Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma

Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma

GENE-40613; No. of pages: 6; 4C: 3, 4 Gene xxx (2015) xxx–xxx Contents lists available at ScienceDirect Gene journal homepage: www.elsevier.com/loca...

1MB Sizes 0 Downloads 37 Views

GENE-40613; No. of pages: 6; 4C: 3, 4 Gene xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma Yin Yang a,b,c,1, Yi Shi a,c,1, Xiaofang Huang d, Xiulan Li a, Zimeng Ye a,e, Ping Shuai a,c, Chao Qu b,c, Rong Chen f, Jiaxing Xu g, Zhenglin Yang a,c, Fang Lu a,c,⁎, Bo Gong a,c,⁎ a

Sichuan Provincial Key Laboratory for Disease Gene Study, Hospital of University of Electronic Science and Technology of China & Sichuan Provincial People's Hospital, Chengdu, Sichuan, China Department of Ophthalmology, Hospital of University of Electronic Science and Technology of China & Sichuan Provincial People's Hospital, Chengdu, Sichuan, China School of Medicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, China d Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan, China e College of Life Science and Engineering, Southwest Jiaotong University, Chengdu, Sichuan, China f Department of Microbiology & Immunology, North Sichuan Medical College, Nanchong, Sichuan, China g Qunli Surgical Operating Room, First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang, China b c

a r t i c l e

i n f o

Article history: Received 24 January 2015 Received in revised form 13 June 2015 Accepted 16 June 2015 Available online xxxx Keywords: POAG Mutation MYOC

a b s t r a c t Purpose: The myocilin (MYOC) gene has been shown to be related to primary open-angle glaucoma (POAG). This study was aimed to detect the mutations in MYOC in a Chinese family with POAG. Methods: A family with four members, the parents, a son and a daughter, was enrolled in this study. All members of the family underwent the complete ophthalmologic examinations. Genomic DNA was collected from peripheral blood of all the participants. The coding sequence of MYOC was amplified by polymerase chain reaction (PCR), followed by direct DNA sequencing. Results: The son, who was the proband of this family, was diagnosed as early-onset POAG in both eyes. His mother was diagnosed as POAG ten years ago. A novel heterozygous missense mutation c.761CbG (p.P254R) in the MYOC gene, was identified as being co-segregated with the phenotype of this family. This mutation was detected in the two affected patients, but not present in the other normal family members or 384 normal controls. Conclusions: This study provides a mutation spectrum of MYOC resulting in POAG development in a Chinese population, which may help to better understand the molecular pathogenesis and clinical diagnosis of MYOCassociated POAG. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Glaucoma is the second leading cause of blindness worldwide and characterized by progressive changes in the optic nerve head and visual field loss (Sharts-Hopko and Glynn-Milley, 2009). Primary open-angle glaucoma (POAG) is the major type of primary glaucoma in most populations (Quigley and Broman, 2006). It is defined by an open, normal appearing anterior chamber angle, optic nerve damage, visual fields defects, and elevated intraocular pressure (IOP). There are two forms of POAG: juvenile onset and adult onset. Usually, juvenile open angle

Abbreviations: the myocilin, (MYOC); primary open-angle glaucoma, (POAG); polymerase chain reaction, (PCR); juvenile open angle glaucoma, (JOAG); intraocular pressure, (IOP); the sorting tolerant from intolerant homology tool, (SIFT); human trabecular meshwork, (HTM) cells. ⁎ Corresponding authors at: Sichuan Provincial Key Laboratory for Disease Gene Study, Hospital of University of Electronic Science and Technology of China & Sichuan Provincial People's Hospital, 32 Road West 2, The First Ring, Chengdu, Sichuan 610072, China. E-mail addresses: [email protected] (F. Lu), [email protected] (B. Gong). 1 These authors contributed equally to this study.

glaucoma (JOAG) may manifest clinically between the ages of 3 and 35 (Morissette et al., 1995), while adult POAG manifests clinically after the age of 40 (Quigley and Broman, 2006). Severe loss of vision can occur when there is appreciable and irreversible loss of the vision field. Therefore, it is very important to diagnose POAG early in its course or even predict its risk. POAG is a complex disease with multiple risk factors. Although the exact mechanisms of POAG remain unclear, the accumulating evidences suggest that the genetic basis plays an important role in its pathogenesis (Bron et al., 2008). A previous study estimated that 72% of all POAG cases exhibited an inherited or familial form of the disease, which does not show a clear pattern of Mendelian inheritance (Gong et al., 2007). So far, there are more than 20 candidate chromosomal loci and many variants have been identified in relation to POAG by linkage analysis and association studies (Takamoto and Araie, 2014). Among them, genes causing monogenic forms of POAG include myocilin (MYOC) (Stone et al., 1997), optineurin (OPTN) (Rezaie et al., 2002), and WD repeat-domain 36 (WDR36) (Monemi et al., 2005), TANK-binding kinase 1 (TBK1) (Fingert, 2011) and Ankyrin repeat- and SOCS box-containing gene 10 (ASB10) (Pasutto et al., 2012) and so on.

http://dx.doi.org/10.1016/j.gene.2015.06.042 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042

2

Y. Yang et al. / Gene xxx (2015) xxx–xxx

Table 1 Family member phenotypes and genotypes.

Table 2 Primers used for mutation screening in MYOC gene.

Family member

I:1

I:2

II:1

II:2

Age (year)/sex Onset age (year) Cup: disc ratio (OD/OS) Visual field damage Maximal IOP, mm Hg (OD/OS) Visual acuity (OD/OS) Mutation

57/M – 0.3/0.3 Normal 14/15

56/F 46 0.8/0.8 Severe 28/30

34/M 34 0.7/0.8 Moderate 31/31

31/F – 0.3/0.3 Normal 14/14

1.0/1.0 –

0.5/0.6 c.761CbG (p.P254R)

Light perception c.761CbG (p.P254R)

1.0/1.0 –

Primer name

Primer sequence (5′–3′)

Product size (bp)

Annealing temperature (°C)

MYOC 1.1F MYOC 1.1R MYOC 1.2F MYOC 1.2R MYOC 2F MYOC 2R MYOC 3.1F MYOC 3.1R MYOC 3.2F MYOC 3.2R

CACCTCTCAGCACAGCAGA AGGTCAATTGGTGGAGGAGG CCTCCTCCACCAATTGACCT CTGTCTTGTGCTAGCTGTGC ACATAGTCAATCCTTGGGCCA CTGTTCCTCTTCTCCTCCCC ATTTGTCTCCAGGGCTGTCA AGTCAATGTCCGTGTAGCCA TGGCTACACGGACATTGACT CCATTGCCTGTACAGCTTGG

362

59

440

59

338

59

528

60

421

59

F: forward primer; R: reverse primer; bp: base pair.

MYOC is the first gene identified to be responsible for POAG. It is also the most frequently mutated gene in POAG family, accounting for 3%–4% of all the cases among different populations, including Caucasian, Asian and African American populations (Takamoto and Araie, 2014; Stone et al., 1997; Sheffield et al., 1993). This gene locates at GLC1A locus on chromosome 1q23, consists of three exons and encodes 57 kD myocilin protein (Green et al., 2007). To date, 97 different pathogenic MYOC mutations have been identified (http://www.myocilin.com/variants.php) and most of them are clustered in the third exon which encodes the olfactomedin-like domain (Kwon et al., 2009). In this study, we characterized the clinical findings and investigated the molecular basis of a Chinese family with POAG, to expand the mutation spectrum of MYOC in the Chinese population.

2. Materials and methods 2.1. Subjects This study was approved by the Institutional Review Boards of the Hospital of University of Electronic Science and Technology of China & Sichuan Provincial People's Hospital. Written informed consents were obtained from all subjects prior to the studies. All procedures in this study adhered to the tenets of the Declaration of Helsinki. Unrelated control subjects were recruited from the Hospital of University of Electronic Science and Technology of China and Sichuan Provincial People's Hospital.

2.2. Clinical diagnosis Clinical information about the family is listed in Table 1. The diagnostic criteria for POAG were applied as described previously (Gong et al., 2015). Briefly, it includes absence of any secondary form of glaucoma, such as exfoliation syndrome or a history of ocular trauma; gonioscopically open anterior chamber angle (Shaffer grade III or IV); optic nerve damage, such as vertical cup-to-disc ratio higher than 0.6 or asymmetry in disc appearance, disc hemorrhage, and focal loss of the nerve fiber layer; characteristic visual field changes tested by standard automated perimetry (Humphrey Field Analyzer II, Carl Zeiss Meditec, Dublin, CA); and IOP greater than 22 mm Hg in both eyes without medications. IOP was measured by Goldmann applanation tonometry (Haag Streit, Bern, Switzerland). Optical Coherence Tomography instrument (OCT, Carl Zeiss Meditec, Dublin, CA) was used to measure retinal nerve fiber layer (RNFL) thicknesses. Unrelated control subjects were recruited from participants who attended the eye clinic for conditions such as senile cataract, floaters, and mild refractive errors. They underwent complete ophthalmic examinations to confirm that they had a historical IOP b 22 mm Hg, they had no first-degree relative with glaucoma and they were free from glaucoma and other major eye diseases.

2.3. DNA extraction All genomic DNA was extracted from peripheral blood using a blood DNA extraction kit (QIAamp DNA Blood Midi Kit; Qiagen, Germany) according to the manufacturer's protocol. DNA samples were stored at − 20 °C until used. DNA integrity was evaluated by 1% agarose gel electrophoresis.

2.4. Mutation screening The coding sequences of MYOC (NM_000261.1) was amplified by polymerase chain reaction (PCR) using a MyCycler thermocycler (BioRad, Hercules, CA). Sequencing primers from flanking sequence of each exon were designed by using the Primer 5.0 (Table 2). Amplification reaction was performed by the PCR reaction (10 μL final volume) containing 50 ng of genomic DNA, 1 μL of each primer (10 pmol/μL), 1 μL of 10 buffer (Takara Bio Inc., Shiga, Japan), 0.8 μL of deoxyribonucleotide triphosphates (2 mmol/L; Takara Bio Inc.), 0.4 μL MgCl2 (2.5 mmol/L; Takara Bio Inc.), and 0.1 μL of ExTaq polymerase (5 U/μL; Takara Bio Inc.). Amplified PCR products were purified with spin columns (QIAquick, Qiagen, Valencia, CA) and sequenced directly (BigDye Terminators Sequencing Kit; Applied Biosystems) in both directions with an automated genetic analysis system (3130; ABI). Multiple sequence alignment of the human MYOC protein was performed along with other MYOC protein across different species, to check for the conservation of the residues. The sorting tolerant from intolerant (SIFT) homology tool (http://blocks.fhcrc.org/sift/SIFT.html) provided in the public domain by the Fred Hutchinson Cancer Research Centre was used to assess the effect of the substituted amino acid on the MYOC protein.

Fig. 1. Pedigree of the family with POAG. Solid symbols indicate affected individuals. Open symbols indicate unaffected individuals and arrow indicates the proband.

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042

Y. Yang et al. / Gene xxx (2015) xxx–xxx

3

Fig. 2. Representative photographs of the proband (II:1) in the family with POAG. (A) Fundus photographs showing a glaucomatous optic disc damage with enlarged cup/disc ratio in both eyes. (B) OCT examination showing thickness loss of superior, inferior, nasal and temporal RNFL.

3. Results 3.1. Clinical findings A family including the parents, the son and the daughter from Sichuan Province of China was recruited in this study (Fig. 1). Other relatives of the parents expressed no interest in being tested and no clinical details were available. Ophthalmic examinations identified two affected individuals (II:1 and I:2) among the four family members. The affected members with POAG exhibited similar clinical features. The proband, their son (II:1) in this family, was firstly diagnosed as early-onset POAG in both eyes at the age of 34, presenting with an elevated IOP (31 mm Hg in the both eyes) and characteristic glaucomatous visual field defects (Table 1). The affected mother (I:2) described her reduced vision and was found to develop POAG ten years ago with pretreatment IOPs of 28/30 mm Hg (OD/OS). She had controlled IOPs of 21/16 mm Hg (OD/OS) after bilateral trabeculectomy. Fundus examination showed the proband had glaucomatous optic disc damage in both eyes with an enlarged cup disc ratio of 0.7/0.8 (OD/OS) (Fig. 2A). RNFL analysis for the proband with OCT indicated thickness loss of superior, inferior, nasal and temporal RNFL (Fig. 2B). 3.2. Mutation screening of MYOC in POAG Sequencing analysis of the MYOC gene revealed a novel heterozygous mutation c.761CbG (p.P254R), which located at nucleotide 761 in the coding sequence of exon 3 (Fig. 3A). This missense mutation was present in the two affected patients (I:2 and II:1) and was not found in the father and daughter (I:1 and II:2) of the family and in 384 ethnically matched normal controls. Comparative amino acid

sequence alignment of other MYOC protein across different species revealed that the novel mutation occurred at highly conserved positions (Fig. 3C). The novel mutation was predicted to be damaging by using the SIFT homology tool, which was usually applied to determine the potential of a substituted amino acid to be deleterious in a protein sequence. The substituted of amino acid was predicted to alter the hydrophobicity of MYOC protein, resulting in changing a hydrophobic Proline to a hydrophilic Arginine acid at position 254. 4. Discussion MYOC was the first identified POAG gene in 1997 (Stone et al., 1997) and there are more glaucoma-causing mutations found in this gene than any other identified glaucoma risk genes (Takamoto and Araie, 2014). According to previous studies, MYOC mutations were identified with a heterozygous genotype in both familial and sporadic POAG patients in different ethnic groups (Takamoto and Araie, 2014; Fingert et al., 1999; Yoon et al., 1999; Kubota et al., 2000; Hewitt et al., 2008; Faucher et al., 2002; Kennan et al., 1998; Zhao et al., 2010; Melki et al., 2004; Hulsman et al., 2002). The present study identified a novel heterozygous missense mutation, c.761CbG (p.P254R), in a Chinese family with POAG and this result expands the spectrum of MYOC mutations resulting in POAG. The MYOC gene, located in chromosome 1, encodes the myocilin protein with 504 amino acids (Foster et al., 2000). Myocilin is not only expressed within the trabecular meshwork of eyes, but also in the ciliary body, retina, cornea, sclera, iris, and optic-nerve head (Ortego et al., 1997; Hardy et al., 2005). This protein has been implicated in causing blocking of aqueous outflow through the trabecular meshwork, leading to increased IOP and optic nerve damage (Tan et al., 2006). It has been

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042

4

Y. Yang et al. / Gene xxx (2015) xxx–xxx

Fig. 3. Representative chromatogram of MYOC sequence. (A) The MYOC gene (red filled box) spanning 17.22 kb on chromosome 1q23-24 (upper panel), the identified heterozygous variant, c.761TbA (p.P254R), was located in exon 3 of this gene. (B) Normal sequence from an unaffected member (I:1), a heterozygous C to G substitution at codon 254 from unaffected member (II:2, I:1). (C) Orthologous protein sequence alignment of MYOC from different species, the mutated residue showing conservation of Proline (P) at codon 254 was shaded in red. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

shown that mutant myocilin formed insoluble aggregates in human trabecular meshwork (HTM) cells and damaged the function of HTM cells, resulting in an increase of aqueous humor outflow resistance (Jacobson et al., 2001; Kanagavalli et al., 2007; Jia et al., 2009). Mutant myocilin has also been reported to accumulate in endoplasmic reticulum (ER) and lead to ER stress and potential cytotoxicity in HTM cells (Joe et al., 2003). In this study, we reported a novel c.761CbG (p.P254R), heterozygous mutation of the MYOC gene in a Chinese family with POAG. This mutation has not been reported in other ethnic groups and is the 24th MYOC mutation identified in Chinese patients with POAG (Table 3). MYOC mutations present variable clinical manifestations and have established a phenotype/genotype correlation in previous studies

(Hewitt et al., 2008; Gong et al., 2004). In this pedigree, both the two POAG patients (I:2 and II:1) were found to harbor the mutation in MYOC. The son (II:1) was diagnosed as POAG at the age of 34 years old. He presented with elevated IOP at 31 mm Hg in both eyes and the damage of his optic nerve and visual field was severe. Therefore, he may suffer from this disease for a long time before the ophthalmologic examination and he should be defined as early-onset POAG. The mother was diagnosed as POAG ten years ago (at her age of 46) when she came to see glaucoma specialist. At that time, she was found to have increased IOPs at 28/30 mm Hg (OD/OS) and characteristic glaucomatous visual field loss in both eyes. In addition, gene analysis of the father (I:1), the daughter (II:2) in this family and 384 normal controls did not detect

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042

Y. Yang et al. / Gene xxx (2015) xxx–xxx

5

Table 3 Missense MYOC mutations identified in Chinese patients with POAG. Mutation

Positiona

Exon

Nucleotide change

Predictionb

Familial/sporadic

Reference

P13L Q19H A46X V53A R76K R82C R91X C245Y P254R T293K E300K S313F Q337X S341P T353I G367R P370L D378G D384G D384N N450Y T455K Y471C L486F

171621714 171621695 171621616 171621594 171621525 171621508 171621481 171605846 171605819 171605702 171605682 171605642 171605571 171605559 171605522 171605481 171605471 171605447 171605429 171605430 171605232 171605216 171605168 171605124

1 1 1 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3

c.38CNT c.57GNT c.136CNT c.158TNC c.227GNA c.244CNT c.271CNT c.734GNA c.761CbG c.878CNA c.898GNA c.938CNT c.1009C del c.1021TNC c.1058CNT c.1099GNA, c.1109CNT c.1133ANG c.1151ANG c.1150GNA c.1348ANT c.1364CNA c.1412ANG c.1456CNT

Damaging Tolerated N/A Damaging Damaging Damaging N/A Damaging Damaging Damaging Damaging Damaging N/A Damaging Damaging Damaging Damaging Damaging Damaging Damaging Tolerated Damaging Damaging Damaging

Familial Sporadic Sporadic Sporadic Familial Sporadic Sporadic Familial Familial Sporadic Sporadic Sporadic Familial Sporadic Sporadic Familial Sporadic Sporadic Familial Familial Familial Familial Sporadic Sporadic

Xie et al. (2008) Fan et al. (2005) Yen et al. (2007) Huang et al. (2014) Xie et al. (2008) Huang et al. (2014) Fan et al. (2005), Huang et al. (2014), Pang et al. (2002) Fan et al. (2005, 2006) Present study Huang et al. (2014) Fan et al. (2005), Pang et al. (2002) Fan et al. (2005) Xie et al. (2008) Huang et al. (2014), Qin and Li (2007) Fan et al. (2005), Pang et al. (2002), Zhou et al. (2013) Chen et al. (2011) Huang et al. (2014), Chen et al. (2006), Zhuo et al. (2008) Huang et al. (2014) Cai et al. (2012) Jia et al. (2009), Zhou et al. (2013) Zhao et al. (2010) Tian et al. (2007) Fan et al. (2005), Pang et al. (2002) Huang et al. (2014)

a b

Genomic positions are according to NCBI build 36. The SIFT score predicts phenotypic effect.

this mutation in MYOC, suggesting that the novel mutation p.P254R of MYOC is likely responsible for the pathogenesis of POAG in this pedigree. For the p.P254R mutation identified in this pedigree, Proline was replaced by Arginine, which has a large positively charged basic side chain, therefore, the p.P254R mutation may change the local charge density of this protein. In addition, it is predicted probably to be damaging to protein function by SIFT. Moreover, through the analysis of topology by TMHMM2.0, the mutation may result in a change in protein secondary structure from a β strand to an α helix between residues 245 and 264. However, the exact mechanisms of function of MYOC and the physiological and pathological roles of myocilin in POAG are largely unknown. In order to better understand POAG pathogenesis, functional study is needed to confirm the role of MYOC and the underlying mechanisms in the disease. In conclusion, a novel homozygous mutation c.761CbG (p.P254R) in the MYOC gene was found in a Han Chinese family with POAG. This study expands the mutation spectrum of MYOC resulting in POAG, which is very helpful for pre-symptomatic molecular diagnosis for the members in this family. Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. Acknowledgment This study was supported by grants from the National Natural Science Foundation of China (81371048 (B.G.), 81400401 (Y.Y.), 81170882 (Y.S.) and 81430008 (Z.Y.)) and the Department of Science and Technology of Sichuan Province, China (2015HH0031 (B.G.) and 2014JZ0004 (Y.S.)). We thank all the participants in this study. References Bron, A., Chaine, G., Villain, M., Colin, J., Nordmann, J.P., Renard, J.P., Rouland, J.F., 2008. Risk factors for primary open-angle glaucoma. J. Fr. Ophtalmol. 31 (4), 435–444. Cai, S.P., Muhemaiti, P., Yin, Y., Cheng, H., Di Ya, A., Keyimu, M., Cao, X., Fan, N., Jiang, L., Yan, N., Zhou, X., Wang, Y., Liu, X., 2012. A novel MYOC heterozygous mutation

identified in a Chinese Uygur pedigree with primary open-angle glaucoma. Mol. Vis. 18, 1944–1951. Chen, Y., Jiang, D., Wan, B., Yu, L., Sun, X., 2006. Presymptomatic genetic diagnosis for consulters from a large Chinese family with juvenile open angle glaucoma. Mol. Vis. 12, 360–366. Chen, J., Cai, S.P., Yu, W., Yan, N., Tang, L., Chen, X., Liu, X., 2011. Sequence analysis of MYOC and CYP1B1 in a Chinese pedigree of primary open-angle glaucoma. Mol. Vis. 17, 1431–1435. Fan, B.J., Wang, D.Y., Fan, D.S., Tam, P.O., Lam, D.S., Tham, C.C., Lam, C.Y., Lau, T.C., Pang, C.P., 2005. SNPs and interaction analyses of myocilin, optineurin, and apolipoprotein E in primary open angle glaucoma patients. Mol. Vis. 11, 625–631. Fan, B.J., Leung, D.Y., Wang, D.Y., Gobeil, S., Raymond, V., Tam, P.O., Lam, D.S., Pang, C.P., 2006. Novel myocilin mutation in a Chinese family with juvenile-onset open-angle glaucoma. Arch. Ophthalmol. 124 (1), 102–106. Faucher, M., Anctil, J.L., Rodrigue, M.A., Duchesne, A., Bergeron, D., Blondeau, P., Cote, G., Dubois, S., Bergeron, J., Arseneault, R., Morissette, J., Raymond, V., 2002. Founder TIGR/myocilin mutations for glaucoma in the Quebec population. Hum. Mol. Genet. 11 (18), 2077–2090. Fingert, J.H., 2011. Primary open-angle glaucoma genes. Eye (Lond.) 25 (5), 587–595. Fingert, J.H., Heon, E., Liebmann, J.M., Yamamoto, T., Craig, J.E., Rait, J., Kawase, K., Hoh, S.T., Buys, Y.M., Dickinson, J., Hockey, R.R., Williams-Lyn, D., Trope, G., Kitazawa, Y., Ritch, R., Mackey, D.A., Alward, W.L., Sheffield, V.C., Stone, E.M., 1999. Analysis of myocilin mutations in 1703 glaucoma patients from five different populations. Hum. Mol. Genet. 8 (5), 899–905. Foster, P.J., Oen, F.T., Machin, D., Ng, T.P., Devereux, J.G., Johnson, G.J., Khaw, P.T., Seah, S.K., 2000. The prevalence of glaucoma in Chinese residents of Singapore: a cross-sectional population survey of the Tanjong Pagar district. Arch. Ophthalmol. 118 (8), 1105–1111. Gong, G., Kosoko-Lasaki, O., Haynatzki, G.R., Wilson, M.R., 2004. Genetic dissection of myocilin glaucoma. Hum. Mol. Genet. 13 (Spec No 1), R91–R102. Gong, G., Kosoko-Lasaki, S., Haynatzki, G., Lynch, H.T., Lynch, J.A., Wilson, M.R., 2007. Inherited, familial and sporadic primary open-angle glaucoma. J. Natl. Med. Assoc. 99 (5), 559–563. Gong, B., Qu, C., Li, X., Shi, Y., Lin, Y., Zhou, Y., Shuai, P., Yang, Y., Liu, X., Zhang, D., Yang, Z., 2015. Mutation spectrum of CYP1B1 in Chinese patients with primary open-angle glaucoma. Br. J. Ophthalmol. 99, 425–430. Green, C.M., Kearns, L.S., Wu, J., Barbour, J.M., Wilkinson, R.M., Ring, M.A., Craig, J.E., Wong, T.L., Hewitt, A.W., Mackey, D.A., 2007. How significant is a family history of glaucoma? Experience from the Glaucoma Inheritance Study in Tasmania. Clin. Exp. Ophthalmol. 35 (9), 793–799. Hardy, K.M., Hoffman, E.A., Gonzalez, P., McKay, B.S., Stamer, W.D., 2005. Extracellular trafficking of myocilin in human trabecular meshwork cells. J. Biol. Chem. 280 (32), 28917–28926. Hewitt, A.W., Mackey, D.A., Craig, J.E., 2008. Myocilin allele-specific glaucoma phenotype database. Hum. Mutat. 29 (2), 207–211. Huang, X., Li, M., Guo, X., Li, S., Xiao, X., Jia, X., Liu, X., Zhang, Q., 2014. Mutation analysis of seven known glaucoma-associated genes in Chinese patients with glaucoma. Invest. Ophthalmol. Vis. Sci. 55 (6), 3594–3602. Hulsman, C.A., De Jong, P.T., Lettink, M., Van Duijn, C.M., Hofman, A., Bergen, A.A., 2002. Myocilin mutations in a population-based sample of cases with open-angle glaucoma: the Rotterdam Study. Graefes Arch. Clin. Exp. Ophthalmol. 240 (6), 468–474.

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042

6

Y. Yang et al. / Gene xxx (2015) xxx–xxx

Jacobson, N., Andrews, M., Shepard, A.R., Nishimura, D., Searby, C., Fingert, J.H., Hageman, G., Mullins, R., Davidson, B.L., Kwon, Y.H., Alward, W.L., Stone, E.M., Clark, A.F., Sheffield, V.C., 2001. Non-secretion of mutant proteins of the glaucoma gene myocilin in cultured trabecular meshwork cells and in aqueous humor. Hum. Mol. Genet. 10 (2), 117–125. Jia, L.Y., Gong, B., Pang, C.P., Huang, Y., Lam, D.S., Wang, N., Yam, G.H., 2009. Correction of the disease phenotype of myocilin-causing glaucoma by a natural osmolyte. Invest. Ophthalmol. Vis. Sci. 50 (8), 3743–3749. Joe, M.K., Sohn, S., Hur, W., Moon, Y., Choi, Y.R., Kee, C., 2003. Accumulation of mutant myocilins in ER leads to ER stress and potential cytotoxicity in human trabecular meshwork cells. Biochem. Biophys. Res. Commun. 312 (3), 592–600. Kanagavalli, J., Pandaranayaka, P.J., Krishnadas, S.R., Krishnaswamy, S., Sundaresan, P., 2007. In vitro and in vivo study on the secretion of the Gly367Arg mutant myocilin protein. Mol. Vis. 13, 1161–1168. Kennan, A.M., Mansergh, F.C., Fingert, J.H., Clark, T., Ayuso, C., Kenna, P.F., Humphries, P., Farrar, G.J., 1998. A novel Asp380Ala mutation in the GLC1A/myocilin gene in a family with juvenile onset primary open angle glaucoma. J. Med. Genet. 35 (11), 957–960. Kubota, R., Mashima, Y., Ohtake, Y., Tanino, T., Kimura, T., Hotta, Y., Kanai, A., Tokuoka, S., Azuma, I., Tanihara, H., Inatani, M., Inoue, Y., Kudoh, J., Oguchi, Y., Shimizu, N., 2000. Novel mutations in the myocilin gene in Japanese glaucoma patients. Hum. Mutat. 16 (3), 270. Kwon, Y.H., Fingert, J.H., Kuehn, M.H., Alward, W.L., 2009. Primary open-angle glaucoma. N. Engl. J. Med. 360 (11), 1113–1124. Melki, R., Colomb, E., Lefort, N., Brezin, A.P., Garchon, H.J., 2004. CYP1B1 mutations in French patients with early-onset primary open-angle glaucoma. J. Med. Genet. 41 (9), 647–651. Monemi, S., Spaeth, G., DaSilva, A., Popinchalk, S., Ilitchev, E., Liebmann, J., Ritch, R., Heon, E., Crick, R.P., Child, A., Sarfarazi, M., 2005. Identification of a novel adult-onset primary open-angle glaucoma (POAG) gene on 5q22.1. Hum. Mol. Genet. 14 (6), 725–733. Morissette, J., Cote, G., Anctil, J.L., Plante, M., Amyot, M., Heon, E., Trope, G.E., Weissenbach, J., Raymond, V., 1995. A common gene for juvenile and adult-onset primary openangle glaucomas confined on chromosome 1q. Am. J. Hum. Genet. 56 (6), 1431–1442. Ortego, J., Escribano, J., Coca-Prados, M., 1997. Cloning and characterization of subtracted cDNAs from a human ciliary body library encoding TIGR, a protein involved in juvenile open angle glaucoma with homology to myosin and olfactomedin. FEBS Lett. 413 (2), 349–353. Pang, C.P., Leung, Y.F., Fan, B., Baum, L., Tong, W.C., Lee, W.S., Chua, J.K., Fan, D.S., Liu, Y., Lam, D.S., 2002. TIGR/MYOC gene sequence alterations in individuals with and without primary open-angle glaucoma. Invest. Ophthalmol. Vis. Sci. 43 (10), 3231–3235. Pasutto, F., Keller, K.E., Weisschuh, N., Sticht, H., Samples, J.R., Yang, Y.F., Zenkel, M., Schlotzer-Schrehardt, U., Mardin, C.Y., Frezzotti, P., Edmunds, B., Kramer, P.L., Gramer, E., Reis, A., Acott, T.S., Wirtz, M.K., 2012. Variants in ASB10 are associated with open-angle glaucoma. Hum. Mol. Genet. 21 (6), 1336–1349. Qin, L., Li, J., 2007. Investigation on the mutation of MYOC gene in two family pedigrees with primary open-angle glaucoma in Shanxi. Yan Ke Xue Bao 23 (2), 75–78.

Quigley, H.A., Broman, A.T., 2006. The number of people with glaucoma worldwide in 2010 and 2020. Br. J. Ophthalmol. 90 (3), 262–267. Rezaie, T., Child, A., Hitchings, R., Brice, G., Miller, L., Coca-Prados, M., Heon, E., Krupin, T., Ritch, R., Kreutzer, D., Crick, R.P., Sarfarazi, M., 2002. Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science 295 (5557), 1077–1079. Sharts-Hopko, N.C., Glynn-Milley, C., 2009. Primary open-angle glaucoma. Am. J. Nurs. 109 (2), 40–47 (quiz 8). Sheffield, V.C., Stone, E.M., Alward, W.L., Drack, A.V., Johnson, A.T., Streb, L.M., Nichols, B.E., 1993. Genetic linkage of familial open angle glaucoma to chromosome 1q21-q31. Nat. Genet. 4 (1), 47–50. Stone, E.M., Fingert, J.H., Alward, W.L., Nguyen, T.D., Polansky, J.R., Sunden, S.L., Nishimura, D., Clark, A.F., Nystuen, A., Nichols, B.E., Mackey, D.A., Ritch, R., Kalenak, J.W., Craven, E.R., Sheffield, V.C., 1997. Identification of a gene that causes primary open angle glaucoma. Science 275 (5300), 668–670. Takamoto, M., Araie, M., 2014. Genetics of primary open angle glaucoma. Jpn. J. Ophthalmol. 58 (1), 1–15. Tan, J.C., Peters, D.M., Kaufman, P.L., 2006. Recent developments in understanding the pathophysiology of elevated intraocular pressure. Curr. Opin. Ophthalmol. 17 (2), 168–174. Tian, Q., Li, F.H., Zhao, K.X., Wang, L., Shan, X.Y., Pang, Y.Y., Li, Y.X., Wu, M.J., Qiu, F., Li, H.Y., 2007. A novel mutation in the myocilin gene identified in a Chinese primary open angle glaucoma family. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 24 (6), 629–634. Xie, X., Zhou, X., Qu, X., Wen, J., Tian, Y., Zheng, F., 2008. Two novel myocilin mutations in a Chinese family with primary open-angle glaucoma. Mol. Vis. 14, 1666–1672. Yen, Y.C., Yang, J.J., Chou, M.C., Li, S.Y., 2007. Identification of mutations in the myocilin (MYOC) gene in Taiwanese patients with juvenile-onset open-angle glaucoma. Mol. Vis. 13, 1627–1634. Yoon, S.J., Kim, H.S., Moon, J.I., Lim, J.M., Joo, C.K., 1999. Mutations of the TIGR/MYOC gene in primary open-angle glaucoma in Korea. Am. J. Hum. Genet. 64 (6), 1775–1778. Zhao, X., Yang, C., Tong, Y., Zhang, X., Xu, L., Li, Y., 2010. Identification a novel MYOC gene mutation in a Chinese family with juvenile-onset open angle glaucoma. Mol. Vis. 16, 1728–1735. Zhou, X.M., Yin, Y., Fan, N., Cheng, H.B., Li, X.H., Wang, Y., Yu, W.H., Cai, S.P., Liu, X.Y., 2013. Single nucleotide polymorphism of MYOC affected the severity of primary open angle glaucoma. Int. J. Ophthalmol. 6 (3), 264–268. Zhuo, Y.H., Wei, Y.T., Bai, Y.J., Duan, S., Lin, M.K., Saragovi, H.U., Ge, J., 2008. Pro370Leu MYOC gene mutation in a large Chinese family with juvenile-onset open angle glaucoma: correlation between genotype and phenotype. Mol. Vis. 14, 1533–1539.

Please cite this article as: Yang, Y., et al., Identification of a novel MYOC mutation in a Chinese family with primary open-angle glaucoma, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.042