select cDNA Subtraction Kit (Clontech, CA, USA) according to the manufacturer's instructions. Subtracted cDNAs were amplified by PCR and cloned into the pGEM-Teasy cloning vector (Promega, USA). Competent cells of Escherichia coli strain JM109 were transformed with pGEM-Teasy vector carrying cDNAs and grown on LB (2% bactotrytone, 0.5% bacto-yeast extract, 0.05 M NaCl,) medium supplemented with 100 mg/ml ampicillin and 20 mg/ml X-gal (5-bromo-4-chloro3-indolyl-β-D-galactopyranoside) and 50 mg/ml IPTG for colonies containing the cDNA clones.

538

M. Şahin-Çevik / Gene 512 (2013) 536–545

2.5. Sequence analysis cDNA clones from subtracted cDNA library were randomly selected, duplicated and screened by colony PCR using universal primers. Colonies containing greater than 200 bp insert sequences were selected, labeled and glycerol stocks of these clones were prepared for further use. Plasmids were isolated from these clones using a 96-well plate plasmid purification kit (Qiagen, Germany). Selected cDNA clones were sequenced using universal primers and any vector sequences were cleaned up using Vector NTI. After the removal of vector sequences, the cDNA sequences were compared with each other and contigs were established using Contig Express module of Vector NTI program to determine clones containing identical sequences. The sequences were then compared with National Center for Biotechnology Information (NCBI) nucleotide and protein sequence databases using BLASTN and BLASTX applications, respectively. The putative functions of cDNA sequences were determined based on the similarity scores obtained from both BLAST analyses. 2.6. Reverse northern blot analysis 2.6.1. Amplification of positive, negative and internal controls Two previously characterized cold-induced genes, cor11 (GenBank accession number: L39005) (Cai et al., 1995) and Pt-AP2/ERF1 (GenBank accession number: L39004) (Şahin-Çevik and Moore, 2006b) were amplified using gene specific primers and they were used as positive controls for cold induction. Glycogen 2 (GYG2) (GenBank accession number: NM_001184703) and troponin T type 1 (TNNT1) (GenBank accession number: NM_003283) genes from human genome were amplified by RT-PCR using two pairs of primers (MSC92 Hs_GYG2F 5′ ATGTCG GAGACAGAGTTTCA 3′, MSC93 Hs_GYG2R 5′ AAGACAAACACCCCGCTATT 3′, MSC94Hs_TNNT1F 5′ ATGTCGGAC ACCGAGGAGCA 3′ and MSC95Hs_ TNNT1R 5′ ACAGCTCCTGGGCTTTCTCC 3′) specific to respective genes from human skeletal muscles RNA provided in the PCR-Select cDNA Subtraction Kit (Clontech, CA, USA) and used as negative controls. In addition, constitutively expressed atpB gene, encoding the β subunit of chloroplast ATP synthase from P. trifoliata (GenBank accession number: AJ238409) was amplified using gene specific primers and used as internal control for normalization (Şahin-Çevik and Moore, 2006a). The genes used as controls were amplified by two-step reverse transcription polymerase chain reaction (RT-PCR) using PrimeScript RT-PCR kit (Takara, Japan). About 0.5 μg of mRNA was denatured at 65 °C for 5 min and quickly chilled on ice. cDNA was synthesized in a mixture containing 1 × PrimeScript buffer, 10 pmol oligo dT primer, 0.5 mM dNTPs, 10 U RNAsin and 20 U PrimeScript (Takara, Japan) at 42 °C for 60 min. PCR amplification was carried out in 100 μl reaction mixture containing 1 × PCR buffer with 2.5 mM MgCl2, 0.2 mM dNTPs, 5 U Takara ExTaq HS DNA polymerase, 2.5 μl of cDNA and 20 pmol of primers specific to individual genes. PCR was performed in the MJ Mini thermal cycler PTC1148 (Bio-Rad, USA) programmed at 94 °C for 5 min initial denaturation and 40 cycles of 94 °C for 30 s denaturation, 55–60 °C for 30 s primer annealing and 72 °C for 30 s or 1 min primer extension followed by one cycle at 72 °C for 10 min final primer extension. 2.6.2. Amplification cDNA clones The bacterial colonies containing the cDNA clones were inoculated from glycerol stocks into LB medium and grown overnight in a 96-well plate. The cDNA clones from subtracted library were amplified from liquid media by PCR in a 96-well PCR plate using NP1 (5′ TCGAGCGGCCGCCCGGGCAGGT 3′) and NP2 (5′ AGGGCGTGGTGCGG AGGGCGGT 3)′ primers provided by PCR-Select cDNA Subtraction Kit (Clontech, CA USA). 100 μl PCR a mixture of 1 × PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTPs, 20 pmol primers and 5 U Taq DNA polymerase (Fermantas, Canada). PCR amplifications were performed in ICycler (Bio-Rad, USA) programmed at 23 cycles of 94 °C for 30 s,

95 °C for 30 s and 68 °C for 3 min according to the manufacturer's instructions. 2.6.3. Synthesis of cDNA probes About 2 μg of Poly (A +) RNAs isolated from 4-h cold-treated and untreated control Poncirus seedlings were mixed with 50 pmol oligo dT primer to make final volume of 10 μl and denatured at 65 °C for 10 min and quickly chilled on ice. DIG cDNAs were synthesized in a mixture containing 1 × Transcriptor reaction buffer, DIG labeling mix (1 mM dATP, dCTP, dGTP (each), 0.65 mM dTTP, 0.35 mM DIG-11-dUTP) (Roche, Germany), 20 U Protector RNase inhibitor and 10 U Transcriptor reverse transcriptase (Roche, Germany) at 50 °C for 60 min. The labeling efficiency of the probes was determined as described in DIG Application Manual for Filter Hybridization (Roche, Germany) and the probes were divided into equal aliquots and used for reverse northern blot hybridization. 2.6.4. Reverse northern blot hybridization Amplified PCR products of cDNAs and control DNAs were denatured with 0.4 N NaOH and denatured DNAs were blotted to two duplicate Hybond N + nylon membranes (Roche, Germany) as two replicates with water controls using a Bio-Dot Microfiltration Apparatus (Bio-Rad, CA, USA) by a vacuum application. The duplicate blots with appropriate controls and cDNAs from the library were pre-hybridized at 68 °C for 30 min and hybridized with DIG-labeled cDNA probe prepared from poly A+ RNA isolated from 4-h cold-treated and untreated control plants at 68 °C for 16 h. Blots were initially washed twice with 2× SSC, 0.1% SDS at room temperature for 5 min, followed by two washes with 0.1× SSC, 0.1% SDS at 68 °C for 15 min. Then, they were subjected to detection of DIG-labeled cDNA probes to detect DNA targets on reverse northern blots by DIG chemiluminescent detection kit (Roche, Germany) using CSPD-Star substrate. 2.6.5. Data analysis Expression data was obtained from reverse northern blot hybridizations of all cDNA samples and controls in duplicate membranes, each containing two replicates of individual sample. The expression values of two replicates for each individual cDNA were determined after background subtraction. Since the reverse northern blot hybridizations were performed on multiple membranes at different times, values for each sample in different experiments were normalized by the expression of ATP synthase gene used as the constitutive control to compare the expression from different data sets. The expression of each cDNA was normalized by dividing the expression value of each sample with the value of the constitutive control on the same blot. Then the ratio of the normalized expression values of individual cDNA in cold-treated and untreated blots was used to determine fold induction of the expression of each cDNA clone. cDNAs showing more than a 2-fold increase in the expression considered to be cold-induced. 2.6.6. Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) Total RNA from 4-h cold-treated and untreated control plants was reverse transcribed to cDNA using PrimeScript reverse transcriptase (Invitrogen, Carlsbad, CA) and oligo dT primer from two step RT-PCR kit (Takara, Japan) according to manufacturer's instructions. PCR amplification was performed in a 25 μl reaction mixture containing PCR buffer [50 mM KCl, 10 mM Tris–HCl (pH 9.0), 1% Triton X-100], 2.5 mM MgCl2, 0.2 mM dNTPs, 20 pmol each of two sets of gene specific primers, 1.25 U ExTaq HS DNA polymerase (Takara, Japan) and 1 μl cDNA template. Gene specific primer sequences used in RT-PCR were listed in Table 1. Amplification reactions were performed in PTC1148 MJ Mini Thermocycler (Bio-Rad, USA) with conditions at 94 °C for 5 min for initial denaturation for 1 cycle followed by 20, 25, 30 or 35 cycles of 94 °C for 30 s denaturation, 50–55 °C for 30 s primer annealing, 72 °C for 30 s to 1 min primer extension, and a final primer extension at

M. Şahin-Çevik / Gene 512 (2013) 536–545

72 °C for 10 min. PCR products were separated in 1.5% agarose gel and visualized with the Mini BIS-Pro (DNR, Israel) imaging system after ethidium bromide staining. The expression of each cDNA and atpB was quantified and analyzed by LabWorks (UVP, England) image analysis software.

3. Results 3.1. Identification of cold-induced genes from the subtracted cDNA library Subtracted cDNA library was constructed using Poly (A +) RNA isolated from ten individual plants of 4-h cold-treated and untreated control Poncirus seedlings to identify genes induced in response to short term (4-h) cold-treatment in Poncirus. Initially, a total of 210 cDNA clones were randomly selected and sequenced. While no sequences were obtained from 3 of the 210 clones selected randomly for sequencing cDNA sequences ranging from 50 bp to 963 bp with average length of 670 bp were obtained from the remaining 207 cDNA clones. The obtained cDNA sequences were analyzed for identification of homologous/orthologous sequences in the GenBank databases using the basic local alignment search tools (BLASTN and BLASTX). Sequence analysis of the cDNA clones from 4-h cold treatment revealed that a number of cDNA clones shared similarity with previously characterized environmentally regulated genes from different agriculturally important crops including poplar (Populus trichocarpa), grape (Vitis vinifera), castor bean (Ricinus communis), cotton (Gossypium hirsutum), pepper (Capsicum annum), rapeseed (Brassica napus), melon (Cucumis melo), soybean (Glycine max) and wheat (Triticum aestivum) (Table 2). Majority of the sequences obtained from random sequencing of the clones from the library showed homology with different sequences in the GenBank databases. However, some redundant sequences showing homology with the same gene from different plants or with different parts of the same gene sequences in the GenBank were also found in the library. The sequences obtained from the library shared homology with genes involved in various cellular functions and processes including transcription, cell rescue, defense, cell death and aging, metabolism, cellular communication and signal transduction mechanism, transport facilitation, energy, protein fate and development. Furthermore, some of the sequences identified in the library shared homology with sequences with unknown function and few others did not match with any sequences in the databases indicating that they may unique to Poncirus.

539

3.2. Expression analysis by reverse northern blot hybridization Reverse northern blot analysis was performed to study differential expression of these cDNA clones in 4-h cold-treated (CT) and untreated (UT) control plants. Although the sequences of 207 cDNAs were obtained from the subtracted library, the expression of 200 cDNAs was analyzed by the reverse northern blot hybridization. In reverse northern blot experiment, the poly (A +) RNA was isolated from bulking of ten individual 4-h cold-treated or untreated control plants and used for probe synthesis to exclude the biological variations. Positive and negative controls were also used in the expression analysis by reverse northern blot to confirm the specificity of hybridization. While COR 15 and Pt-AP2/ERF1 from Poncirus were included in the membrane as positive controls, GYG2 and TNNT1 genes from human skeletal muscle showing no homology with plant genes were used as negative controls. In addition, a housekeeping gene coding for the beta subunit of the chloroplast ATP synthase from Poncirus whose expression is not affected by cold-treatment or any other conditions was used as an internal control to normalize and compare the results of different blots in different experiments. In addition, each blot contained two replicates of each cDNA sample at different locations in the blot to eliminate the differences due to location in the membrane. When results of the reverse northern blot analysis were evaluated, while expressions of cor11 and Pt-AP2/ERF1 genes were induced in 4-h CT plants, no expression was detected from the negative controls in any blot as expected. On the other hand, the expression level of some cDNAs was found to be much higher in CT blots than the UT blots. The expression data was quantified and the expression level of each cDNA was normalized using expression level of the ATP synthase gene. After the normalization, the expression of a specific cDNA with the CT probe was divided by the expression level of the same cDNA on UT blot to determine the level of induction. The cDNAs showing two fold or greater increase in the expression were considered to be cold-induced genes. The analysis of the expression of 200 cDNA revealed that a total of 64 cDNAs showing 2 to 11-fold increase in their expressions were found to be cold-induced. Sequences of the cold-induced cDNAs were submitted to the GenBank under the accession numbers from HO663516 to HO663579 (Table 2). Cold-induced genes identified in this study were classified into eight categories based on their putative function(s) (Table 1) including (i) transcription; (ii) cell rescue, defense, cell death and aging; (iii) metabolism; (iv) cellular communication and signal transduction mechanism; (v) transport facilitation; (vi) energy; (vii) protein fate

Table 1 Primers used for expression analysis of cold-induced genes by semi-quantitative RT-PCR. Primer code

Clone no

Gene/function

Sequence (5′ to 3′)

Orientation

Size (bp)

MSC123 MSC122 MSC121 MSC120 MSC119 MSC118 MSC117 MSC116 MSC115 MSC114 MSC111 MSC110 MSC107 MSC106 MSC105 MSC104 MSC103 MSC102 MSC69 MSC70

C4-154

C2H2-type zinc-finger protein Miraculin-like protein 2

C4-184

Hypothetical protein

C4-214

Protein kinase

C4-235

Catalase 3

C4-252

RUBISCO

C4-217

Transcription factor

C4-33

NBS-LLR disease resistance

C4-245

Drought-induced EST

Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense

319

C4-106

CGCAAGTAACCGTAAAGAAATACC ACAAACGTTGTCACTACGATGG ACAGGCTAGCTAGCAATGAC TGGGGTTTCTCACGATCATGC CGAAGAGGATGATGGCAACG TCTCAAGGCTAACCCAGAGAGC CATCACCATGCCTTGTTGTT GTATAGATTTTGATGCGTGTGG ATGAGATCCGCCACATTTGG TACAAACTCACACACCACCCG GAGTTCACAAGGCTCTTGCC TTGTATGCTCCTCTCATCCG GGAGATTGCAACTTAGTTGG GTCTGTTTCTTTGCTCCAAGC ACAAGTAGCGAAGTTGCCGG CTGCAAGATTAACAACAGCC AGCAAAGCTGCATATAACATCC GACGAGAGGGAGTTAAATTAGG CTCTTCGGACAGTTCGTCC GTGCTACAGATGGTCTAACG

ATP Synthase beta subunit

196 258 202 210 280 526 347 227 1100

540

M. Şahin-Çevik / Gene 512 (2013) 536–545

and (viii) development. In addition, some cold-induced genes showed no homology with sequences in GenBank. Thus, they were classified as genes with unknown functions in Table 2. The list of cold-induced genes identified in this study with their GenBank accession number, the putative function of the gene, e-value of the homology and fold induction is listed in Table 2. The expressions of 64 genes were induced in response to cold, but due to the redundancy in sequences, only 55 unique sequences were shown in the list. Some of early cold-induced genes identified in this study showed significant homology with environmental stress regulated genes in Poncirus and other plants, including zinc finger protein and apetala2/ethylene response factor (AP2/ERF), basic leucine zipper domain (bZIP), CCR4-associated factor, protein kinase and catalase (Fowler and Thomashow, 2002; Meng et al., 2008; Peng et al., 2012; Şahin-Çevik and Moore, 2006a,b; Seki et al., 2001, 2002). These results show that subtracted cDNA library constructed and reverse northern analysis conducted for verification of the cold induced expression of genes were both functioned properly in this study. The cold-induced genes identified in this study were also analyzed to determine whether they had been previously cloned from Citrus or Poncirus, typically as anonymous cDNAs. Therefore, 55 unique cDNAs identified in this study were blast against a citrus EST database the HarvEST Citrus, and the results demonstrated that 10 cDNAs, or about 20% of the sequences identified in this study are not present in HarvEST Citrus database. Thus, the subtracted library approach appears to be effective for identification citrus sequences that have not been previously cloned. 3.3. Expression analysis by semi-quantitative RT-PCR A semi-quantitative RT-PCR analysis was conducted using RNA from 4-h cold-treated and untreated control plants. The expression of 9 cDNA clones including C4-245, C4-33, C4-217, C4-252, C4-235, C4-214, C4-184, C4-106 and C4-154 was studied by semi-quantitative RT-PCR analysis. The genes were amplified individually by RT-PCR using specific primers and different number of cycles ranging from 20 to 35 to determine the exponential phase for quantification. The results demonstrated that 25 cycles was the best amplification scheme for quantification of all selected genes. The DNA fragments of corresponding sizes for each selected cDNA and one housekeeping gene indicated in Table 1 were amplified by RT-PCR from the CT and UT control plants. The DNA fragments were quantified and the expression of each cDNA in CT and UT control plants was determined. Expression analysis by RT-PCR revealed that while the expression of ATP synthase gene from Poncirus was not changed in CT and UT control plants, the expression of all 9 cDNAs, including C4-245, C4-33, C4-217, C4-252, C4-235, C4-214, C4-184, C4-106 and C4-154 was significantly higher in 4-h CT plants than UT control plants (Fig. 1). The results confirmed that genes identified in this study actually induced in response to cold. 4. Discussion Although cold-regulated genes were previously identified from Poncirus and Citrus in response to different periods ranging from 2 to 7 d of cold treatment or cold acclimation in different studies, genes induced in response to short term cold treatment have not been explored in Poncirus or Citrus. Therefore, early cold-responsive genes in Poncirus were identified and their expressions were determined in this study. As a result, 64 cold-induced genes were identified from 4-h cold-treated cold-hardy Poncirus plants using PCR-select subtraction hybridization method. Cold-induced genes identified in this study showed homology with previously identified cold-regulated genes from P. trifoliata and C. unshiu (Lang et al., 2005; Meng et al., 2008; Peng et al., 2012; Şahin-Çevik and Moore, 2006a; Zhang et al., 2005a) and environmental stress-regulated genes from other woody

and herbaceous plants (Dhanaraj et al., 2004; Fowler and Thomashow, 2002; Nanjo et al., 2004; Seki et al., 2001, 2002; Street et al., 2006). The majority of genes identified in this study were found to have function in cell rescue, defense, cell death and aging (23%), transcription (17%) and metabolism (11%). These groups followed by protein fate (13%), energy (9%), cellular communication and signal transduction mechanism (6%), transport facilitation (5%) and development (3%). In addition, 13% of cold-induced genes showing no homology with sequences in GenBank were not classified into any functional groups. Thus, they were grouped as genes with unknown functions. Majority of genes determined to be induced in response to 4-h cold treatment were different from the cold-regulated genes identified in response to 2 or 7 d cold-treated Citrus and Poncirus in previous studies. It was also reported that majority of genes induced in response to different durations of cold acclimation were different in both Arabidopsis and poplar (Fowler and Thomashow, 2002; Maestrini et al., 2009). These findings suggest that different genes are involved in early and late response to cold treatment in Poncirus as well as other plants. One of the major effects of cold stress in plants is the modification of the expression of genes involved in transcription and RNA processing. Expression of a number of transcription factors or DNA-binding proteins induced in response to abiotic stresses and they play an important role in regulation of gene expression during abiotic stresses. Several transcription factors including three different types of zinc finger proteins and AP2/ERF proteins were identified in this study. Proteins containing zinc finger domain are generally involved in protein–protein and protein–nucleic acid interactions and regulate expression of genes related with different signal transduction pathways, growth and development as well as plant response to abiotic stresses (Ciftci-Yilmaz and Mittler, 2008). It was shown that ten zinc finger families of transcription factors are induced in response to low temperature in Arabidopsis (Seki et al., 2002). SCOF-1 is another zinc finger protein isolated from soybean induced by low temperature and abscisic acid (ABA) treatments. And the constitutive overexpression of SCOF-1 gene enhanced cold tolerance of transgenic plants with the induction of cold-regulated (COR) gene expression (Kim et al., 2001) suggesting that it is directly involved in regulation of cold-responsive gene expression. Genes encoding zinc finger proteins were also induced in response to cold treatment in this and previous studies in Poncirus (Şahin-Çevik and Moore, 2006a). These suggested that zinc finger proteins are commonly induced in response to abiotic stresses in plants and they are specifically induced in response to both short and long term cold acclimation in Poncirus. AP2/ERF domain containing proteins are transcription factor family and mostly involved in abiotic and biotic responsive gene expressions, including cold in different plants (Berrocal-Lobo et al., 2002; Chen et al., 2003; Mine et al., 2003; Sakuma et al., 2002; Shen et al., 2003). Nanjo et al. (2004) identified 13 genes coding for AP2/ERF domain containing transcription factors from a full-length enriched EST library from leaves of poplar (Populus nigra var. italica). Expressions of 11 of these genes were induced by dehydration, salinity, chilling or ABA treatments. Similarly, four members of this family of proteins were identified in hot pepper using microarray and their expressions were induced in response not only to cold, but also to drought, salt or ABA treatments (Hwang et al., 2005). In addition, an AP2/ERF transcription factor belonging to class IV ERF protein was also identified from 2-d cold acclimated Poncirus and its expression significantly induced in response to cold in cold-hardy Poncirus, but not in cold sensitive Citrus grandis (Şahin-Çevik and Moore, 2006a, 2006b). Furthermore, another gene encoding AP2/ERF transcription factor was identified in response to short-term cold treatment in this study. These results imply that AP2/ERF transcription factors play an important role in the regulation of abiotic stress-responsive gene expressions in plants and are involved in both early and late response to cold stress in Poncirus.

M. Şahin-Çevik / Gene 512 (2013) 536–545

541

Table 2 Summary of sequence and expression analysis of cold-induced genes identified from a 4-h cold-treated Poncirus cDNA library. Clone numbera

GenBank accession number

Transcription C4-27 HO663520 C4-86 HO663542 C4-154 HO663565 C4-34 HO663522 C4-137 HO663558 C4-220 HO663519 C4-217 HO663523 C4-136 HO663557 C4-47 HO663526 Cell rescue, defense, cell death and aging C4-33 HO663521 C4-50 HO663528 C4-237 HO663545 C4-235 HO663548 C4-245 HO663518 C4-95 HO663547 C4-106 HO663563 Metabolism C4-125 HO663554 C4-52 HO663530 C4-44 HO663525 C4-218 HO663579 C4-249 HO663539 Cellular communication and signal transduction C4-239 HO663544 C4-214 HO663550 C4-29 HO663576 C4-74 HO663537 Transport facilitation C4-56 HO663532 C4-53 HO663531 C4-201 HO663551 Energy C4-14 HO663573 C4-175 HO663577 C4-162 HO663568 C4-15 HO663574 C4-178 HO663555 C4-252 HO663535 Protein fate C4-208 HO663534 C4-171 HO663561 C4-253 HO663516 C4-123 HO663553 C4-184 HO663552 C4-165 HO663569 C4-58 HO663533 C4-155 HO663572 C4-210 HO663527 C4-22 HO663575 C4-172 HO663571 Development C4-153 HO663564 C4-157 HO663566 Proteins with unknown function C4-69 HO663536 C4-248 HO663540 C4-170 HO663559 C4-142 HO663560 C4-161 HO663567 C4-113 HO663570 C4-41 HO663578

GenBank matchb

Fold inductiond

Gene/protein

Source plant

E valuec

C3H-type zinc finger protein Zinc finger protein 2 C2H2-type zinc finger protein (2) Glycine-rich protein AP2/ERF domain-containing transcription factor Nucleic acid binding protein Transcription factor (2) RNA pol. I-specific transcription initiation factor RRN3 family protein Putative oligouridylate-binding protein

Capsicum annuum Bos taurus Bruguiera gymnorhiza Citrus unshiu Populus trichocarpa Ricinus communis Ricinus communis Arabidopsis thaliana Prunus dulcis

3.E−05 2.E−04 3.E−21 8.E−131 1.E−12 7.E−63 3.E−81 3.E−44 5.E−57

2.17 2.53 3.76 2.32 2.32 2.39 5.13 2.23 2.61

NBS-LLR disease resistance protein Lipoxygenase (3) Chloroplast drought-induced stress protein Catalase 3 EST from severe drought-stressed leaves CCR4-associated factor (2) Putative miraculin-like protein 2 (6)

Populus trichocarpa Citrus jambhiri Arabidopsis thaliana Prunus persica Populus trichocarpa Ricinus communis Citrus hybrid cv. ShiranuhI-

2.E−45 2.E−151 7.E−13 7.E−26 3.E−09 5.E−07 4.E−23

6.40 2.44 2.74 2.48 2.45 3.79 3.21

Caffeic acid O-methyltransferase Glycerophosphodiester phosphodiesterase Sinapate 1-glucosyltransferase Acetyl-CoA carboxylase Putative metallotionein (mt gene)

Citrus aurantium Ricinus communis Brassica napus var. Napus Phaseolus vulgaris Citrus medica

7.E−58 3.E−50 8.E−04 2.E−36 1.E−91

2.00 2.41 2.19 2.26 3.07

Serine/threonine-protein kinase AtPK19 Protein kinase APK1B, chloroplast precursor Phosphoinositide kinase Executer1 protein, chloroplast precursor

Solanum lycopersicum Ricinus communis Ricinus communis Ricinus communis

2.E−28 3.E−20 3.E−05 1.E−71

3.28 3.37 2.17 2.04

Magnesium transporter Importin beta-1 Inorganic phosphate transporter

Populus trichocarpa Ricinus communis Ricinus communis

6.E−26 6.E−12 6.E−47

2.81 2.15 2.01

Glyceraldehyde-3-phosphate dehydrogenase 6-phosphogluconate dehydrogenase Chloroplast photosystem II-PsbR Photosystem II-core complex proteins psbY Ribulose-1,5-bisphosphate carboxylase/oxygenase Ribulose-1,5-bisphosphate carboxylase/oxygenase activase

Citrus aurantiifolia Ricinus communis Prosopis juliflora Ricinus communis Citrus reticulata Malus x domestica

1.E−78 1.E−71 2.E−27 2.E−10 7.E−68 3.E−51

7.86 2.34 3.00 2.00 2.10 8.15

Cysteine protease Trypsin inhibitor Papain-like cysteine proteinase isoform II Mitochondrial processing peptidase beta subunit Hypothetical protein Arginine/serine-rich splicing factor Protein CYPRO4 Translation initiation factor Serine carboxypeptidase precursor Drm3-like protein Ribozomal Protein L17

Ricinus communis Murraya koenigii Ipomoea batatas Cucumis melo Vitis vinifera Ricinus communis Ricinus communis Ricinus communis Gossypium hirsutum Solanum tuberosum Triticum aestivum

7.E−114 4.E−38 7.E−50 7.E−05 2.E−25 4.E−20 7.E−66 3.E−29 3.E−67 1.E−10 2, E−29

3.15 2.01 2.78 3.37 2.65 4.25 3.17 2.01 3.59 2.24 3.26

Cell division control protein CDC91 Root phototropism protein

Oryza sativa Japonica Group Ricinus communis

3.E−36 1.E−115

11.00 3.75

Populus trichocarpa Ricinus communis

3.E−44 8.E−38 7.E−49

Vitis vinifera

3.E−16

No significant homology Predicted protein Unnamed protein product Conserved hypothetical protein No significant homology No significant homology Unnamed protein product

2.43 3.24 2.20 2.38 3.17 2.67 3.10

a

C4 indicates 4-h cold-induced cDNA. The GenBank sequences showing the highest nucleotide and/or amino acid sequence homology with the individual cDNA clones. The numbers in the parentheses indicate the number of different cold-induced cDNA clones showing homology with the same sequence in the databases. c The Expect (E) value is a parameter that describes the number of hits one can “expect” to see just by chance when searching a database of a particular size. d Fold induction indicates the ratio of the normalized values of individual genes obtained from reverse northern blots with cold-treated and untreated control cDNA probes. b

Glycine-rich proteins (GRPs) play a role in different cellular and biological processes in the cell including cell wall formation (Keller et al., 1988; Ringli et al., 2001; Yokoyama and Nishitani, 2006), plant defense response (Fu et al., 2007; Ueki and Citovsky, 2002), signal transduction

(Park et al., 2001) and regulation of osmotic stress (Mangeon et al., 2010). It was demonstrated that GRPs have RNA-chaperone activity and may have a role in stabilization, processing and transport of RNAs during abiotic stresses (Kim and Kang, 2006; Kim et al., 2005, 2008). It has been

542

M. Şahin-Çevik / Gene 512 (2013) 536–545

shown that some GRPs were induced in response to cold in different plants (Kim et al., 2010), including Poncirus (Şahin-Çevik and Moore, 2006a). And it was demonstrated that overexpression of AtRZ-1a, a zinc finger-containing glycine-rich RNA-binding protein enhances cold and freezing tolerance of Arabidopsis plants (Kim et al., 2005). Identification of a cDNA coding for a GRP showing increased expression in cold treatment in this and the previous study in Poncirus suggests that GRPs may have a role in cold adaptation by protecting RNAs during cold stress. Genes involved in cell rescue, defense, cell death and aging constituted the major group of cold-induced genes identified in this study. Although some of these genes, including nucleotide-binding site (NBS)-leucine-rich repeat (LRR) proteins, lipoxygenase (LOX), and CCR4 associated factor 1 (CAF1) were previously reported to be involved in various stages of plants' response to pathogen infection, several studies reported that they have a role in abiotic stress response in plants. For example, constitutive or conditional expression of activated disease resistance 1 (ADR1) gene encoding a NBS-LRR protein from Arabidopsis enhanced drought tolerance of Arabidopsis plants (Chini et al., 2004). Recently, Ptcorp gene showing homology with NBS-LRR proteins was also identified in Poncirus and its expression was induced in response to low freezing temperatures in Poncirus as well as Satsuma mandarin (Long et al., 2012). Moreover, a gene encoding a NBS-LRR protein was also induced in response to cold treatment in this study suggesting that NBS-LRR proteins might have roles in early response to both cold and freezing stresses in Citrus and Poncirus. Lipoxygenase (LOX) is another gene playing an important role in synthesis of jasmonates (JAs) an endogenous plant hormone related with different kinds of defense and stress pathways (Bhardwaj et al., 2011; Wang et al., 2004a). Expression of LOX is induced by low temperature in maize, Canagana jubata, a perennial temperate shrub grows well in low temperature, figleaf gourd (Cucurbita ficifolia), a type of squash and in Arabidopsis (Bhardwaj et al., 2011; Lee et al., 2005; Nemchenko et al., 2006; Seki et al., 2002) suggesting that LOX may have a role in low temperature response in plants. A cDNA coding for LOX was also identified in this study and its expression was induced in response to cold acclimation in Poncirus. A gene encoding for CCR4 associated factor1 (CAF1) was also identified in Poncirus in this study. It was demonstrated that different types of stress hormones, wounding and pathogens induced the expression of CAF1 (Liang et al., 2009). In addition, over-expression of the pepper CAF1 gene (CaCAF1) in tomato plants and Arabidopsis CAF1 gene in Arabidopsis plants enhanced resistance against pathogen attacks and these transgenic plants showed higher expression levels of pathogenesis-related (PR) genes (Liang et al., 2009; Sarowar et al., 2007). Recently, CAF1 was also induced in response to low temperature treatment for different time periods ranging from 6 h to7 d in Poncirus (Peng et al., 2012). Isolation of CAF1 from low temperature induced cDNA library of two independent studies showed that it is also induced in response to cold stress in Poncirus and may also involve in cold tolerance in plants. Generally, expression of miraculin-like proteins increased in response to biotic stress as well as plant hormone treatment. Brenner et al. (1998) showed that miraculin-like protein from tomato, LeMir was induced by root nematode (Meloidogyne javanica). RlemMLP1 and RlemMLP2 are two miraculin-like proteins and their expressions were induced in response to wounding, inoculation with Alternaria alternata and treatment with methyl jasmonate in rough lemon (Citrus jambhiri Lush) (Tsukuda et al., 2006). Although the expression of this protein was found to be decreased in response to 7 d low temperature treatment in Poncirus (Zhang et al., 2005a) and C. unshiu (Lang et al., 2005), expressions of six cDNAs coding for several different miraculin-like proteins in response to 4-h cold treatment in this study and bulk of Poncirus plants treated with low temperature at 4 °C for different time periods ranging from 6 h to7 d (Peng et al., 2012) were induced. Differences observed in the expression pattern of miraculin-like proteins in response to cold are likely

due to the duration of cold acclimation. A previous report in Citrus showed that two miraculin-like genes, RlemMLP1 and RlemMLP2 from rough lemon were only induced 6 to 12 h after infection with A. alternata infection thereafter, their expressions gradually decreased. These results implied that expression of miraculin-like protein may induce earlier time points in response to abiotic or biotic stresses and decrease in a longer period of stress treatments. Abiotic stresses including cold disrupt the metabolic balance of the cell causing an increase on the production of reactive oxygen species (ROS), such as H2O2 and HO (Miller et al., 2008; Mittler, 2002). ROS are toxic molecules and can damage proteins, DNA and lipids (Suzuki and Mittler, 2005). Therefore, detoxification of ROS is necessary and ROSscavenging enzymes, such as superoxide dismutase (SOD), glutathione peroxidase (GPX) and catalase (CAT) are responsible for detoxification of ROS in the cell (Mittler et al., 2004; Suzuki and Mittler, 2005). Increased expression of genes coding for these enzymes was reported in various plants in response to different stresses, including cold (Dhanaraj et al., 2004; Mantri et al., 2007; Seki et al., 2002). One of the cold regulated genes identified in this study showed homology with catalase implying that Poncirus also utilizes ROS-scavenging enzymes to overcome the negative effects of oxidative stress caused by cold stress. Expressions of genes involved in cellular communication and signal transduction are commonly regulated by abiotic stresses, including cold. Protein kinases catalyze the protein phosphorylation to control many fundamental cellular processes in response to external signals (Wu et al., 2010). Three cDNAs showing homology with protein kinase, serine/threonine-protein kinase and phosphoinositide kinase induced in response to low temperature in Poncirus in this study. They were also found to be induced during low temperature stress in different crops, including Arabidopsis (Fowler and Thomashow, 2002), chickpea (Mantri et al., 2007) and poplar (Maestrini et al., 2009). In addition, the expression of Executer 1 was induced in response to short-term cold treatment in Poncirus in this study. Recently, a report showing increased expression of Executer 1 in response to low temperature treatment in Poncirus (Peng et al., 2012) confirms the cold responsiveness of this gene. These findings were consistent with previous report showing that executer protein 1 and executer protein 2 have both roles in transferring stress related signals from plastid to the nucleus and highly conserved among higher plants (Lee et al., 2007a). These results showed that kinases and other proteins involved in signaling are induced in response to cold acclimation and they are likely to have a role in further activation of abiotic stress related pathways in Poncirus as in other plants. Low temperature stress requires more energy to use in various cellular processes (Yan et al., 2006). Therefore, significant changes in the expression of genes related with energy production and metabolism were observed during cold stress. A total of 27 proteins were identified in response to low temperature in the root of rice and majority of these proteins were related with energy production and metabolism (Lee et al., 2008). In this study, 11 different genes involved in energy production and metabolism were identified. A cDNA encoding phosphogluconate dehydrogenase, which was previously identified in response to cold in rice (Lee et al., 2008), was among the cold responsive genes identified in Poncirus. In addition, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene related with carbohydrate metabolism was also induced in response to cold acclimation in this study and induction of this gene was also reported during low temperature stress in Arabidopsis (Seki et al., 2002) and blood oranges (Crifò et al., 2011). These results suggest that GAPDH is involved in cold response in plants. Low temperature limits the available CO2 concentration and adversely affects the electron flows leading to increases on the activity of genes involved in photosynthesis (Hirotsu et al., 2005). It has been shown that activity of the ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO) was very high in leaf tissue of rice during low temperature stress (Lee et al., 2007b). Increased activity of RUBISCO was also observed in Poncirus,

M. Şahin-Çevik / Gene 512 (2013) 536–545

543

Fig. 1. Semiquantitative RT-PCR analysis of the expression of 9 selected cDNAs and ATP synthase used as control.

a hybrid (C. ichangensis Swing. × Fortunella margarita Lour. Swing.) and Valencia orange (Citrus sinensis L. Osbeck) in response to low temperature (Vu et al., 1995). In this study, genes coding for RUBISCO, RUBISCO activase and two members of the PSII are induced in response to short term cold acclimation. This result suggest that the photosynthesis machinery is adversely affected by cold stress immediately and expression of genes related with photosynthesis increased in Poncirus and other plants to cope with these changes. Caffeic acid O-methyltransferase (COMT) is one of the key enzymes in lignin biosynthesis. Expression of COMT was found to be increased in drought-tolerant lines, but not in drought-sensitive lines and they also reported a correlation between leaf lignin content and drought tolerance (Hu et al., 2009). In addition, expression of caffeoyl-CoA O methyltransferase-like protein was increased in response to cold stress in Arabidopsis (Fowler and Thomashow, 2002). Moreover, accumulation of caffeic acid/5-hydroxyferulic 3-O-methyltransferase was observed in drought stressed leaves of maize (Riccardi et al., 1998). Therefore, it is documented that COMT and related enzymes are up-regulated during abiotic stresses in plants. A cDNA encoding COMT was also among the

cold induced genes related with metabolism identified in Poncirus in this study inferring that COMT is involved in cold tolerance of Poncirus. Abiotic stresses lead to degradation of many proteins in the cell and synthesis of a small portion of proteins (Sachs et al., 1980). Thus, many genes related to protein fate are regulated by abiotic stresses, such as cold. Cysteine proteinases also known as thiol proteases have function in protein maturation, degradation and rebuilding of proteins in response to different external stimuli. They also play a role in removing misfolded proteins during normal cellular processes (Grudkowska and Zagdańska, 2004). Activity of cysteine proteinases was reported to be induced by abiotic stresses including cold, heat, drought and salt stresses (Fowler and Thomashow, 2002). For example, C14 gene showing homology with cysteine protease has demonstrated differential expression in response to high and low temperature in tomato (Schaffer and Fischer, 1990). Similarly, rd19 and rd21 genes from Arabidopsis encoded different cysteine proteinases and showed induction by water and salt stresses (Yamaguchi-Shinozaki et al., 1992). Two cDNAs showing homology with cysteine proteinase and papainlike cysteine proteinase were also found to be induced in response to

544

M. Şahin-Çevik / Gene 512 (2013) 536–545

four-hour cold acclimation in Poncirus in this study indicating that cysteine proteinases may have similar roles in different crops in response to abiotic stresses. Degradation of proteins in the cell depends on the proteolytic enzyme activity (Ingram and Bartels, 1996). Proteolysis occurred by many enzymes located in different compartments in the cell (Zhang et al., 2008). Proteolysis causes increases in the activity of proteinase inhibitors (PIs) which regulate the catalytic activity of proteinases and control the protease activity as a final regulatory step in the cell (Hibbetts et al., 1999; Losso, 2008). Thus, they control protein turnover and metabolism (Ryan, 1989). Expression of PIs induced in response to abiotic and biotic stresses in many plants, including Arabidopsis (Gosti et al., 1995), chesnut (Pernas et al., 2000) Brassica napus (Downing et al., 1992) and rice (Huang et al., 2007). In addition, overexpression of rice chymotrypsin inhibitor-like 1 (OCPI1) gene positively affected the drought tolerance of transgenic plants (Huang et al., 2007). The expression of a cDNA showing homology with trypsin inhibitor gene was increased in response to low temperature in Poncirus implying that common mechanisms are used in cold response by different crops and these up-regulated genes can be used for improving plants' resistance to abiotic stresses. Generally, expressions of heat shock proteins (HSPs) responsible for the functional conformations of the protein (Wang et al., 2004b) and late embryogenesis abundant proteins (LEA) responsible for the stabilization of membranes and proteins through detergent-like or chaperone activities (Close, 1997) are induced in response to different abiotic stresses in plants. And both genes were also found to be induced in previously constructed two-day cold acclimated Poncirus library (Şahin-Çevik and Moore, 2006a). Although several cDNA clones showing homology with HSPs and LEA proteins were identified in four-hour cold induced Poncirus library, their expression was not increased significantly enough in reverse northern blot analysis to be classified as cold induced genes. This result showed that HSPs and LEA proteins are possibly involved in relatively late response rather than early response to cold stress in Poncirus.

5. Conclusion Cold response in Poncirus has been explored in recent years to understand the mechanisms of cold tolerance. A number of genes induced in response to 2 to 7 d cold acclimation, which is considered as long term cold response, were identified in previous studies. However, changes in gene expression in response to short term cold acclimation have not been studied in Poncirus. Therefore, genes induced in response to 4-h cold acclimation were identified and their expressions were analyzed in this study to understand the mechanisms of early cold response in Poncirus. As a result, a total of 64 early cold-responsive genes were identified in Poncirus. Some of these genes were the same as previously identified late cold-responsive genes in Poncirus whereas majority of genes were not identified in Poncirus before. On the other hand, these genes showed homology with previously identified early or late cold-responsive genes from other plants suggesting that genes identified in this study are directly related with cold response in cold-hardy Poncirus. Isolation and further characterization of these genes will reveal their role in cold tolerance in Poncirus. In addition, comparative expression analyses of these genes in cold-hardy Poncirus and cold sensitive Citrus species will reveal the evolution of cold tolerance in different Citrus species and Citrus relatives.

Acknowledgments This research was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK) project number 106O549.

References Berrocal-Lobo, M., Molina, A., Solano, R., 2002. Constitutive expression of EthyleneResponse-Factor1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J. 29, 23–32. Bhardwaj, P.K., Kaur, J., Sobti, R.C., Ahuja, P.S., Kumar, S., 2011. Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid. Gene 483 (1–2), 49–53. Brenner, E.D., Lambert, K.N., Kaloshian, I., Williamson, V.M., 1998. Characterization of LeMir, a root-knot nematode-induced gene in tomato with an encoded product secreted from the root. Plant Physiol. 118, 237–247. Cai, Q.Y., Moore, G.A., Guy, C.L., 1995. An unusual group-2 lea gene family in Citrus responsive to low-temperature. Plant Mol. Biol. 29, 11–23. Chen, J.Q., Dong, Y., Wang, Y.J., Liu, Q., Zhang, J.S., Chen, S.Y., 2003. An AP2/EREBP-type transcription-factor gene from rice is cold-inducible and encodes a nuclearlocalized protein. Theor. Appl. Genet. 107 (6), 972–979. Chini, A., et al., 2004. Drought tolerance established by enhanced expression of the CCNBS-LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1. Plant J. 38, 810–822. Ciftci-Yilmaz, S., Mittler, R., 2008. The zinc finger network of plants. Cell Mol. Life Sci. 65 (7–8), 1150–1160. Close, T.J., 1997. Dehydrins: A commonality in the response of plants to dehydration and low temperature. Physiol. Plant. 100, 291–296. Crifò, T., Puglisi, I., Petrone, G., Recupero, G.R., Lo Piero, A.R., 2011. Expression analysis in response to low temperature stress in blood oranges: implication of the flavonoid biosynthetic pathway. Gene 476 (1–2), 1–9. Dhanaraj, A.L., Slovin, J.P., Rowland, L.J., 2004. Analysis of gene expression associated with cold acclimation in blueberry floral buds using expressed sequence tags. Plant Sci. 166, 863–872. Downing, W.L., et al., 1992. A Brassica napus transcript encoding a protein related to the Kunitz protease inhibitor family accumulates upon water stress in leaves, not in seeds. Plant J. 2, 685–693. Fernandez, P., Di Rienzo, J., Fernandez, L., Hopp, H.E., Paniego, N., Heinz, R.A., 2008. Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis. BMC Plant Biol. 26 (8), 11. Fowler, S., Thomashow, M.F., 2002. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14, 1675–1690. Fu, Z.Q., et al., 2007. A type III effector ADP-ribosylates RNA-binding proteins and quells plant immunity. Nature 447, 284–288. Gmitter Jr., F.G., Grosser, J.W., Moore, G.A., 1992. Citrus. In: Hammerschlag, F.A., Litz, R.E. (Eds.), Biotechnology of Perennial Fruit Crops. CAB International, Wallingford, UK, pp. 335–369. Gosti, F., Bertauche, N., Vartanian, N., Giraudat, J., 1995. Abscisicacid-dependent and -independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol. Gen. Genet. 246, 10–11. Grudkowska, M., Zagdańska, B., 2004. Multifunctional role of plant cysteine proteinases. Acta Biochim. Pol. 51 (3), 609–624. Guy, C.L., 1990. Cold-acclimation and freezing stress tolerance-role of proteinmetabolism. Annu. Rev. Plant Physiol. 41, 187–223. Hibbetts, K., Hines, B., Williams, D., 1999. An overview of proteinase inhibitors. J. Vet. Intern. Med. 13 (4), 302–308. Hirotsu, N., Makino, A., Yokota, S., Mae, T., 2005. The photosynthetic properties of rice leaves treated with low temperature and high irradiance. Plant Cell Physiol. 46, 1377–1383. Hu, Y., Li, W.C., Xu, Y.Q., Li, G.J., Liao, Y., Fu, F.L., 2009. Differential expression of candidate genes for lignin biosynthesis under drought stress in maize leaves. J. Appl. Genet. 50 (3), 213–223. Huang, Y., Xiao, B., Xiong, L., 2007. Characterization of a stress responsive proteinase inhibitor gene with positive effect in improving drought resistance in rice. Planta 226, 73–85. Hwang, E.W., Kim, K.A., Park, S.C., Jeong, M.J., Byun, M.O., Kwon, H.B., 2005. Expression profiles of hot pepper (Capsicum annum) genes under cold stress conditions. J. Biosci. 30 (5), 657–667. Ingram, J., Bartels, D., 1996. The molecular basis of dehydration tolerance in plants. Annu. Rev. Plant Physiol. 47, 377–403. Jia, Y., del Rio, H.S., Robbins, A.L., Louzada, E.S., 2004. Cloning and sequence analysis of a low temperature-induced gene from trifoliate orange with unusual pre-mRNA processing. Plant Cell Rep. 23 (3), 159–166. Keller, B., Sauer, N., Lamb, C.J., 1988. Glycine-rich cell wall proteins in bean: gene structure and association of the protein with the vascular system. EMBO J. 7, 3625–3633. Kim, Y.-O., Kang, H., 2006. The role of a zinc finger-containing glycine-rich RNA-binding protein during the cold adaptation process in Arabidopsis thaliana. Plant Cell Physiol. 47, 793–798. Kim, J.C., et al., 2001. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants. Plant J. 25, 247–259. Kim, Y.-O., Kim, J.S., Kang, H., 2005. Cold-inducible zinc finger-containing glycine-rich RNA-binding protein contributes to the enhancement of freezing tolerance in Arabidopsis thaliana. Plant J. 42, 890–900. Kim, J.S., et al., 2008. Glycine-rich RNA-binding protein 7 affects abiotic stress responses by regulating stomata opening and closing in Arabidopsis thaliana. Plant J. 55, 455–466. Kim, W.Y., Kim, J.Y., Jung, H.J., Oh, S.H., Han, Y.S., Kang, H., 2010. Comparative analysis of Arabidopsis zinc finger-containing glycine-rich RNA-binding proteins during cold adaptation. Plant Physiol. Biochem. 48 (10–11), 866–872. Lang, P., Zhang, C.K., Ebel, R.C., Dane, F., Dozier, W.A., 2005. Identification of cold acclimated genes in leaves of Citrus unshiu by mRNA differential display. Gene 10 (359), 111–118.

M. Şahin-Çevik / Gene 512 (2013) 536–545 Lee, S.H., et al., 2005. Differential impact of low temperature on fatty acid unsaturation and lipoxygenase activity in fig leaf gourd and cucumber roots. Biochem. Biophys. Res. Commun. 330, 1195–1198. Lee, K.P., Kim, C., Landgraf, F., Apel, K., 2007a. EXECUTER1- and EXECUTER2dependent transfer of stress-related signals from the plastid to the nucleus of Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 104 (24), 10270–10275. Lee, D.G., Ahsan, N., Lee, S.H., Kang, K.Y., Lee, J.J., Lee, B.H., 2007b. An approach to identify cold-induced low-abundant proteins in rice leaf. C. R. Biol. 330 (3), 215–225. Lee, D.G., et al., 2008. Chilling stress-induced proteomic changes in rice roots. J. Plant Physiol. 166 (1), 1–11. Liang, W., et al., 2009. The Arabidopsis homologs of CCR4-associated factor 1 show mRNA deadenylation activity and play a role in plant defence responses. Cell Res. 19 (3), 307–316. Long, G., Song, J., Deng, Z., Liu, J., Rao, L., 2012. Ptcorp gene induced by cold stress was identified by proteomic analysis in leaves of Poncirus trifoliata (L.) Raf. Mol. Biol. Rep. http://dx.doi.org/10.1007/s11033-011-1396-8. Losso, J.N., 2008. The biochemical and functional food properties of the bowman-birk inhibitor. Crit. Rev. Food Sci. Nutr. 48 (1), 94–118. Maestrini, P., et al., 2009. Isolation and expression analysis of low temperature-induced genes in white poplar (Populus alba). J. Plant Physiol. 166 (14), 1544–1556. Mangeon, A., Junqueira, R.M., Sachetto-Martins, G., 2010. Functional diversity of the plant glycine-rich proteins superfamily. Plant Signal Behav. 5 (2), 99–104. Mantri, N.L., Ford, R., Coram, T.E., Pang, E.C., 2007. Transcriptional profiling of chickpea genes differentially regulated in response to high-salinity, cold and drought. BMC Genomics 8, 303. Meng, S.S., Dane, F., Si, Y., Ebel, R., Zhang, C.K., 2008. Gene expression analysis of cold treated versus cold acclimated Poncirus trifoliata. Euphytica 164, 209–219. Miller, G., Shulaev, V., Mittler, R., 2008. Reactive oxygen signaling and abiotic stress. Physiol. Plant. 133 (3), 481–489. Mine, T., Hiyoshi, T., Kasaoka, K., Ohyama, A., 2003. CIP353 encodes an AP2/ERF-domain protein in potato (Solanum tuberosum L.) and response slowly to cold Stress. Plant Cell Physiol. 44 (1), 10–15. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410. Mittler, R., Vanderauwera, S., Gollery, M., Van Breusegem, F., 2004. Reactive oxygen gene network of plants. Trends Plant Sci. 9 (10), 490–498. Nanjo, T., Futamura, N., Nishiguchi, M., Igasaki, T., Shinozaki, K., Shinohara, K., 2004. Characterization of full-length enriched expressed sequence tags of stresstreated poplar leaves. Plant Cell Physiol. 45, 1738–1748. Nemchenko, A., Kunze, S., Feussner, I., Kolomiets, M., 2006. Duplicate maize 13 lipoxygenase genes are differentially regulated by circadian rhythm, cold stress, wounding, pathogen infection, and hormonal treatments. J. Exp. Bot. 57, 3767–3779. Nguyen, H.T., Leipner, J., Stamp, P., Guerra-Peraza, O., 2009. Low temperature stress in maize (Zea mays L.) induces genes involved in photosynthesis and signal transduction as studied by suppression subtractive hybridization. Plant Physiol. Biochem. 47, 116–122. Nogueira, F.T.S., De Rosa, V.E., Menossi, M., Ulian, E.C., Arruda, P., 2003. RNA expression profiles and data mining of sugarcane response to low temperature. Plant Physiol. 132, 1811–1824. Park, A.R., et al., 2001. Interaction of the Arabidopsis receptor protein kinase Wak1 with a glycine-rich protein, AtGRP-3. J. Biol. Chem. 276, 26688–26693. Peng, T., Zhu, X.F., Fan, Q.J., Sun, P.P., Liu, J.H., 2012. Identification and characterization of low temperature stress responsive genes in Poncirus trifoliata by suppression subtractive hybridization. Gene 492, 220–228. Pernas, M., Sanchez-Monge, R., Salcedo, G., 2000. Biotic and abiotic stress can induce cystatin expression in chestnut. FEBS Lett. 467, 206–210. Rabbani, M.A., et al., 2003. Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses. Plant Physiol. 133 (4), 1755–1767. Rensink, W.A., Iobst, S., Hart, A., Stegalkina, S., Liu, J., Buell, C.R., 2005. Gene expression profiling of potato responses to cold, heat, and salt stress. Funct. Integr. Genomics 5 (4), 201–207. Riccardi, F., Gazeau, P., deVienne, D., Zivy, M., 1998. Protein changes in response to progressive water deficit in maize. Quantitative variation and polypeptide identification. Plant Physiol. 117, 1253–1263. Ringli, C., Keller, B., Ryser, U., 2001. Glycine-rich proteins as structural components of plant cell walls. Cell Mol. Life Sci. 58, 1430–1441. Robbins, A.L., Louzada, E.S., 2005. Expression analysis of a cold responsive transcript from trifoliate orange by real-time PCR and RT-PCR. Plant Cell Rep. 24 (10), 612–618.

545

Ryan, C.A., 1989. Proteinase inhibitor gene families: strategies for transformation to improve plant defenses against herbivores. Bioessays 10, 20–24. Sachs, M.M., Freeling, M., Okimoto, R., 1980. The anaerobic proteins of maize. Cell 20, 761–767. Şahin-Çevik, M., Moore, G.A., 2006a. Identification and expression analysis of cold regulated genes from the cold-hardy Citrus relative Poncirus trifoliata (L.) Raf. Plant Mol. Biol. 62, 83–97. Şahin-Çevik, M., Moore, G.A., 2006b. Two AP2 domain containing genes isolated from the cold-hardy Citrus relative Poncirus trifoliata (L.) Raf. are induced in response to cold. Funct. Plant Biol. 33, 863–875. Sakuma, Y., Liu, Q., Dubouzet, J.G., Abe, H., Shinozaki, K., Yamaguchi-Shinozaki, K., 2002. DNA-binding specificity of the ERF/AP2/ERF domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 290, 998–1009. Sarowar, S., et al., 2007. Capsicum annuum CCR4-associated factor CaCAF1 is necessary for plant development and defense response. Plant J. 51, 792–802. Schaffer, M.A., Fischer, R.L., 1990. Transcriptional activation by heat and cold of a thiol protease gene in tomato. Plant Physiol. 93, 1486–1491. Seki, M., et al., 2001. Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13, 61–72. Seki, M., et al., 2002. Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J. 31, 279–292. Shen, Y.G., Zhang, W.K., He, S.J., Zhang, J.S., Liu, Q., Chen, S.Y., 2003. An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress. Theor. Appl. Genet. 106, 923–930. Soost, R.K., Cameron, J.W., 1975. Citrus. In: Janick, J., Moore, J.N. (Eds.), Advances in Fruit Breeding. Purdue University Press, West Lafayette, IN, pp. 507–540. Street, N.R., et al., 2006. The genetics and genomics of the drought response in Populus. Plant J. 48, 321–341. Suzuki, N., Mittler, R., 2005. Reactive oxygen species and temperature stresses: A delicate balance between signaling and destruction. Physiol. Plant. 1–7. Thomashow, M.F., 1998. Role of cold-responsive genes in plant freezing tolerance. Plant Physiol. 118, 1–8. Tsukuda, S., Gomi, K., Yamamoto, H., Akimitsu, K., 2006. Characterization of cDNAs encoding two distinct miraculin-like proteins and stress-related modulation of the corresponding mRNAs in Citrus jambhiri lush. Plant Mol. Biol. 60 (1), 125–136. Ueki, S., Citovsky, V., 2002. The systemic movement of a tobamovirus is inhibited by a cadmium-ion-induced glycine-rich protein. Nat. Cell Biol. 4, 478–486. Vu, J.C.V., Gupta, S.K., Yelenosky, G., Ku, M.S.B., 1995. Cold induced changes in ribulose 1,5-bisphosphate carboxylase-oxygenase and phosphoenolpyruvate carboxylase in citrus. Environ. Exp. Bot. 35, 25–31. Wang, H., Huang, Z.J., Chen, Q., 2004a. Ectopic overexpression of tomato JERF3 in tobacco activates downstream gene expression and enhances salt tolerance. Plant Mol. Biol. 55, 183–192. Wang, W., Vinocur, B., Shoseyov, B.O., Altman, A., 2004b. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 9, 244–252. Wu, T., Kong, X.P., Zong, X.J., Li, D.P., Li, D.Q., 2010. Expression analysis of five maize MAP kinase genes in response to various abiotic stresses and signal molecules. Mol. Biol. Rep. 38 (6), 3967–3975. Yamaguchi-Shinozaki, K., Koizumi, M., Urao, S., Shinozaki, K., 1992. Molecular cloning and characterization of 9 cDNAs for genes that are responsive to desiccation in Arabidopsis thaliana: sequence analysis of one cDNA clone that encodes a putative transmembrane channel protein. Plant Cell Physiol. 33, 217–224. Yan, S.P., Zhang, Q.Y., Tang, Z.C., Su, W.A., Sun, W.N., 2006. Comparative proteomic analysis provides new insight into chilling stress response in rice. Mol. Cell Proteomics 5, 484–496. Yelenosky, G., 1985. Cold Hardiness in Citrus. Hort. Rev. 7, 201–238. Yokoyama, R., Nishitani, K., 2006. Identification and characterization of Arabidopsis thaliana genes involved in xylem secondary cell walls. J. Plant Res. 119, 189–194. Zhang, C.K., et al., 2005a. Cold acclimation induced genes of trifoliate orange (Poncirus trifoliata). Plant Cell Rep. 23 (10–11), 764–769. Zhang, C.K., et al., 2005b. Down-regulated gene expression of cold acclimated Poncirus trifoliata. Can. J. Plant Sci. 85, 417–424. Zhang, X., Liu, S., Takano, T., 2008. Two cysteine proteinase inhibitors from Arabidopsis thaliana, AtCYSa and AtCYSb, increasing the salt, drought, oxidation and cold tolerance. Plant Mol. Biol. 68 (1–2), 131–143.