Identification of mutations in the lipoprotein lipase (LPL) and apolipoprotein C-II (APOC2) genes using denaturing high performance liquid chromatography (DHPLC)

Identification of mutations in the lipoprotein lipase (LPL) and apolipoprotein C-II (APOC2) genes using denaturing high performance liquid chromatography (DHPLC)

Clinica Chimica Acta 412 (2011) 240–244 Contents lists available at ScienceDirect Clinica Chimica Acta j o u r n a l h o m e p a g e : w w w. e l s ...

331KB Sizes 0 Downloads 2 Views

Clinica Chimica Acta 412 (2011) 240–244

Contents lists available at ScienceDirect

Clinica Chimica Acta j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c l i n c h i m

Identification of mutations in the lipoprotein lipase (LPL) and apolipoprotein C-II (APOC2) genes using denaturing high performance liquid chromatography (DHPLC) Kathrin B. Schuster a, Wolfgang Wilfert a, David Evans b, Joachim Thiery a, Daniel Teupser a,⁎ a b

Institute of Laboratory Medicine, Clinical Chemistry and Molecular Diagnostics, University Hospital Leipzig, Liebigstr. 27, 04103 Leipzig, Germany Endokrinologie und Stoffwechsel, Medizinische Klinik III, Zentrum für Innere Medizin, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany

a r t i c l e

i n f o

Article history: Received 5 August 2010 Received in revised form 22 September 2010 Accepted 5 October 2010 Available online 16 October 2010 Keywords: DHPLC LPL APOC2 PCR-based amplification Mutational detection Chromatography

a b s t r a c t Background: Endothelial lipoprotein lipase (LPL) hydrolyzes triglycerides of chylomicrons and very low density lipoproteins, releasing free fatty acids for local and systemic use. Mutations in the LPL gene or its cofactor APOC2 may result in a decrease or complete loss of enzyme function and subsequently to type I hyperlipoproteinemia. Methods: We used PCR to amplify all exons and the promoter region of LPL and APOC2. Nine blinded DNA samples with known LPL mutations were used as positive controls. In addition, nine patients from our lipid clinic and twelve healthy subjects were analyzed. DNA was screened for sequence variants by denaturing HPLC (DHPLC) followed by direct sequencing of PCR fragments showing distinct elution profiles. Results: All LPL sequence variants in the positive controls (D9N, V69L, delAACTG386, I225T, N291S, and S447X) were correctly identified. In the remaining patients, additional variants were detected in LPL and APOC2. These variants were also present in healthy subjects, indicating that they constituted silent variation with no relevant effect on plasma triglycerides, at least in the heterozygous state. Conclusions: A semi-automated DHPLC screening method was developed for the detection of sequence variants in the LPL and APOC2 genes. Our results demonstrate that the method was robust and sensitive. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Lipoprotein lipase (LPL) is a key enzyme in human lipid homeostasis and energy metabolism [1]. Enzymatically active dimers of LPL bound to the capillary endothelium of adipose tissue and striated muscle hydrolyze triglycerides of chylomicrones and very low density lipoproteins, releasing free fatty acids for local and systemic use [2]. The LPL gene is located on chromosome 8p22, spans 30 kb and is divided into 10 exons [3]. The cDNA codes for a 475 amino acid protein, including a 27 amino acid signal peptide. More than 100 naturally occurring mutations in the LPL gene have been described [4,5]. Apolipoprotein C2 (APOC2), a 79 amino acid protein acts as a physiological activator of LPL [6]. APOC2 is primarily synthesized in the liver [7]. The human APOC2 gene, located on chromosome 19q13, is 3.4 kb in length and consists of 4 exons [8]. Several mutations in the APOC2 gene are known to date. They are located in the promoter region, the coding exons or in splice junction sites [9–12]. Homozygosity or compound heterozygosity for mutations in the LPL or APOC2 genes may result in a decrease or complete loss of enzyme function (prevalence of LPL deficiency is 1 in 106, ApoC2

⁎ Corresponding author. Tel.: +49 341 9722204; fax: +49 341 9722209. E-mail address: [email protected] (D. Teupser). 0009-8981/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.cca.2010.10.006

deficiency is much rarer [13]). This may lead to the accumulation of chylomicrons, a phenotype known as type I hyperlipoproteinemia. Patients with this disorder are often affected by hemorrhagic pancreatitis [14]. It should be pointed out that it is a matter of ongoing dispute whether LPL deficiency is related to an increased risk of coronary artery disease (CAD), since LPL-deficient patients with and without CAD have been reported [15]. In the past, mutational detection in the LPL and APOC2 gene was mostly carried out by direct sequencing [16,17]. Although direct DNA sequencing is considered a gold standard, it entails significant costs and labor. The aim of the current study was to provide a sensitive, fast and cost effective screening method of the promoter and all coding exons of LPL and APOC2. To this end, we developed a denaturing high performance liquid chromatography (DHPLC) method as a first line screen, followed by direct sequencing of the respective PCR products. 2. Materials and methods 2.1. DNA samples In total, 30 DNA samples were used to establish the DHPLC screening method of the LPL and the APOC2 genes. Blinded DNA samples from nine patients with known LPL variants (positive controls) were provided by the University Hospital Hamburg-

K.B. Schuster et al. / Clinica Chimica Acta 412 (2011) 240–244

Eppendorf, Germany [18]. Results were verified after DHPLC analysis. Nine hypertriglyceridemic patients were recruited through the lipid clinic of the University Hospital Leipzig (Supplemental Table 1). In addition, DNA from twelve healthy normolipidemic subjects was used as control (Supplemental Table 2) [19]. To identify homozygotes, DHPLC was also performed in all samples mixed with wildtype DNA (1:1). 2.2. PCR mutagenesis for generation of APOC2 variants Because no positive controls with APOC2 variants were available, a PCR mutagenesis was performed to construct the formerly described APOC2Hamburg mutation [12,20]. The fragment of the APOC2 gene (exons 2 and 3) with the G→C base exchange at position 103 within this fragment was generated by PCR mutagenesis using two complementary mismatch primers (5′-GGG ATT TGC TGA GTG TGG GCT-3′ and 5′-AGC CCA CAC TCA GCA AAT CCC-3′) and the forward and reverse primers used for PCR amplification. The presence of the nucleotide exchange in the resulting fragment was confirmed by DNA sequencing. Prior to DHPLC analysis samples were mixed with wildtype DNA (1:1) to allow the formation of heteroduplexes. 2.3. Primers and PCR amplification For purposes of PCR, the LPL gene was divided into eleven fragments and the APOC2 gene into three fragments, comprising the promoter region, the coding sequence and exon–intron boundaries to detect potential mutations at splice junction sites. The promoter region and exon 1 of the APOC2 gene were amplified in one fragment, using previously described primers [12]. The established primer sequences, sizes of fragments and respective annealing temperatures are listed in Table 1. The PCR reaction was performed in a final volume of 50 μl containing 5 μl of 10× PCR buffer, 5 μl of the dNTP mix (1250 μM), 1 μl of each primer (20 pmol/μl), 2.5 μl of DMSO, 0.5 μl of Taq Polymerase (5 U/μl) and 2.5 μl of DNA. Distilled H2O was added to a total volume

241

of 50 μl. Thermal cycling was performed in a GeneAmp PCR System 9700 (Applied Biosystems) with the following PCR conditions: Initial denaturation at 95 °C for 5 min, followed by 15 cycles with denaturation at 95 °C for 20 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s. To allow annealing of all primers in all 14 fragments in one cycling protocol, this was followed by 25 cycles with annealing at 58 °C and a final extension step at 72 °C for 10 min. Samples were stored at 4 °C until further analysis. Prior to DHPLC, 5 μl of the PCR products were run on a 2% agarose gel to ensure that only the specific product was amplified and that no contaminating bands were present (Fig. 1). 2.4. DHPLC analysis DHPLC analysis was performed with a Transgenomic Wave-MDSystem (Transgenomic Inc., Omaha, Nebraska, USA). The instrument contains a DNASep Cartridge column, packed with 2 μm non-porous alkylated poly(styrene-divinylbenzene) particles [21]. The mobile phase consisted of Buffer A: 0.1 mol/L triethylammoniumacetat (TEAA) in water (pH 7) (WAVE optimized Buffer A) and Buffer B: 25% acetonitrile in 0.1 mol/L TEAA in water (pH 7) (WAVE optimized Buffer B). Prior to the DHPLC-run, PCR products were denatured at 95 °C for 5 min, followed by a gradual reannealing from 95 °C to 40 °C over 37 min (temperature ramp of 1 °C/40 s) to produce heteroduplex formations. Next, 5 μl of the PCR products was loaded onto the preheated column. The temperature at which heteroduplex detection occurred was estimated by the Wavemaker software 4.1. and optimized manually, analyzing the specific melting profile for each PCR fragment. The established DHPLC temperatures for each fragment are listed in Table 1. For each PCR fragment, the empirical gradient conditions were achieved starting from different percentages of buffer A and increasing buffer B by 2%/min over 4.5 min. The flow-rate was set to 0.9 ml/min. The DNA molecules eluted from the column were detected by scanning with a UV detector at 260 nm. Data collected from the UV detector were displayed by the Navigator software.

Table 1 Primers, PCR characteristics and DHPLC analysis temperatures for LPL and APOC2. Gene

Amplicon

Primer,a 5′→3′

Annealing temperature [°C]

Size [bp]

DHPLC analysis temperature [°C]

LPL

Promoter

58.8

Exon 1

377

66.2

LPL

Exon 2

416

56.4 + 61.0

LPL

Exon 3

391

59.0 + 61.5

LPL

Exon 4

370

Sequencing (57 °C)

LPL

Exon 5

478

59.0

LPL

Exon 6

543

58.6

LPL

Exon 7

339

57.4 + 61.4

LPL

Exon 8

299

Sequencing (56.6 °C)

LPL

Exon 9

336

58.9 + 61.5

LPL

Exon 10

101

59.8

APOC2

330

61.5

APOC2

Promoter Exon 1 Exon 2, 3

462

62.2

APOC2

Exon 4

63.0 61.4 58.2 60.5 57.8 60.7 57.1 58.4 60.8 60.4 61.3 60.2 61.0 57.9 59.4 60.6 64.6 61.8 59.3 58.4 61.3 57.1 61.0 60.5 61.0 61.4 62.7 61.8

274

LPL

F:GGTAGAGTGGAACCCCTTAAGCTAA R:GCAGCTTTCCCTTGAGGAGG F:TGCCCTGCCATCCCCTTT R:CCACTCCGGGGACCGTTT F:AAACACTTCAGAAACAAAAATAGCATCA R:TGTCTTTATTCAAGTGTAAGGAGATCCA F:TTTCTATCTGTGCCAATGGGTTT R:GAAAAGGAAGAAAGAACAGCCG F:TTCTCTCTCTTACCTGTAACACAAAATTAAAAT R:AAGAACACCACACATGTGGGTATTTAA F:ATACCATGACTGTAGAATAGGAGCTAATAA R:GCCAAATGTGTATATGAAAACTACATACTTT F:CCTACAATCATAAATGCACAGGACTATAT R:GATCAATGCAACCCCCTATCA F:GCACTTCCGGTTTGAGTGCT R:GACTTGTTTTCTAGGCATCGCTC F:GGCAGGGAGAGCTGATCTCTATAAC R:AGCCCCTAGGTCCTGACATCA F:AACAATTACCCAGCATGATCATGTATTA R:TTGATCACATGAGTCAGGGCAA F:CGGGAATTGTAAAACACTCAGAAGATAATA R:AATTCACATGCCGTTCTTTGTTC F:TCCATTCCCAGTGGGCACC b R:TGTCCCCGCACCCTGAGT b F:CAGCCTGCCACATGACACC R:GCCAGACCCCATTTCTCCAG F:CCTCTAACCATCTGTGCTTTCTCC R:GCAGTGCCATCCATGAGAAGC

289

60.2

a b

F, forward; R, reverse. Based on Nauck et al. [12].

242

K.B. Schuster et al. / Clinica Chimica Acta 412 (2011) 240–244

Fig. 1. Separation of LPL and APOC2 PCR fragments on 2% agarose gel. 5 μl of PCR products was run to ensure that only the specific product was amplified and no additional bands were present.

Heterozygous profiles were identified by visual inspection of the chromatograms on the basis of the appearance of additional earlier eluting peaks.

promoter and exon 1 of APOC2, respectively. These SNPs were known to be in tight linkage disequilibrium with no effect on triglycerides. A list of all detected variants in patients and controls is provided in Supplemental Table 4.

2.5. Direct DNA sequencing 4. Discussion All PCR fragments showing abnormal chromatograms compared with controls were sequenced. Furthermore, some of the PCR fragments with normal formations in the chromatograms were sequenced as a control. Sequencing was performed using BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, USA) according to the manufacturer's recommendations on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, USA). 3. Results PCR conditions for amplification of LPL and APOC2 fragments were optimized to obtain clear bands without additional amplicons (Fig. 1). Mutational DHPLC screening of LPL and APOC2 was first performed in nine blinded positive controls with known LPL variants obtained from the University Hospital Hamburg-Eppendorf. Samples leading to distinct elution profiles were followed up by DNA sequencing. All variants known to be present in positive controls could be correctly identified. All identified variants were heterozygous. These were D9N (exon 2), V69L and a frameshift mutation (delAACTG386) (exon 3), I225T (exon 5), N291S (exon 6) and S447X (exon 9) (see Supplemental Table 3 for HGVS nomenclature). Variants in exons 3 and 5 (V69L, delAACTG386 and I225T) were not previously reported (Fig. 2). In addition, the positive control APOC2Hamburg [12,20], generated by PCR mutagenesis could be clearly distinguished by DHPLC (Fig. 2). Next, mutational analysis was performed in a set of hypertriglyceridemic patients and healthy subjects not previously tested for the presence of LPL and APOC2 mutations. In these subjects, additional heterozygous variants in LPL were detected at T-93G in the promoter, C→A in intron 3 (bp1327), A→G and G→A in intron 6 (bp34 and 108, respectively), rs269 and rs270 (intron 6) and rs316 (intron 8) (Fig. 2). All of the latter variants were also present in healthy subjects, indicating that they constituted silent variation with no relevant effect on plasma triglycerides, at least in the heterozygous state. We also detected two SNPs, rs2288912 and rs2288911, located in the

We established a novel method for mutational analysis of LPL and APOC2 genes using DHPLC. Our method covered the promoter region, all coding exons and exon–intron boundaries. We show that the method was robust and sensitive to identify known and novel variants in LPL and APOC2. DHPLC is a semi-automated technique for the detection of mismatches in DNA, and is increasingly used for screening of genetic variants in various genes prior to sequencing, e.g. the APOB or biotinidase gene [22,23]. The detection of sequence variants is based on DNA heteroduplex formation and separation of heteroduplex from homoduplex molecular species under partial denaturing conditions by means of ion-pair reverse phase HPLC. Amplicons with distinct elution profiles can then be sequenced in a following step [24]. In the present study, a total of 11 LPL and 3 APOC2 amplicons were analyzed in 30 DNA samples at different DHPLC analyzing temperatures (Table 1 and Fig. 2). Due to the melting profiles of the amplicons LPL exon 2, 3, 7 and 9, we established two different analyzing temperatures to allow the detection of sequence variants across the complete coding sequence. The amplicons LPL exon 4 and 8 required a second higher analysis temperature to denature all parts of the amplicon. However, analyzing these amplicons at higher temperatures led to extremely low peak signals and the chromatograms could not be interpreted. Therefore, we suggest direct sequencing of these amplicons. Some other studies used single strand confirmation polymorphism analysis (SSCP) for mutational detection in the LPL gene [25–27]. Comparative studies describe a SSCP sensitivity of 65%, while the sensitivity of DHPLC approaches 100% [28–30]. While there is no published data on the sensitivity of LPL mutational detection by SSCP, we show that our method was capable of correctly identifying all previously known mutations present in a set of blinded samples. All mutations in the nine positive controls were correctly detected by DHPLC and verified by sequencing. In total, we detected sequence variants in 10 of the 14 examined amplicons in our study. Because the analyzing conditions for all amplicons were designed in the same

K.B. Schuster et al. / Clinica Chimica Acta 412 (2011) 240–244

LPL promoter

LPL exon 1

LPL exon 2

58.8°C

66.2°C

56.4°C

Absorbance (mV)

4

10

4

LPL exon 3 61.5°C 5

WT

3 WT

5

V69L

2

T-93G

V69L

WT

1

D9N

WT 3

4 5 Time (min)

0

D9N

4

Time (min)

0

5

2

Time (min)

3

WT

intron 3, bp1327, C 0

A

4 5 Time (min)

LPL exon 9

0

4 5 Time (min)

intron 6, bp108, G 2

LPL exon 9

58.9°C 5

3

WT 5 rs316

WT

A

3 4 Time (min)

LPL exon 10 5

0

4 5 Time (min)

WT 0

2

3 4 Time (min)

61.5°C

5

3

4 Time (min)

60.2°C 2

WT

5

APOC2 exon 4

62.2°C

WT

WT

0

APOC2 promoter/exon 1 APOC2 exon 2,3 5

59.8°C

61.5°C 5

WT

WT

5

rs270

I225T 0

LPL exon 8 56.6°C

WT

5

5

2 Time (min)

LPL exon 7

G

rs269

1

delAACTG386

WT

10

5

0

10 61.4°C

WT intron 6, bp37, A

4 Time (min)

57.4°C

N291S 10

3

LPL exon 7

58.6°C

2

0

Time (min)

LPL exon 6

LPL exon 5 10 59.0°C

WT

1 delAACTG386

0

4

3

LPL exon 4 57.0°C Absorbance (mV)

WT

WT

WT

Absorbance (mV)

LPL exon 3 59.0°C

5

WT

2

0

LPL exon 2 61.0°C

5

3

243

WT

WT

WT WT

3

4 Time (min)

0

2 Time (min)

WT

APOC2-Hamburg

WT

S447X 0

WT

1

S447X rs2288912+ rs2288911 3

0

2

4 3 Time (min)

0

3

5 4 Time (min)

0

3

4 5 Time (min)

0

4

5 Time (min)

6

Fig. 2. Chromatograms of all LPL and APOC2 amplicons with typical wildtype (black) and mutated elution profiles (in color). For the amplicons LPL exon 2, 3, 7 and 9 two different DHPLC analysis temperatures were used to allow mutational detection across the complete coding sequence. Note, that some SNPs, e.g. D9N in LPL exon 2 can only be detected at one temperature (56.4 °C). For detection of sequence variants in other regions of this amplicon the higher temperature (61.0 °C) is necessary. The melting profile of the amplicons LPL exon 4 and 8 requires a second DHPLC analysis temperature, but DHPLC analysis at higher temperatures than the established ones led to extremely low peak signals and the chromatograms could not be interpreted. Therefore direct sequencing is recommended for amplicons LPL exon 4 and 8. In 10 of the 14 amplicons sequence variants were detected.

manner, it should be possible to detect sequence variants in LPL and APOC2 in the other 4 amplicons as well. Another advantage of the present method is the reduction of cost and labor compared to sequencing. DHPLC is considered ten times less expensive than sequencing [31]. Preparation of the samples before DHPLC analysis is the same as for sequencing (DNA isolation, PCR, and agarose gel electrophoresis). The HPLC-run for one sample takes 8 min and all samples are loaded automatically with an autosampler. One main advantage of DHPLC is the reduction of time required for interpretation of elution profiles, which is much less laborious than interpreting DNA sequences. What might be the clinical significance of the described method in addition to its obvious value for research? We believe that the greatest value of a screening test for LPL and ApoC2 mutations lies in the ability to differentiate between primary and secondary forms of hypertriglyceridemia. In many cases, a diagnosis based on clinical evidence is impossible. In contrast, genetic screening allows the definite diagnosis of primary hypertriglyceridemia. This has consequences on the emphasis given to therapeutic options. Patients with genetic hypertriglyceridemia might be responsive to a diet with mediumchain trans-fatty acids and should receive lipid lowering medication

to avoid typical symptoms in particular pancreatitis. Patients with a secondary form of hypertriglyceridemia should be given more emphasis on education about the risk of several exogenous factors and enforce a lifestyle change. Furthermore the distinction between LPL and ApoC2 deficiency is important for the management of patients of chylomicronemia syndrome because acute pancreatitis developed in ApoC2 deficiency may be responsive to infusion of fresh plasma [13]. Genetic screening might also have an advantage for family members of the patient. Children can be detected and treated before clinical events occur. Furthermore, the communication and the compliance between patient, family members and physicians can be improved when the reason for a disease is known. In conclusion a semi-automated DHPLC screening method for the detection of sequence variants in the LPL and APOC2 genes was developed and shown to be robust and sensitive. Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10.1016/j.cca.2010.10.006.

244

K.B. Schuster et al. / Clinica Chimica Acta 412 (2011) 240–244

References [1] Otarod JK, Goldberg IJ. Lipoprotein lipase and its role in regulation of plasma lipoproteins and cardiac risk. Curr Atheroscler Rep 2004;6:335–42. [2] Williams KJ. Molecular processes that handle—and mishandle—dietary lipids. J Clin Invest 2008;118:3247–59. [3] Deeb SS, Peng RL. Structure of the human lipoprotein lipase gene. Biochemistry 1989;28:4131–5. [4] Merkel M, Eckel RH, Goldberg IJ. Lipoprotein lipase: genetics, lipid uptake, and regulation. J Lipid Res 2002;43:1997–2006. [5] Sagoo GS, Tatt I, Salanti G, et al. Seven lipoprotein lipase gene polymorphisms, lipid fractions, and coronary disease: a HuGE association review and metaanalysis. Am J Epidemiol 2008;168:1233–46. [6] Hospattankar AV, Fairwell T, Ronan R, Brewer Jr HB. Amino acid sequence of human plasma apolipoprotein C-II from normal and hyperlipoproteinemic subjects. J Biol Chem 1984;259:318–22. [7] Wu AL, Windmueller HG. Relative contributions by liver and intestine to individual plasma apolipoproteins in the rat. J Biol Chem 1979;254:7316–22. [8] Fojo SS, Law SW, Brewer Jr HB. The human preproapolipoprotein C-II gene. Complete nucleic acid sequence and genomic organization. FEBS Lett 1987;213:221–6. [9] Fojo SS, de Gennes JL, Chapman J, et al. An initiation codon mutation in the apoC-II gene (apoC-II Paris) of a patient with a deficiency of apolipoprotein C-II. J Biol Chem 1989;264:20839–42. [10] Fojo SS, Stalenhoef AF, Marr K, Gregg RE, Ross RS, Brewer Jr HB. A deletion mutation in the ApoC-II gene (ApoC-II Nijmegen) of a patient with a deficiency of apolipoprotein C-II. J Biol Chem 1988;263:17913–6. [11] Chen CH, Cao YL, Hu WC. Apolipoprotein C-II promoter T–NA substitution at position -190 affects on the transcription of the gene and its relationship to hyperlipemia. Biochem Biophys Res Commun 2007;354:62–5. [12] Nauck MS, Nissen H, Hoffmann MM, et al. Detection of mutations in the apolipoprotein CII gene by denaturing gradient gel electrophoresis. Identification of the splice site variant apolipoprotein CII-Hamburg in a patient with severe hypertriglyceridemia. Clin Chem 1998;44:1388–96. [13] Lam CW, Yuen YP, Cheng WF, Chan YW, Tong SF. Missense mutation Leu72Pro located on the carboxyl terminal amphipathic helix of apolipoprotein C-II causes familial chylomicronemia syndrome. Clin Chim Acta 2006;364:256–9. [14] Sugandhan S, Khandpur S, Sharma VK. Familial chylomicronemia syndrome. Pediatr Dermatol 2007;24:323–5. [15] Ebara T, Endo Y, Yoshiike S, et al. A 60-y-old chylomicronemia patient homozygous for missense mutation (G188E) in the lipoprotein lipase gene showed no accelerated atherosclerosis. Clin Chim Acta 2007;386:100–4. [16] Evans D, Wendt D, Ahle S, Guerra A, Beisiegel U. Compound heterozygosity for a new (S259G) and a previously described (G188E) mutation in lipoprotein lipase (LpL) as a cause of chylomicronemia. Mutations in brief no. 183. Online. Hum Mutat 1998;12:217.

[17] Wang J, Cao H, Ban MR, et al. Resequencing genomic DNA of patients with severe hypertriglyceridemia (MIM 144650). Arterioscler Thromb Vasc Biol 2007;27: 2450–5. [18] Evans D, Beil FU. The D9N, N291S and S447X variants in the lipoprotein lipase (LPL) gene are not associated with Type III hyperlipidemia. BMC Med Genet 2007;8:56. [19] Leichtle A, Teupser D, Thiery J. Alpha-tocopherol distribution in lipoproteins and anti-inflammatory effects differ between CHD-patients and healthy subjects. J Am Coll Nutr 2006;25:420–8. [20] Fojo SS, Beisiegel U, Beil U, et al. Donor splice site mutation in the apolipoprotein (Apo) C-II gene (Apo C-IIHamburg) of a patient with Apo C-II deficiency. J Clin Invest 1988;82:1489–94. [21] Huber CG, Oefner PJ, Preuss E, Bonn GK. High-resolution liquid chromatography of DNA fragments on non-porous poly(styrene-divinylbenzene) particles. Nucleic Acids Res 1993;21:1061–6. [22] Nelken J, Meshkani R, Chahal N, McCrindle B, Adeli K. Detection of familial defective apoB (FDB) mutations in hypercholesterolemic children and adolescents by denaturing high performance liquid chromatography (DHPLC). Clin Biochem 2008;41:395–9. [23] F. Iqbal, C.B. Item, M.A. Vilaseca, et al. The identification of novel mutations in the biotinidase gene using denaturing high pressure liquid chromatography (dHPLC). Mol Genet Metab; 2010; 100:42-45. [24] Oefner P, Underhill P. DNA mutation detection using denaturing high-performance liquid chromatography (DHPLC). Curr Protoc Hum Genet 1999(Suppl 19): 7.10.11–17.10.12. [25] Yang Y, Mu Y, Zhao Y, et al. Genetic screening of the lipoprotein lipase gene for mutations in Chinese subjects with or without hypertriglyceridemia. J Genet Genomics 2007;34:381–91. [26] Pasalic D, Jurcic Z, Stipancic G, et al. Missense mutation W86R in exon 3 of the lipoprotein lipase gene in a boy with chylomicronemia. Clin Chim Acta 2004;343: 179–84. [27] Razzaghi H, Aston CE, Hamman RF, Kamboh MI. Genetic screening of the lipoprotein lipase gene for mutations associated with high triglyceride/low HDLcholesterol levels. Hum Genet 2000;107:257–67. [28] Eng C, Brody LC, Wagner TM, et al. Interpreting epidemiological research: blinded comparison of methods used to estimate the prevalence of inherited mutations in BRCA1. J Med Genet 2001;38:824–33. [29] Bunn CF, Lintott CJ, Scott RS, George PM. Comparison of SSCP and DHPLC for the detection of LDLR mutations in a New Zealand cohort. Hum Mutat 2002;19:311. [30] Buyse IM, Fang P, Hoon KT, Amir RE, Zoghbi HY, Roa BB. Diagnostic testing for Rett syndrome by DHPLC and direct sequencing analysis of the MECP2 gene: identification of several novel mutations and polymorphisms. Am J Hum Genet 2000;67:1428–36. [31] Xiao W, Oefner PJ. Denaturing high-performance liquid chromatography: a review. Hum Mutat 2001;17:439–74.