Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in the prophenoloxidase system, phagocytosis and AMP synthesis

Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in the prophenoloxidase system, phagocytosis and AMP synthesis

Accepted Manuscript Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in ...

NAN Sizes 0 Downloads 0 Views

Accepted Manuscript Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in the prophenoloxidase system, phagocytosis and AMP synthesis

Junhao Ning, Yuan Liu, Zhaoxia Cui PII: DOI: Reference:

S0044-8486(19)30597-6 https://doi.org/10.1016/j.aquaculture.2019.05.025 AQUA 634140

To appear in:

aquaculture

Received date: Revised date: Accepted date:

12 March 2019 9 May 2019 10 May 2019

Please cite this article as: J. Ning, Y. Liu and Z. Cui, Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in the prophenoloxidase system, phagocytosis and AMP synthesis, aquaculture, https://doi.org/10.1016/j.aquaculture.2019.05.025

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Identification and functional analysis of a thioester-containing protein from Portunus trituberculatus reveals its involvement in the prophenoloxidase system, phagocytosis and AMP synthesis

PT

Junhao Ninga,c,d# , Yuan Liua,b,c# , Zhaoxia Cuie,b*

a

b

SC

Chinese Academy of Sciences, Qingdao 266071, China

RI

CAS Key Laboratory of Experimental Marine Biology, Institute of Oceanology,

Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory

NU

for Marine Science and Technology, Qingdao 266071, China c

MA

Center for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao 266071,

China

School of Marine Science, Ningbo University, Zhejiang, Ningbo 315211, China

EP T

e

University of Chinese Academy of Sciences, Beijing 100049, China

ED

d

AC C

* Corresponding author. School of Marine Science, Ningbo University, Zhejiang, Ningbo 315211, China Tel: +86 532 82898509. Fax: +86 532 82898509. E-mail address: [email protected] (Z. Cui). # These authors contributed equally to this work.

1

ACCEPTED MANUSCRIPT ABSTRACT Thioester-containing proteins (TEPs) are an ancient superfamily of secreted effector proteins that perform essential roles in the innate immune response. Herein, a TEP gene, designated as PtTEP, was identified from the swimming crab Portunus

PT

trituberculatus. The open reading frame (ORF) of PtTEP was 4,434 bp in length,

RI

encoded a polypeptide with 1,478 amino acids containing the conserved sequence

SC

features of insect TEP. PtTEP was highly expressed in most immune-related tissues, such as intestine, gill and hepatopancreas, and the expression of PtTEP was

NU

significantly up-regulated in hemocytes after bacterial and fungal challenges.

MA

Compared to that in fertilized eggs, the transcripts of PtTEP were decreased obviously in the cleavage stage and followed by a significant up-regulation in the

it

is

indicated

that PtTEP be a

maternal immune

factor.

RNA

EP T

ovary,

ED

blastula, gastrula and heart-beating stages. Combined with the higher mRNAs in crab

interference- mediated suppression of PtTEP could significantly enhance the expression of prophenoloxidase (proPO) associated genes (PtproPO and PtPPAF) and

AC C

serine protease related genes (PtcSP1-3 and PtSPH) but inhibit the expression of PtLSZ and phagocytosis-related genes (PtMyosin and PtRab5). These results were further supported by the PO and lysozyme activities in hemolymph of the PtTEP-silenced crabs. We also observed that silencing of PtTEP reduced the expression of antimicrobial peptide genes (PtALF1-3, PtCrustin1 and PtCrustin3) and the genes involved in activation of the Toll and NF-κB pathways and additionally increased the mortality of Vibrio alginolyticus infected crabs. Taken together, our 2

ACCEPTED MANUSCRIPT study suggests that PtTEP might function in crab innate immune defense via regulating the proPO-activating system, phagocytosis and AMP synthesis. Keywords: Portunus trituberculatus; TEP; Expression profiles; Phagocytosis;

PT

Prophenoloxidase system; AMP

proteins

(TEPs)

comprise

SC

Thioester-containing

RI

1. Introduction

a

large

family

of

NU

immune-associated proteins characterized by the presence of an intrachain β-cysteinyl-γ-glutamyl thioester bond (Myamoto et al., 2016; Sekiguchi et al., 2012).

MA

TEPs remain inactive in the native state, but when they encounter proteolytic

ED

activation, change in temperature or aqueous conditions, their thioester bond becomes reactive and can bind to invading pathogens or attacking proteases through reacting

EP T

with nucleophilic groups on their surfaces (Chu and Pizzo, 1994; Nonaka, 2014). Three subfamilies in the TEP superfamily have been discovered, including

AC C

complement factors, A2Ms and insect TEPs (iTEPs) subfamilies (Blandin and Levashina, 2004; Zhang et al., 2007). The iTEPs have been mostly studied in mosquito Anopheles gambiae and fruit fly Drosophila melanogaster (Blandin et al., 2008; Vierstraete et al., 2004). Among the detected 19 homologs of iTEP in A. gambiae, AgTEP1 is well characterized and reported to play an opsonin role in the phagocytosis of various pathogens (Levashina et al., 2001; Yassine et al., 2012). AgTEP1 can also bind to the surface of parasites to promote their melanization and lysis (Blandin et al., 2008). In D. melanogaster, six 3

ACCEPTED MANUSCRIPT homologues of iTEP (namely DmTEP1–6) have been identified (Blandin and Levashina, 2004). Among them, DmTEP2, DmTEP3 and DmTEP6 have the capacity to bind to multiple invading microbes, and function as an opsonin role to promote the phagocytosis (Bou Aoun et al., 2010; Stroschein-Stevenson et al., 2006). In addition,

PT

the mutant flies lacking four immune- inducible TEPs (TEP1–4) can suppress the

RI

activation of the Toll pathway, leading to a lower expression of antimicrobial peptide

SC

genes and thus a less efficient phagocytic response (Dostálová et al., 2017). More recently, several TEPs isolated from molluscans reveal their important role in the

NU

immune response against pathogens (Liao et al., 2018; Portet et al., 2018; Xue et al.,

MA

2017).

The first TEP gene in crustaceans has been cloned from crayfish Pacifastacus

ED

leniusculus, which is participated in intestine defense against Pseudomonas

EP T

libanensis/gessardii (Wu et al., 2012). In shrimp Litopenaeus vannamei, LvTEP1 performs key defensive roles against bacteria and virus, and its mRNA expression can be regulated by NF-κB and JNK pathways (Li et al., 2017). However, little is known

AC C

about the biological functions of TEPs in crabs. In the latest decade, the swimming crab (Portunus trituberculatus) has been suffering various diseases and leads to catastrophic economic losses to crab aquaculture (Bonami and Zhang, 2011; Wang and Gu, 2002). Considerable effort has been investigated the innate immune defense mechanism of crabs to help in the discovery of new strategies for controlling the diseases in the field. Here, we report the complete cDNA cloning and functional characterization of an iTEP (PtTEP) from 4

ACCEPTED MANUSCRIPT P. trituberculatus. The expression profiles including tissue-specific expression and temporal expression following pathogens challenge were investigated. The maternal mRNAs of PtTEP were also detected in embryonic stages. The involvement of PtTEP in the prophenoloxidase (proPO) system, phagocytosis and regulation of AMP genes

PT

was elucidated by the siRNA- mediated knockdown approach. The results suggest that

RI

PtTEP is an important immune molecule and is essential for crab survival to a

NU

SC

systemic infection of V. alginolyticus.

MA

2. Materials and methods

2.1. Animals, immune challenge and samples collection

ED

Healthy crabs (100 ± 2 g) purchased from a commercial farm in Qingdao, China,

EP T

were reared in filtered seawater (15 ± 2 ℃) and fed with clams once daily at nightfall for one week before processing. Crabs were randomly separated into four groups, and

AC C

each crab of the challenge group was injected with 3×108 cells of live Vibrio alginolyticus, Micrococcus luteus and Pichia pastoris resuspended in 50 μl phosphate buffered saline (PBS, NaCl 137 mM, KCl 2.7 mM, Na2 HPO4 ‧ 12H2 O 10 mM, KH2 PO4 2mM, pH 7.4) into the arthrodial membrane of the last walking leg, respectively. Crabs receiving an injection of 50 μl PBS were served as the control group. At each time point (0, 2, 4, 8, 12, 24, 48 and 72 h) post- injection, five crabs were randomly sampled to collect hemocytes. Briefly, hemolymph was harvested from the last walking leg with an equal volume of ice-cold anticoagulant buffer (27 5

ACCEPTED MANUSCRIPT mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH 7.0). Then the hemolymph immediately centrifuged at 800 g, 4 ℃ for 5 min to isolate hemocytes. For tissue-specific expression analysis, five untreated male crabs and five females were dissected to get hemocytes, gill, hepatopancreas, eyestalk, muscle, heart, intestine,

PT

stomach, ganglia thoracalia, ovary/testis and brain.

RI

During the breeding season, ovigerous female crabs (P. trituberculatus) were

SC

collected and the fertilized eggs (Fe) were collected immediately after discharge. The developmental stage of crab embryo was monitored under a dissecting microscope,

NU

and embryos from cleavage stage (Cs), blastula stage (Bs), gastrula stage (Gs) and

MA

heart-beating stage (Hs) were collected separately in 1.5 ml tubes from the same crab. The embryonic samples at each stage were collected from five berried crabs. Except

ED

hemocytes, tissues and embryos were immediately frozen in liquid nitrogen and

EP T

stored at -80 ℃ for further RNA isolation.

AC C

2.2. RNA isolation, cDNA synthesis and cloning of PtTEP

The total (1 μg) RNA was extracted using TRIzol reagent according to the manufacture’s protocol (Invitrogen). The RNA quantity and purity were tested using 1% agarose gel electrophoresis and Nanodrop 2000 (Thermo). The first-strand cDNA was synthesized for the quantitative real-time PCR (qRT-PCR) analysis using a PrimeScript™ first Strand cDNA Synthesis Kit (Takara, Dalian, China) with an oligo dT primer, and was used as the template to analyze the expression patterns. To 6

ACCEPTED MANUSCRIPT amplify the 3′- and 5′- ends of PtTEP cDNA sequence, the first strand cDNA was synthesized using the Clontech SMARTer™ RACE cDNA Amplification kit (Takara, Dalian, China) with 5′-CDS Primer A and SMARTer IIA oligo (5′-RACE-ready cDNA) and 3′-CDS Primer (3′-RACE-ready cDNA).

PT

An unigene homologous to PlTEP of P. leniusculus (AEC50086.1) was found in

RI

our transcriptome data, designated as PtTEP. Gene-specific primers (Table 1) were

SC

designed to amplify partial cDNA sequences of PtTEP. The 3′- and 5′-ends were amplified using Universal Primer A mix combined with nested primers (Table 1). The

NU

PCR programs were performed as follows: 94 ℃ for 3 min, 35 cycles of denaturation

MA

at 94 ℃ for 30 s, annealing at Ta for 50 s, and elongation at 72 ℃ for 3 min, followed by a 10 min extension at 72 ℃ and cooling to 16 ℃. The PCR products were

ED

gel-purified and cloned into pMD19-T simple vector (TaKaRa). After being

EP T

transformed into the competent cells of Escherichia coli DH5a, positive recombinants were identified through anti-Amp selection prior to sequencing by a commercial company (Sangon, China). The complete cDNA sequence of PtTEP was obtained by

AC C

overlapping the unigene and the 5′ and 3′ fragments.

2.3. Sequence and phylogenetic analysis

Sequence alignment against the GeneBank protein database was performed using the

BLAST

at

the

National

Center

for

Biotechnology

Information

(http://www.ncbi.nlm.nih.gov/BLAST). Signal peptide was predicted using SignalP 7

ACCEPTED MANUSCRIPT 4.0 program (http://www.cbs.dtu.dk/services/SignalP). The functional sites and domains in the deduced amino acid sequence were predicted with SMART program (http://smart.embl-heidelberg.de/). Multiple sequence alignments of TEPs were performed using the C lustal W program packaged in DNAMAN 8.0 software. The

PT

phylogenetic tree was constructed by the neighbor-joining method using MEGA 7.0

SC

RI

software, applying the poisson model and a bootstrapping procedure with 1000 times.

NU

2.4. Quantification of gene expression by qRT-PCR

MA

qRT-PCR was applied to analyze the expression of PtTEP in different tissues and embryo stages using a pair of gene-specific primers (Table 1). To study its possible

ED

functions in P. trituberculatus innate immunity, the expression patterns of PtTEP in crab hemocytes after pathogens challenge were investigated using the same primers.

EP T

Reactions were carried out on an ABI PRISM 7300 Sequence Detection System (Applied Biosystems, USA) using SYBR green II as fluorescent dye. β-actin was used

AC C

as a reference for internal standardization. For each PCR reaction, a total volume of 20 μl contained 10 μl of 2 SYBR Premix Ex Taq (TaKaRa), 0.4 μl 50 ROX Reference Dye, 4 μl of the diluted cDNA, 0.4 μl of each primer (10 μM), and 4.8 μl of sterile distilled H2 O. The PCR parameters were 95 ℃ for 30 s, 40 cycles of 95 ℃ for 5 s and 60 ℃ for 35 s. Each sample was examined in triplicate. Relative expression levels of PtTEP were quantified by 2‒∆∆CT methods (Livak and Schmittgen, 2001). 8

ACCEPTED MANUSCRIPT

2.5. Synthesis of siRNAs and RNAi assay

Small interfering RNA (siRNA) for RNA interference (RNAi) assays of crab was

instructions.

The

sequence-specific

PtTEP-siRNA

RI

manufacturer’s

PT

synthesized using an in vitro transcription T7 kit (Takara, Dalian) according to the

SC

(5′-GGCAAUCUCCGUCACUCUC-3′) was synthesized to silence the expression of the PtTEP gene, and the sequence of siRNA was scrambled to generate the sequence

(5′-UGCACGUGUCACUCCUACC-3′).

NU

PtTEP-random-siRNA

The

MA

synthesized siRNAs were dissolved in siRNA buffer (50 mM Tris–HCl, 100 mM NaCl, pH 7.5), and examined by electrophoresis and spectrophotometry.

ED

The RNAi assay was conducted in crab by the injection of siRNA into the arthrodial membrane of the last walking leg at 100 μg/crab using a syringe. In details,

EP T

50 μg of siRNA (PtTEP-siRNA or random-siRNA) was injected at a volume of 50 μl per crab. At 24 h after the first injection, 50 μg of siRNA (PtTEP-siRNA or

AC C

random-siRNA) in 50 μl PBS was injected into the same crab. At the same time, crabs only injected with PBS was as the positive control. The amount of injected siRNA was chosen according to our pre-experiment and the RNAi assay in the swimming crab (Ning et al., 2018). For each treatment, five crabs were used. At 24 h and 48 h after the second injection, the intestine and hemocytes from all crabs in the experimental groups and control groups were separately isolated and frozen in liquid nitrogen for RNA extraction and cDNA synthesis as described earlier. Then the 9

ACCEPTED MANUSCRIPT expression of PtTEP was further determined by qRT-PCR to detect the efficiency of the RNAi. The assays described above were biologically repeated four times.

PT

2.6. Expression patterns of immune related genes in the PtTEP-silenced crabs

RI

In order to explore the potential function of PtTEP in regulating serine protease

SC

cascades, phagocytosis, proPO activating system and complement- like pathways, thirteen immune related genes including PtcSP1-3 (clip domain serine protease,

NU

JF412648, JF412649 and JF412650), PtSPH (serine protease homologue, JF412651),

MA

PtproPO (FJ215871), PtPPAF (proPO-activating factor, GQ914996), PtMyosin (POR|c99862_g4), PtRab5 (small GTP-binding protein, POR|c94716_g1), PtLSZ

ED

(lysozyme, FJ589729), PtgC1qR (complement C1q receptor, MK076886), PtMBL (mannose-binding lectin, POR|c92478_g1), PtA2M-1 (MK076885) and PtA2M-2

EP T

(MK076887) were chosen to detect their expression in intestine of the PtTEP-silenced crabs. Meanwhile, we also detected the expression of AMP genes, including

AC C

PtALF1-3 (anti- lipopolysaccharide factor, HM627757, HM627758 and GQ165621), PtCrustin1 (FJ612106), PtCrustin3 (JQ728425), and key genes related to the Toll, NF-κB and JNK pathways, comprising PtTLR (Toll- like receptor, KR108027.1), PtMyD88

(myeloid

differentiation

factor

88,

KM521426.2),

PtPelle

(POR|c93425_g1), PtRelish (MF624027.1) and PtJNK (c-Jun N-terminal kinase, POR|c99916_g3), in the PtTEP-knockdown crabs. The gene-specific primers used for qRT-PCR analysis were listed in Table 1. β-actin was used as the control. 10

ACCEPTED MANUSCRIPT

2.7. Phenoloxidase (PO) activity in the PtTEP-silenced crabs

Total PO activity was detected after setting up the RNAi assay. Hemolymph was

PT

withdrawn from four PtTEP-knockdown crabs without the use of anticoagulant.

(L-dopa) was used to detect PO activity according to

SC

L-3,4-dihydroxyphenylalanine

RI

Protein concentration was measured using a Bradford assay kit (Bio-Rad).

previous literature with slight modification (Amparyup et al., 2009). Briefly, 2 mg of

NU

total hemolymph proteins in 435 μl of Tris–HCl (10 mM, pH 8.0) were mixed with 65

MA

μl of freshly prepared L-dopa (3 mg/ml, Sigma). After incubation at room temperature for 30 min, 500 μl of 10% (v/v) acetic acid was added to each mixture. The reactions

ED

were measured the absorbance at 490 nm in precision microplate reader (Emax). The

AC C

respectively.

EP T

PBS and random-siRNA treated crabs was used as the black and negative control,

2.8. Lysozyme activity in the PtTEP-silenced crabs

After setting up the RNAi assay, lysozyme activity was measured based on the turbidimetric method (Demers and Bayne, 1997) with slight modifications. Briefly, a solution of M. luteus (Nanjing Jiancheng, China) was prepared by dissolving 5 mg of the lyophilized cells in 20 ml sodium phosphate buffer (0.1 M, pH 6.2). 100 μl of hemolymph was withdrawn without the use of anticoagulant from four

11

ACCEPTED MANUSCRIPT PtTEP-silenced crabs using a syringe and quickly added to 1 ml of prepared M. luteus solution (MLS), and bathed at 37 ℃ for 15 min then ice bathed for 3 min. The mixture of hemolymph and MLS was added to a 96-well plate (220 μl/well) in triplicate. 20 μl of double-distilled water and standard solution mixed with 200 μl MLS were added to

PT

96-well plates as a black and a standard, respectively. The plates were assessed

RI

immediately at the absorbance of 530 nm after the ice-bath. The PBS and

SC

random-siRNA treated crabs was used as the black and negative control, respectively.

NU

2.9. Survival rate assay in the PtTEP-silenced crabs

MA

Healthy crabs (100 ± 2 g and n = 30 in each group) were received an injection with 50 μg of siRNA (PtTEP-siRNA or random-siRNA) suspended in 50 μl PBS. At

ED

24 h after the first injection, crabs were injected again with 50 μg of siRNA using the same method. 50 μl of V. alginolyticus (3× 108 cells) was injected into each crab in the

EP T

PtTEP-siRNA and random-siRNA treated groups at 24 h after the second injection, and mock-challenged with PBS as a control. Survival number of crabs in each group

AC C

was counted every 12 h.

2.10. Statistical analysis

Statistical analyses were processed using SPSS 16.0 software. Data obtained from this study were presented as the mean ± standard deviation (S.D.) and subjected to a one-way ANOVA. Differences were considered statistically significant at P <0.05 (*) and P <0.01 (**).

12

ACCEPTED MANUSCRIPT

3. Results

3.1. Sequence analysis of PtTEP

PT

The full- length cDNA sequence of PtTEP was 5110-bp long, consisting of a

RI

134-bp 5′ untranslated region (UTR), an open reading frame (ORF) of 4,434 bp

SC

encoding a 1,478-amino-acid protein with the first 23 amino acid residues as the

NU

putative signal peptide, and a 539-bp 3′ UTR with a polyadenylation signal site and a poly (A) tail (GenBank accession no. MK076888) (Fig. 1). The theoretical mass of

MA

PtTEP mature protein was calculated to be 162.85 kDa with an isoelectric point 5.59. SMART prediction showed that PtTEP contained one canonical thioester motif

ED

(GCGEQ) in residues 935‒939 with a putative thioester bond between Cys936 and

EP T

Gln939 , four proteinase-binding alpha-2-macroglobulin (A2M) domains (A2M-N, A2M-N2, A2M, and A2M-COMP), and one A2M receptor binding domain

AC C

(A2M-RECEP) near the C-terminus (Fig. 1). PtTEP contained seven cysteines positioned at 1,309‒1,468 that formed a C-terminal distinctive cysteine signature like that in the iTEP subfamily.

3.2. Multiple sequence alignment and phylogenetic analysis

The alignment of deduced amino acid sequences revealed that iTEPs from different species were conserved (Fig. 2). PtTEP shared more sequence similarity with 13

ACCEPTED MANUSCRIPT crustacean TEPs (72% identity with LvTEP1 from L. vannamei and 69% with PlTEP2 from P. leniusculus) than insect TEPs (43% identity with IsTEP from Ixodes scapularis, 40% with AaTEP from Aedes aegypti and 30% with DmTEP1 from D. melanogaster). All analyzed TEPs contained the conserved thioester motif (in red

PT

frame) (Fig. 2). The binding activities of TEPs were associated with a histidine

RI

residue approximately 100 amino acids downstream of the thioester domain. Of note

SC

is that this histidine is replaced by an asparagine (Asn) at 111 amino acids downstream of the thioester site in PtTEP (Fig. 2).

NU

The complete amino acid sequences of 57 TEPs from different phyla of animals

MA

were chosen to construct a neighbor-joining (NJ) phylogenetic tree. The tree topology can be separated into three distinct branches clades, including A2M, complement

ED

factor and iTEP- like subfamily (Fig. 3). A2M subfamily was composed of CPAMD8

EP T

and A2M proteins, and complement factor subfamily contained only complement C3-like proteins. PtTEP, LvTEP1 from L. vannamei, PlTEP1, PlTEP2 from P. leniusculus, insect TEP and CD109 proteins were clustered together, then had a closer

AC C

relationship with vertebrate CD109 and molluscan TEP and CD109 proteins.

3.3. Expression profiles of PtTEP in adult tissues and embryos

To investigate the distribution feature of PtTEP, healthy crab tissues and embryos were sampled and subjected to qRT-PCR analysis. PtTEP was constitutively expressed in all tissues examined, with low expression levels in heart, hemocytes and 14

ACCEPTED MANUSCRIPT ganglia thoracalia and high expression levels in eyestalk, intestine, gill, muscle, and hepatopancreas. Of note, the mRNA levels of PtTEP in ovary were significantly higher than those in testis (Fig. 4A). During embryonic development, the mRNAs of PtTEP decreased significantly in cleavage stage compared to fertilized eggs, then

PT

increased significantly after cleavage stage and the highest level was detected in

RI

heart-beating stage. The mRNAs of PtTEP in heart-beating stage were five- fold to

NU

SC

that in fertilized eggs.

MA

3.4. Challenge-induced expression by microorganisms

Hemocytes are considered as the main line of defense in invertebrates and

ED

rapidly respond to pathogenic invasion. Therefore, hemocyte was chosen to analyze the expression patterns of PtTEP in response to bacterial or fungal challenge. After V.

EP T

alginolyticus infection, the transcripts of PtTEP increased abruptly and reached a peak value of approximately 3.4- fold at 2 h, and decreased gradually followed by recovery

AC C

to the initial level at 8 h (Fig. 5A). In response to M. luteus and P. pastoris challenge, the expression of PtTEP cannot been affected within 24 h post injection, followed by a significant increase at 48 h and rose to the highest level at 72 h (Fig. 5A). Since the PtTEP, proPO system and basal immune molecules co-existed in the blood circulation, and PtTEP exhibited a rapid response to V. alginolyticus infection. It was interesting to examine the activities of PO and lysozyme in the hemolymph of crab after V. alginolyticus infection. At the early time of infection, 2 and 4 h, the PO 15

ACCEPTED MANUSCRIPT activity was significantly decreased, but increased to a significantly higher level at 8 and 12 h post injection compared to the initial level, and subsided to the normal level at 24 h post injection (Fig. 5B). However, the lysozyme activity was significantly increased at 2 h, and remained at a significantly higher level until 12 h post injection,

RI

PT

then recovered to the normal level (Fig. 5C).

SC

3.5. Expression analysis of immune-related genes after PtTEP gene silenced by RNAi

NU

The silencing efficiency of synthesized PtTEP-siRNA was shown in Fig. 6. The

MA

expression of PtTEP gene in crab intestine of the RNA interference group was significantly suppressed at 24 and 48 h compared with the random-siRNA group (Fig.

ED

6A). The silencing efficiency of PtTEP-siRNA was 88.6% and 49.9%, respectively, indicating that PtTEP could be specifically and efficiently knocked down by the

EP T

synthesized siRNAs. Moreover, PtTEP gene in crab hemocytes could also be effectively knocked down at 24 h, and the silencing efficiency reached up to 38.0%

AC C

(Fig. 6B). According to the results of specific-tissue expression, intestine (at 24 h post the second PtTEP-siRNAs injection) was selected as the optimal tissue to detect the expression of immune related genes. With the suppression of PtTEP expression, the expression of serine protease related genes (PtcSP1-3 and PtSPH) and proPO-associated genes (PtproPO and PtPPAF) was significantly upregulated compared with the control group in the intestine (Fig. 7A), while PtLSZ, phagocytosis-related genes (PtMyosin and PtRab5) 16

ACCEPTED MANUSCRIPT and complement- like genes (PtA2M-1 and PtA2M-2) were remarkably suppressed. However, there was no obvious effect on PtgC1qR and PtMBL in the PtTEP-silenced

PT

crabs.

3.6. Expression analysis of AMP genes and the key genes involved in immune

SC

RI

pathways after PtTEP gene silenced by RNAi

To figure out whether PtTEP can regulate AMP through specific immune

NU

pathway, the expression of AMP genes and the genes involved in the Toll, NF-κB and

MA

JNK pathways were detected in the PtTEP-knockdown crabs. Results showed that knockdown of PtTEP gene significantly suppressed the expression of AMP genes

ED

(PtALF1-3, PtCrustin1 and PtCrustin3), as well as the genes (PtTLR and PtRelish) involved in the Toll and NF-κB pathways (Fig. 7B). However, the expression of

AC C

(Fig. 7B).

EP T

PtMyD88, PtPelle and PtJNK could not be affected in the PtTEP-knockdown crabs

3.6. Effect of PtTEP gene silencing on PO and lysozyme activities

To further investigate the possible roles of PtTEP in the proPO system and basal immunity, hemolymph was withdrawn from at 24 h post the second PtTEP-siRNAs injection and subjected to PO and lysozyme enzymic activity assay. Results showed that knockdown of PtTEP could significantly increase PO activity by 59.4% when

17

ACCEPTED MANUSCRIPT compared with that of the random-siRNA injection group (Fig. 8A). However, lysozyme activity exhibited an opposite trend, decreased significantly in the PtTEP-silenced crabs compared with that of PBS and random-siRNA injection groups

PT

(Fig. 8B).

SC

RI

3.7. Defensive role of PtTEP against V. alginolyticus infection

In order to investigate the defensive role of PtTEP against the main pathogen V.

NU

alginolyticus infection, experimental crabs were challenged with V. alginolyticus at 24

MA

h after the second PtTEP-siRNAs injection. In the PtTEP-siRNA treated group, the crabs were more vulnerable to V. alginolyticus infection compared with the

ED

random-siRNA treated group, and the survival rate reduced to 26.7% within 96 h after infection (Fig. 9). The survival rates of crabs in the PtTEP-silenced group were

EP T

significantly lower than those of the random-siRNA treated group, suggesting that

AC C

PtTEP performed a crucial role in crab resistance to V. alginolyticus infection.

4. Discussion

Accumulating evidence shows that thioester-containing proteins play essential roles in the innate immunity in invertebrates (Ghai et al., 2007; Li et al., 2017; Portet et al., 2018; Xue et al., 2017; Yassine et al., 2012). Herein, a novel iTEP-like protein from P. trituberculatus, namely PtTEP, was identified. The protein sequence of

18

ACCEPTED MANUSCRIPT PtTEP displayed all the defining features of iTEPs with four proteinase-binding A2M domains, one A2M receptor binding domain, a conserved thioester domain and the C-terminal signature composed of seven cysteine residues (Li et al., 2017; Wu et al., 2012). Moreover, PtTEP clearly clustered within the iTEP group but significantly

PT

distinct from A2M and complement factor groups, suggesting that it is a new member

RI

of the TEP family and may perform similar immune functions of iTEPs.

SC

In complement C3, a catalytic histidine (His) residue is highly conserved at approximately 100 amino acids downstream of the thioester site (Dodds and Law,

NU

2010). However, in this study, as other crustacean TEPs (Li et al., 2017; Wu et al.,

MA

2012), PtTEP had an Asn residue at the comparable position instead of His. In A. gambiae, AgTEP1 with a His residue at 113 amino acids downstream of its thioester

ED

domain can perform a complement- like opsonin that attaches to the surface of E. coli

EP T

and Staphylococcus aureus to activate the phagocytosis (Levashina et al., 2001). In addition, crustacean A2Ms usually have a His or serine (Ser) residue at the catalytic His in complement C3 (Lin et al., 2007; Ma et al., 2010), which might give A2Ms

AC C

C3-like activity (Nakao et al., 2000). Phylogenetic analysis showed three main groups, named complement factor subfamily, A2M subfamily and iTEP-like subfamily. The complement factor subfamily was significantly distinct from the other two groups due to the presence of the anaphylatoxin (ANA) and C-terminal C345C domains. Of note is that a subgroup was formed with CD109 and TEP proteins, which is consistent with the phylogenetic tree topology shown in previous study (Li et al., 2017; Portet et al., 2018). Whereas 19

ACCEPTED MANUSCRIPT some reports suggest that the CD109 proteins belong to A2M subfamily (Fujito et al., 2010; Solomon et al., 2004). Combined with previous studies (Li et al., 2017; Liao et al., 2018; Portet et al., 2018; Wu et al., 2012), we recommend that insect TEPs and CD109 proteins should be present as an iTEP-like subfamily.

PT

In mammals, thioester-containing proteins, such as C3 and A2M, are mainly

RI

synthesized in liver (Andus et al., 1993; Raftos et al., 2004), while the tissue

SC

distribution of TEP transcripts varies in different invertebrate species (Li et al., 2017; Portet et al., 2018; Wu et al., 2012; Zhang et al., 2007). In this study, the high

NU

expression of PtTEP were detected in most immune-related tissues, suggesting its

MA

potential defensive role against pathogens. Due to lack acquired immunity, maternal immune factors were more important for crab embryos and larvae in response to

ED

pathogen infection. The maternal mRNAs of PtTEP were observed in fertilized eggs,

EP T

together with the high mRNA level in crab ovary, our results suggest PtTEP might be a maternal immune factor deposited in the embryos of P. trituberculatus. As embryonic development proceeds, the elimination of maternal gene products and

AC C

zygotic genome activation (ZGA) occur during the maternal-to-zygotic transition (Tadros and Lipshitz, 2009; Walser and Lipshitz, 2011). The mRNAs of PtTEP showed a significant decrease at the cleavage stage followed by a significant increase after the cleavage stage, which also favors the view that PtTEP may be a maternally derived immune factor. The transcripts of PtTEP can be induced by both the Gram- negative bacterium and the Gram-positive bacterium, as well as fungi, suggesting the involvement of 20

ACCEPTED MANUSCRIPT PtTEP in crab innate immune response. The significant up-regulation of PtTEP mRNAs in hemocytes was observed at 2 h post V. alginolyticus injection, which suggests PtTEP may be inducible acute-phase molecule. It is in good agreement with a significant upregulation of PfA2M in Pinctada fucata at early time point after V.

PT

alginolyticus infection (Wang et al., 2016). Similar to that reported in shrimp LvTEP1

RI

(Li et al., 2017), crabs with knockdown of PtTEP were more susceptible to V.

SC

alginolyticus infection compared to the control group, suggesting that PtTEP can play a crucial role in the defensive response against foreign invaders.

NU

To investigate whether the PtTEP can regulate the proPO activating system, the

MA

PO activities were detected in hemolymph after V. alginolyticus infection. PO activities were reversely related to the abundance of PtTEP transcripts, indicating that

ED

PtTEP may function in the negative regulation of proPO system. Similar analysis was

EP T

also reported in LvA2M from L. vannamei (Ponprateep et al., 2016). Moreover, with the suppression of PtTEP expression, the expression of proPO-associated genes and PO activities in crab hemolymph were significantly higher than the control treatments,

AC C

which also favors that PtTEP is a co-regulator of the proPO-activating system. Furthermore, knockdown of PtTEP led to a lower expression of phagocytosis-related genes, suggesting that PtTEP might have an opsonic function in regulating the phagocytosis. Similarly, knockdown of PfA2M in P. fucata can also manifestly reduce the phagocytosis of hemocytes (Wang et al., 2016). To our knowledge, a series of serine proteases are required for the activation of the proPO system (Jang et al., 2008; Söderhäll and Cerenius, 1998). We also observed 21

ACCEPTED MANUSCRIPT that serine protease related genes were significantly up-regulated when PtTEP gene was knocked down, which further supports that PtTEP could function in regulating the proPO activating system. In addition, the typical serine protease inhibitor, A2M, can regulate the active proteases in the blood circulation system (Ponprateep et al.,

that PtTEP may function upstream or

RI

PtTEP-knockdown crabs indicated

PT

2016). The significant down-regulation of PtA2M-1 and PtA2M-2 in the

SC

independently of the serine protease cascades. Knockdown of PtTEP could not affect the expression of PtgC1qR and PtMBL, while the expression of PtTEP, PtA2M-1 and

NU

PtA2M-2 was changed significantly with suppression of PtgC1qR or PtMBL (Ning et

MA

al., 2018), which suggests that thioester-containing proteins may function downstream of PtgC1qR or PtMBL in crab with similarities to the classical and lectin pathways in

ED

vertebrates (Endo et al., 2006).

EP T

In invertebrates, antimicrobial peptides play important roles in the innate immune response against foreign invaders (Lemaitre and Hoffmann, 2007). In the present study, the expression of AMP genes was significantly suppressed in the

AC C

PtTEP-silenced crabs. Besides, with suppression of PtTEP expression, the changing tendency of AMP genes was consistent with the expression of PtToll and PtRelish involved in the Toll and NF-κB pathways. It indicates PtTEP may regulate the synthesis of antimicrobial peptides through the Toll and NF-κB pathways. This is consistent with the results reported in the TEP mutant flies (Dostálová et al., 2017). It is well-known that lysozyme is a broad-spectrum defensive molecule involved in the lysis of the bacterial cell wall. In this study, silencing of PtTEP gene significantly 22

ACCEPTED MANUSCRIPT suppressed the basal expression of lysozyme gene. This result was also supported by the significant reduction of lysozyme activities in hemolymph in the PtTEP-silenced crabs. We also observed that lysozyme activities were positively related to the mRNA levels of PtTEP transcripts after V. alginolyticus infection. Accordingly, it is tempting

PT

to speculate that PtTEP may play an essential role in the basal immunity of crab.

RI

In summary, a novel iTEP was isolated from the swimming crab. The

SC

maternally-derived mRNAs of PtTEP were detected in embryos. After bacteria and fungi challenges, the expression of PtTEP was significantly up-regulated in

NU

hemocytes. PtTEP regulated the proPO-activating system probably by preventing

MA

relevant serine proteases from activating the protease cascades. Knockdown of PtTEP resulted in lower expression of phagocytosis-related genes and thus a significant

ED

reduction of lysozyme activities in hemolymph. Furthermore, PtTEP might be involved in the transcriptional regulation of AMP genes through regulating the Toll

AC C

EP T

and NF-κB pathways.

Disclosure statement The authors declare no conflict of interest.

Acknowledgments

We are grateful to all the laboratory members for technical advice and helpful discussions. This research was supported by National Key R&D Program of China 23

ACCEPTED MANUSCRIPT (2018YFD0900303), National Natural Science Foundation of China (41776159), Scientific and Technological Innovation Project of Qingdao National Laboratory for Marine Science and Technology (2015ASKJ02) and Natural Science Foundation of

PT

Shandong Province (ZR2017QD001).

RI

References

SC

Amparyup, P., Charoensapsri, W., Tassanakajon, A., 2009. Two prophenoloxidases

NU

are important for the survival of Vibrio harveyi challenged shrimp Penaeus

MA

monodon. Dev. Comp. Immunol. 33, 247–256.

Andus, T., Gross, V., Tran-Thi, T.A., Schreiber, G., Nagashima, M., Heinrich, P.C.,

ED

1993. The biosynthesis of acute-phase proteins in primary cultures of rat hepatocytes. Febs. Journal. 133, 561–571.

EP T

Armstrong, P.B., Quigley, J.P., 1999. α2- macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev. Comp, Immunol. 23, 375–390.

AC C

Blandin, S., Levashina, E.A., 2004. Thioester-containing proteins and insect immunity. Mol. Immunol. 40, 903–908. Blandin, S.A., Marois, E., Levashina, E.A., 2008. Antimalarial responses in Anopheles gambiae: from a complement- like protein to a complement-like Pathway. Cell Host Microbe. 3, 364–374. Bou Aoun, R., Hetru, C., Troxler, L., Doucet, D., Ferrandon, D., Matt, N., 2010. Analysis of thioester-containing proteins during the innate immune response of

24

ACCEPTED MANUSCRIPT Drosophila melanogaster. J. Innate. Immunl. 3, 52–64. Chu, C.T., Pizzo, S.V., 1994. alpha 2- macroglobulin, complement, and biologic defense: antigens, growth factors, microbial proteases, and receptor ligation. Lab. Invest. 71, 792–812.

PT

Demers, N.E., Bayne, C.J., 1997. The immediate effects of stress on hormones and

RI

plasma lysozyme in rainbow trout. Dev. Comp. Immunol. 21, 363–373.

SC

Dodds, A.W., Law, S.K.A., 2010. The phylogeny and evolution of the thioester

15–26. A.,

Rommelaere,

S.,

Poidevin,

M.,

Lemaitre,

B.,

2017.

MA

Dostálová,

NU

bond-containing proteins C3, C4 and α2- macroglobulin. Immunol. Rev.166,

Thioester-containing proteins regulate the Toll pathway and play a role in

ED

Drosophila defence against microbial pathogens and parasitoid wasps. BMC

EP T

Biol. 15, 79.

Endo, Y., Takahashi, M., Fujita, T., 2006. Lectin complement system and pattern recognition. Immunobiology. 211, 283–293.

AC C

Fujito, N.T., Sugimoto, S., Nonaka, M., 2010. Evolution of thioester-containing proteins revealed by cloning and characterization of their genes from a cnidarian sea anemone, Haliplanella lineate. Dev. Comp. Immunol. 34, 775–784. Ghai, R., Waters, P., Roumenina, L.T., Gadjeva, M., Kojouharova, M.S., Reid, K.B.M., Sim, R.B., Kishore, U., 2007. C1q and its growing family. Immunobiol. 212, 253–266. Jang, I.H., Nam, H.J., Lee, W.J., 2008. CLIP-domain serine proteases in Drosophila 25

ACCEPTED MANUSCRIPT innate immunity. BMB Rep. 41, 102–107. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Levashina, E.A., Moita, L.F., Blandin, S., Vriend, G., Lagueux, M., Kafatos, F.C.,

PT

2001. Conserved role of a complement- like protein in phagocytosis revealed by

RI

dsRNA knockout in cultured cells of the mosquito, Anopheles gambiae. Cell. 104,

SC

709–718.

Li, C., Li, H., Xiao, B., Chen, Y., Wang, S., Lu, K., Yin, B., Li, S., He, J., 2017.

NU

Identification and functional analysis of a TEP gene from a crustacean reveals its

MA

transcriptional regulation mediated by NF-κB and JNK pathways and its broad protective roles against multiple pathogens. Dev. Comp. Immunol. 70, 45–58.

ED

Liao, H., Wang, J., Xun, X., Zhao, L., Yang, Z., Zhu, X., Xing, Q., Huang, X., Bao, Z.,

EP T

2018. Identification and characterization of TEP family genes in Yesso scallop (Patinopecten yessoensis) and their diverse expression patterns in response to bacterial infection. Fish Shellfish Immunol. 79, 327–339.

AC C

Lin, Y.C., Vaseeharan, B., Ko, C.F., Chiou, T.T., Chen, J.C., 2007. Molecular cloning and characterisation of a proteinase inhibitor, alpha 2-macroglobulin (alpha2-M) from the haemocytes of tiger shrimp Penaeus monodon. Mol. Immunol. 44, 1065–1074. Livak, K., Schmittgen, T., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2‒∆∆CT method. Method. 25, 402–408. Ma, H., Wang, B., Zhang, J., Li, F., Xiang, J., 2010. Multiple forms of alpha-2 26

ACCEPTED MANUSCRIPT macroglobulin in shrimp Fenneropenaeus chinesis and their transcriptional response to WSSV or Vibrio pathogen infection. Dev. Comp. Immunol. 34, 677–684. Myamoto, D.T., Pidde-Queiroz, G., Pedroso, A., Gonçalves-De-Andrade, R.M., Van

PT

Den Berg, C.W., Tambourgi, D.V., 2016. Characterization of the gene encoding

RI

component C3 of the complement system from the spider Loxosceles laeta

SC

venom glands: Phylogenetic implications. Immunobiol. 221, 953–963. Nakao, M., Mutsuro, J.R., Fujiki, K., Nonaka, M., Yano, T., 2000. Molecular cloning

NU

and protein analysis of divergent forms of the complement component C3 from a

MA

bony fish, the common carp (Cyprinus carpio): presence of variants lacking the catalytic histidine. Eur. J. Immunol. 4, 5–8.

ED

Ning, J., Liu, Y., Gao, F., Liu, H., Cui, Z., 2018. Characterization and functional

EP T

analysis of a novel gC1qR in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 84, 970–978. Nonaka, M., 2014. Evolution of the Complement System. Subcell. Biochem. 80,

AC C

31–43.

Ponprateep, S., Vatanavicharn, T., Lo, C.F., Tassanakajon, A., Rimphanitchayakit, V., 2016. Alpha-2-macroglobulin is a modulator of prophenoloxidase system in pacific white shrimp Litopenaeus vannamai. Fish Shellfish Immunol. 62, 68–74. Portet, A., Galinier, R., Pinaud, S., Portela, J., Nowacki, F., Gourbal, B., Duval, D., 2018. BgTEP: an antiprotease involved in innate immune sensing in Biomphalaria glabrata. Front. Immunol. 9, 1–16. 27

ACCEPTED MANUSCRIPT Raftos, D.A., Fabbro, M., Nair, S.V., 2004. Exocytosis of a complement component C3-like protein by tunicate hemocytes. Dev. Comp. Immunol. 28, 181–190. Söderhäll, K., Cerenius, L., 1998. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23–28.

PT

Sekiguchi, R., Fujito, N.T., Nonaka, M., 2012. Evolution of the thioester-containing

RI

proteins (TEPs) of the arthropoda, revealed by molecular cloning of TEP genes

SC

from a spider, Hasarius adansoni. Dev. Comp. Immunol. 36, 483–489. Solomon, K.R., Sharma, P., Chan, M., Morrison, P.T., Finberg, R.W., 2004. CD109

NU

represents a novel branch of the α2-macroglobulin/complement gene family.

MA

Gene. 327, 171–183.

Stroschein-Stevenson, S.L., Foley, E., O'Farrell, P.H., Johnson, A.D., 2006.

ED

Identification of Drosophila gene products required for phagocytosis of Candida

EP T

albicans. PLoS Biol. 4, e4.

Tadros, W., Lipshitz, H., 2009. The maternal-to- zygotic transition: a play in two acts. Development. 136, 3033–3042.

AC C

Vierstraete, E., Verleyen, P., Baggerman, G., D'Hertog, W., Van Den Bergh, G., Arckens, L., De Loof, A., Schoofs, L., 2004. A proteomic approach for the analysis of instantly released wound and immune proteins in Drosophila melanogaster hemolymph. Proc. Nat. Acad. Sci. USA. 101, 470–475. Walser,

C.B.,

Lipshitz,

H.D.,

2011.

Transcript

clearance

during

the

maternal-to-zygotic transition. Curr. Opin. Genet. Dev. 21, 431–443. Wang, W., Gu, Z., 2002. Rickettsia- like organism associated with tremor disease and 28

ACCEPTED MANUSCRIPT mortality of the Chinese mitten crab Eriocheir sinensis. Dis. Aquat. Orga. 48, 149–153. Wang, Z., Wang, B., Chen, G., Lu, Y., Jian, J., Wu, Z., 2016. An alpha-2 macroglobulin in the pearl oyster Pinctada fucata: Characterization and function

PT

in hemocyte phagocytosis of Vibrio alginolyticus. Fish Shellfish Immunol. 55,

RI

585–594.

SC

Wu, C., Noonin, C., Jiravanichpaisal, P., Söderhäll, I., Söderhäll, K., 2012. An insect TEP in a crustacean is specific for cuticular tissues and involved in intestinal

NU

defense. Insect Biochem. Mol. Biol. 42, 71–80.

MA

Xue, Z., Wang, L., Liu, Z., Wang, W., Chang, L., Song, X., Wang, L., Song, L., 2017. The fragmentation mechanism and immune-protective effect of CfTEP in the

ED

scallop Chlamys farreri. Dev. Comp. Immunol. 76, 220–228.

EP T

Yassine, H., Kamareddine, L., Osta, M.A., 2012. The mosquito melanization response is implicated in defense against the entomopathogenic fungus Beauveria bassiana. Plos Pathog. 8, e1003029.

AC C

Zhang, H., Song, L., Li, C., Zhao, J., Wang, H., Gao, Q., Xu, W., 2007. Molecular cloning and characterization of a thioester-containing protein from Zhikong scallop Chlamys farreri. Mol. Immunol. 44, 3492–3500. Figure Captions Fig. 1. The sequence analysis of PtTEP. (A) The full- length cDNA sequence and deduced amino acid sequences of PtTEP. The conserved functional domains including four proteinase-binding alpha-2- macroglobulin (A2M) domains (A2M-N, A2M-N2, 29

ACCEPTED MANUSCRIPT A2M and A2M-COMP) and one A2M receptor binding domain (A2M-RECEP) were boxed. The putative signal peptide sequence in N-terminal was underlined with a black line, the thioester motif (GCGEQ) was represented in a red box, as well as the Poly (A) addition signals (AATAAA) was denoted by a double underline. Seven

PT

cysteines located at 1309-1468 in the C-terminal were circled. (B) Architecture and

RI

location representation of the characteristic domains of PtTEP, SP indicated signal

SC

peptide.

NU

Fig. 2. Multiple sequence alignment of TEP proteins. The Box1~5 corresponding to

MA

A2M-N, A2M-N2, A2M, A2M-COMP and A2M-RECEP have been shown respectively in Fig. 1. Sequences in red box was putative thioester motif as indicated

ED

in the figure, and the thioester associated histidine (His) was indicated by a red

EP T

triangle. Multiple alignments were performed with the thioester-containing proteins in Supplementary Table 1.

AC C

Fig. 3. Phylogenetic tree of thioester-containing proteins produced using the Neighbor-joining method. Phylogenetic analysis of the TEP superfamily full- length protein sequences from 57 members (Supplementary Table 1). PtTEP was marked by a black triangle. A bootstrap analysis of 1,000 replications was carried out on the tree inferred from the Neighbor-joining method and the values are shown at each branch of the tree.

30

ACCEPTED MANUSCRIPT Fig. 4. The expression profiles of PtTEP in different tissues (A) and embryos at early developing stages (B) determined by qRT-PCR. Tissue names were shortened as: msl for muscle, gil for gill, hep for hepatopancreas, hrt for heart, int for intestine, stm for stomach, gat for Ganglia thoracalia, ovr for ovary, tes for testis, eys for eyestalk, bra

PT

for brain and hem for hemocyte. Fe: fertilized eggs, Cs: cleavage stage, Bs: blastula

RI

stage, Gs: gastrula stage, Hs: heartbeat stage. Each column represented the mean of

SC

triplicate assays within ± S.D. The statistically differences were represented with

NU

asterisk (* P < 0.05, ** P < 0.01).

MA

Fig. 5. Expression response of PtTEP to pathogens challenge in hemocytes (A) and relative activities of phenoloxidase (PO) (B) and lysozyme (LSZ) (C) in crab

ED

hemolymph post V. alginolyticus injection. Each column represented the mean of

EP T

triplicate assays within ± S.D. The statistically differences were represented with asterisk (* P < 0.05, ** P < 0.01).

AC C

Fig. 6. The silencing efficiency of siRNA on transcription level of PtTEP in the intestine (A) and hemocytes (B) of P. trituberculatus. Control: positive control group after

PBS

only

injection;

Random-siRNA:

negative

control

group

after

random-siRNA injection; RNAi: experimental group after PtTEP-siRNA injection. Each column represented the mean of triplicate assays within ± S.D. The statistically differences between experimental group and control group were represented with asterisk (* P < 0.05, ** P < 0.01). 31

ACCEPTED MANUSCRIPT

Fig. 7. Expression analysis of AMP and immune-related genes in the PtTEP-silenced crabs mediated by siRNA. (A) The expression of immune related gene in PtTEP-knockdown crabs detected by qRT-PCR. (B) Regulation expression of AMP

PT

genes mediated by the Toll and NF-κB pathways in the PtTEP-silenced crabs. Control:

RI

negative control group after random-siRNA injection, RNAi: experimental group after

SC

PtTEP-siRNA injection. Each column represented the mean of triplicate assays within ± S.D. The statistically differences between experimental group and control group

MA

NU

were represented with asterisk (* P < 0.05, ** P < 0.01).

Fig. 8. The PO (A) and LSZ (B) activities in hemolymph of crabs with the PtTEP

ED

gene knockdown. Crabs injected with random-siRNA and PBS were used as negative

EP T

control group and positive control group, respectively. Each column represented the mean of triplicate assays within ± S.D. The statistically differences between experimental group and control group were represented with asterisk (* P < 0.05, **

AC C

P < 0.01).

Fig. 9. Function of PtTEP against bacterial infection. After setting up the RNAi assay, crabs were infected with V. alginolyticus at 24 h after the last injection, and the PBS as the negative control. Statistical significances between PtTEP-siRNA and random-siRNA (as a positive control) treated groups were calculated using the One-Way ANOVA. Results were representative of three independent experiments. 32

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

ED

Table 1 Primer sequences used in this study

Reverse primer (5′–3′)

PtTEP-1

CTGCTCAGACAGATTGCCGA

TTTGGTGGTGACGGTGATGT

PtTEP-2

GCGAGGAGATGTGGTGTTCA

ACTGCTCTCAAAAGGCCACA

PtTEP-3

AGCAGCAATGAAGAGCAGAGAG

TGATGAAGGAAAGCAGCGAGA

CTCTTCTCGCTGCTTTCCTTCATC

TTTTTGGGACTTTGCCACCACTT

ACTATGTCCAGCCAGCGTGT

GGAAGGACTCGCGCTCATAG

TAAGGACATCGGACAGGAGACACT

TAAGGAAGTGAACGCTATCTCT

RT-PtcSP3

AAGCCAGTCGAAATACAGGAG

CAGCATCTCCTTCCCAATTCC

RT-PtSPH

CATCCTTGACCAGCCAGCA

CCCACCCAGACACAACACA

RT-PtMyosin

CGTTGGCGAAGTAGGAGAGT

GAACAAGAGGCGTAATGAGGT

RT-PtRab5

AACCCAGCATCCAGTCACCC

TACCCCTAAGCCCCTCAACC

RT-PtLSZ

AGAAGTGGAAGGGAAAGGGG

GTCTGATGGGAACACGAGCG

RT-PtproPO

CCTCTTCTTCACGACACTCAACTG

TCACGAGATAACACAAAACGCC

RT-PtPPAF

GGACAGGACCAAGACCCAGT

GATTTGAGAAGGAACAAGCGTG

RT-PtCrustin1

GGCAGTTGTGGCTACCATTGT

CGCTCGGTGTAAGGTGGATAG

RT-PtCrustin3

AGTATCTCAGAATCGACCA

CCCTCTTAGTTTCTCTTGTT

qRT-PCR RT-PtTEP RT-PtcSP1 RT-PtcSP2

AC C

cDNA cloning

EP T

Forward primer (5′–3′)

Primers Name

33

ACCEPTED MANUSCRIPT ACGACGAGGAGGAGAAAGAGG

GGCACTGATGGTGGAAACTGA

RT-PtALF2

GACGCTCTGAAGGACTTTATG

CGCCGAAACGCTTAGAAATAC

RT-PtALF3

TAGTCGTGGTGAGAGGGCAA

CTTTGCTCTCTCATCAGGAC

RT-PtgC1qR

ACGTGTCTTCAGGGGCGTGT

GCTCCCGGTCACCTCTCGTG

RT-PtMBL

GGCACCGTCGGTCATCCAAC

GCTGGCTGCGACCAAACCTT

RT-PtA2M-1

TGGAGGACGTGAAACCCGGC

CGTCGTTTGGTGGCAGCGTG

RT-PtA2M-2

GTGGTTGGCTACGGGACGGGT

ACGGCAATGTCATCACTGGGGAT

RT-PtTLR

CATTGAGGACAGCCACAGGAC

TGGTAGAGAGGTACAGCTTGAGTTC

RT-PtMyD88

GGTCCTTGAAGCAACAGGTGGTAG

AGTGCTGGCTGACTAGGAGATGAC

RT-PtPelle

ACTCTTGCCTTCCCTTGCTAAC

ACTGACCATGAATCATACCCCTG

RT-PtRelish

CCAGAGTACGCAAGCCACATCAC

CCGCAGCACCACCTTGTTCAG

RT-PtJNK

AGTGTGGCGGCTCAGCTGTT

CTCCACTCCGACTGCCTCGC

RT-β-actin

TCACACACTGTCCCCATCTACG

ACCACGCTCGGTCAGGATTTTC

RI

PT

RT-PtALF1

PtTEP-3’RACE2

TTGGTGGAGAAGAAGCCAGACAG

PtTEP-5’RACE1

GAAGTGATTGTGGGTGCCGAGC

PtTEP-5’RACE2

CCACTGCCTTACCCTGTGTCCTG

NU

GTCAGGAACAGCATCAACAGAGGC

AC C

EP T

ED

MA

PtTEP-3’RACE1

SC

RACE

34

ACCEPTED MANUSCRIPT Highlights 1. A novel thioester-containing protein were isolated from Portunus trituberculatus. 2. PtTEP might be maternally- transferred immune factor and can be induced by

PT

bacteria or fungi. 3. Knockdown of PtTEP rendered crabs more susceptible to Vibrio alginolyticus

RI

infection.

AC C

EP T

ED

MA

NU

SC

4. PtTEP was involved in the proPO-activating system and basal immunity.

35

Figure 1A

Figure 1B

Figure 2A

Figure 2B

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9