Increased Expression of DUOX2 Is an Epithelial Response to Mucosal Dysbiosis Required for Immune Homeostasis in Mouse Intestine

Increased Expression of DUOX2 Is an Epithelial Response to Mucosal Dysbiosis Required for Immune Homeostasis in Mouse Intestine

Accepted Manuscript Increased Expression of DUOX2 is an Epithelial Response to Mucosal Dysbiosis Required for Immune Homeostasis in Mouse Intestine He...

8MB Sizes 0 Downloads 1 Views

Accepted Manuscript Increased Expression of DUOX2 is an Epithelial Response to Mucosal Dysbiosis Required for Immune Homeostasis in Mouse Intestine Helmut Grasberger, Jun Gao, Hiroko Nagao-Kitamoto, Sho Kitamoto, Min Zhang, Nobuhiko Kamada, Kathryn A. Eaton, Mohamad El-Zaatari, Andrew B. Shreiner, Juanita L. Merchant, Chung Owyang, John Y. Kao PII: DOI: Reference:

S0016-5085(15)01095-1 10.1053/j.gastro.2015.07.062 YGAST 59953

To appear in: Gastroenterology Accepted Date: 31 July 2015 Please cite this article as: Grasberger H, Gao J, Nagao-Kitamoto H, Kitamoto S, Zhang M, Kamada N, Eaton KA, El-Zaatari M, Shreiner AB, Merchant JL, Owyang C, Kao JY, Increased Expression of DUOX2 is an Epithelial Response to Mucosal Dysbiosis Required for Immune Homeostasis in Mouse Intestine, Gastroenterology (2015), doi: 10.1053/j.gastro.2015.07.062. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. All studies published in Gastroenterology are embargoed until 3PM ET of the day they are published as corrected proofs on-line. Studies cannot be publicized as accepted manuscripts or uncorrected proofs.

ACCEPTED MANUSCRIPT

Basic and Translational Alimentary Tract

Increased Expression of DUOX2 is an Epithelial Response to Mucosal Dysbiosis

Short Title:DUOX2 supports intestinal immune homeostasis

RI PT

Required for Immune Homeostasis in Mouse Intestine

Helmut Grasberger1*, Jun Gao1, Hiroko Nagao-Kitamoto1, Sho Kitamoto1, Min Zhang1, Nobuhiko Kamada1, Kathryn A. Eaton2, Mohamad El-Zaatari1, Andrew B. Shreiner1, Juanita L. Merchant1, Chung Owyang1, John Y. Kao1*

SC

Division of Gastroenterology1, Department of Internal Medicine, Unit for Laboratory Animal Medicine2, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA Grant Support: This study was supported by the National Institutes of Health grants

M AN U

RO1DK087708-01 (J.Y.K.) and RO1DK055732-15 (J.L.M.), a JSPS Postdoctoral Fellow for Research Abroad (S. K. and H. N.-K.), the Crohn’s and Colitis Foundation of America (N.K.) and the Michigan Gastrointestinal Peptide Research Center NIDDK 5P30DK034933 (H.G., N. K.). *

EP

TE D

Correspondence: Helmut Grasberger, M.D. and John Y. Kao, M.D. Division of Gastroenterology Department of Internal Medicine University of Michigan Health System 6520 MSRB I, SPC 5682 1150 West Medical Center Drive Ann Arbor, Michigan 48109 Telephone: (734) 647-2964 Fax: (734) 763-2535 E-mail: [email protected]; [email protected] Disclosures: The authors have nothing to disclose.

AC C

Accession number: NCBI GEO series GSE60933. Abbreviations: CD, Crohn's disease; cCD, colon-only Crohn's disease; GALT, gut-associated lymphatic tissue; GF, germ-free; GSEA, gene set enrichment analysis; IBD, inflammatory bowel disease; ILC, innate lymphoid cells; MLN, mesenteric lymph node; SFB, segmented filamentous bacterium; SPF, specific pathogen-free. Author contributions HG: designed study, acquired and analyzed data, prepared manuscript; JG, HNK, SK, MZ, KE, ABS: developed experimental tools; NK: supplied critical materials and reviewed manuscript; MEZ: performed microscopy; JLM and CO: contributed funding and reviewed manuscript. JYK: designed study, revised and edited manuscript, obtained funding.

1

ACCEPTED MANUSCRIPT

BACKGROUND & AIMS: Dual oxidase 2 (DUOX2), a hydrogen-peroxide generator at the apical membrane of gastrointestinal epithelia, is upregulated in patients with inflammatory bowel disease (IBD) before the onset of inflammation, but little is known about its effects. We

RI PT

investigated the role of DUOX2 in maintaining mucosal immune homeostasis in mice.

METHODS: We analyzed the regulation of DUOX2 in intestinal tissues of germ-free vs conventional mice, mice given antibiotics or colonized with only segmented filamentous bacteria, mice associated with human microbiota, and mice with deficiencies in interleukin (IL)23 and 22 signaling. We performed 16S rRNA gene quantitative PCR of intestinal mucosa and

SC

mesenteric lymph nodes of Duoxa-/- mice that lack functional DUOX enzymes. Genes differentially expressed in Duoxa-/- mice compared to co-housed wild type littermates were

M AN U

correlated with gene expression changes in early-stage IBD using gene set enrichment analysis.

RESULTS: Colonization of mice with segmented filamentous bacteria upregulated intestinal expression of DUOX2. DUOX2 regulated redox-signaling within mucosa-associated microbes and restricted bacterial access to lymphatic tissues of the mice, thereby reducing microbiotainduced immune responses. Induction of Duox2 transcription by microbial colonization did not

TE D

require the mucosal cytokines IL17 or IL22, although IL22 increased expression of Duox2. Dysbiotic, but not healthy human microbiota, activated a DUOX2 response in recipient germfree mice that corresponded to abnormal colonization of the mucosa with distinct populations of microbes. In Duoxa-/- mice, abnormalities in ileal mucosal gene expression at homeostasis

EP

recapitulated those in patients with mucosal dysbiosis.

CONCLUSIONS: DUOX2 regulates interactions between the intestinal microbiota and the

AC C

mucosa to maintain immune homeostasis in mice. Mucosal dysbiosis leads to increased expression of DUOX2, which might be a marker of perturbed mucosal homeostasis in patients with early-stage IBD.

KEYWORDS: intestine, gastroenterology, microbial dysbiosis, inflammatory bowel disease

2

ACCEPTED MANUSCRIPT

A single layer of epithelial cells constitutes a physical and immune barrier between the gutassociated lymphatic tissue (GALT) and >1013 commensal microbes in the intestinal lumen. The function of this barrier plays a central role in maintaining normal mucosal homeostasis and

adequate innate defense response against luminal microbes 1.

RI PT

protecting against potentially life-threatening pathogens by creating spatial separation and

Conceivably the most primordial form of innate defense response, present in all

SC

metazoans, is the release of reactive oxygen species (ROS) generated by membrane integral enzymes. In animals, prime candidates for such ROS-based defense system at barrier epithelia

M AN U

are the dual oxidases (DUOX), epithelial-specific NADPH oxidases that generate extracellular H2O2. Of the two DUOX isoenzymes, DUOX1 is highly expressed in bronchial epithelium and urothelium, whereas in the gut the expression is dominated by DUOX2

2,3

. Expression of a

DUOX2 homolog in the gut epithelium is evolutionary conserved. Indeed, studies in invertebrates indicate an important role of DUOX in innate host defense against luminal bacteria 4,5

TE D

. We recently provided evidence in mice that DUOX2-generated H2O2 restricts Helicobacter

felis colonization within the gastric mucus layer, providing a paradigm for the nonredundant function of DUOX in mammalian innate defense 6. A critical function of DUOX2 in the epithelial

EP

defense response against the abundant intestinal microbiota would be consistent with the robust upregulation of DUOX2 in conditions frequently associated with dysbiosis, even in the absence

AC C

of manifest inflammation. For instance, DUOX2 is markedly upregulated in the intestine of patients with irritable bowel syndrome 7, in the normal appearing proximal small intestine after ileal pouch-anal anastomosis 8, and in noninflamed ilea of patients with colon-only Crohn's disease (cCD) 9. However, whether DUOX2 induction is a consequence of microbial dysbiosis and plays a role in maintaining immune homeostasis is currently unclear. In the present study we provide evidence that an epithelial-attaching commensal, segmented filamentous bacterium (SFB), is sufficient to induce DUOX2. DUOX activity modulates redox-signaling in mucosa-associated microbes and restricts the access of bacteria

3

ACCEPTED MANUSCRIPT

to the GALT system, thereby dampening microbiota-induced mucosal immune responses. Dysbiotic microbiota from patients transplanted into germ-free recipient mice leads to differential mucosal colonization and Duox2 induction compared to microbiota from healthy donors. In

RI PT

addition, a loss of DUOX activity alone is sufficient to cause ileal gene expression abnormalities reminiscent of that associated with mucosal dysbiosis in cCD. These findings implicate DUOX2 as a critical modulator in mutualistic host-microbiota interactions that are fundamental in

AC C

EP

TE D

M AN U

SC

maintaining gut immune homeostasis.

4

ACCEPTED MANUSCRIPT

Materials and Methods Animals Duoxa-/- and gender-matched wild type (wt) littermates in 129S6 genetic background were

RI PT

cohoused (3-5 animals/cage) in microisolator cages under SPF conditions 6. Food and water were supplied ad libitum, with the latter including a supplemental dose of L-thyroxine to maintain euthyroidism of Duoxa-/- mice

. Il22-/-, Il23r-/-, and RORgt-/- mice (all in B6 background) have

11-13

. C57BL6 mice with distinct resident microbiota were purchased

SC

been described previously

10

from Taconic Farms and Jackson Laboratory, respectively. For all studies, mice were used at 9-

M AN U

12 weeks of age. Studies were approved by the University of Michigan Institutional Animal Care and Use Committee (PRO-00004497 and PRO-00002436).

Detailed methods for tissue collection, mono-association of mice with SFB, human-flora associated mouse model, enteric Salmonella Typhimurium infection, dextran sodium sulfate

TE D

challenge, intestinal permeability assay, microarray-based gene expression profiling, histology and morphometric analysis, 16S rRNA in situ hybridization and immunostaining, DNA and RNA extraction, realtime reverse transcription PCR (rt-qPCR), Western blotting and ileal enteroid

AC C

Statistics

EP

culture are available in the Supplementary materials and methods.

Log-transformed expression data from unpaired groups were analyzed using Welch's t-

test with multiple comparisons adjustment or with one-way ANOVA and Bonferroni post-hoc tests. The Wilcoxon matched-pairs signed-rank test was used to test for differences between genotype groups in mixed housing experiments. Each cage was analyzed as a pair of the means obtained in Duoxa-/- and cohoused wt littermates (n=2-3 mice per genotype and cage). Data were analyzed using GraphPad Prism 6.0 (San Diego, CA).

5

ACCEPTED MANUSCRIPT

Results Intestinal expression of DUOX2 in response to microbial colonization We initially analyzed longitudinal DUOX2 expression profiles in the gut of mice kept in

RI PT

our specific pathogen-free (SPF) or germfree (GF) environment. Both DUOX2 subunit genes (i.e., Duox2 and Duoxa2; Supplementary Figure S1A) were robustly induced by the microbiota as reported previously

14

, but expression did not directly correlate with luminal bacterial density

SC

as Duox2 mRNA induction peaked in the terminal ileum (Figures 1A and B). Compared to GF mice, DUOX2 protein expression was also robustly induced in the ilea of SPF mice (Figure 1C;

M AN U

Supplementary Figure S2). Expression of other epithelial NADPH oxidases was exceedingly low (Duox1, Figure 1D) or predominant in the colorectum (Nox1, Figure 1E). Duox2 expression was maintained in response to continuous stimulation by the microbiota, since levels of Duox2 and Duoxa2 mRNA were significantly diminished following a single dose of antibiotics by oral

TE D

gavage (Figure 1F).

Induction of DUOX2 by colonization with a mucosa-adherent commensal Because the murine ileum is typically colonized by SFB that, unusual for commensal

EP

bacteria, grow firmly attached to the intestinal epithelium in a symbiotic relationship, we hypothesized that SFB contributed to the ileum-dominant expression of DUOX2. We compared

AC C

mice maintained in either an SFBneg SPF environment (Jackson Laboratories; B6-Jax) with those housed in SFBpos SPF environment (Taconic Farms (B6-Tac)15 or our own SFBpos SPF animal facilities). Quantitative PCR of SFB-specific 16S rRNA confirmed that mucosaassociated SFB were essentially restricted to the ileum in SFBpos animals but absent in SFBneg B6-Jax mice (Figure 2A). SPF mice from these different environments had indistinguishable Duox2 expression profiles except that B6-Jax mice lacked the peak ileal expression (Figure 2A and B; Supplementary Figure S2). To corroborate that SFB was sufficient to trigger DUOX2 induction, GF mice were gavaged with cecal content from SFB-monocolonized (SFBmono) mice.

6

ACCEPTED MANUSCRIPT

After one week, a high level of mucosa-associated SFB was detected in both the ileum and colon (Figure 2C). SFB colonization was accompanied by robust induction of Duox2 mRNA (Figure 2C) and protein (Figure 2D and E; Supplementary Figure S2) confirming that mono-

RI PT

association with SFB was sufficient for Duox2 induction. Twenty-four hours following treatment with streptomycin, SFB-specific 16S rRNA in ileal mucosal samples (as surrogate for viable SFB) was reduced to less than 0.1% (Figure 2F), in agreement with the suppression of Duox2

SC

and Duoxa2 mRNA (Figure 1F). Overall, these results indicate that epithelial-attaching SFB

M AN U

strongly triggers DUOX2 expression.

Microbial induction of DUOX2 does not require a functional IL-22 pathway SFB is known to be a particular powerful inducer of mucosal innate lymphoid cells (ILC) to produce interleukin-22 (IL-22), which is a master regulator of epithelial defense responses

15

.

In fact, IL-22 was strongly stimulated in the ileum of SFBmono mice (Figure 3A; Supplementary

TE D

Figure S3A) and its expression was acutely abrogated in mice treated with enteral streptomycin (Figure 3B), reminiscent of the sharp decline in mucosal SFB colonization and Duox2 expression (Figures 1F and 2F). The anti-microbial lectin Reg3g, a known IL-22 target gene,

EP

was also strongly upregulated in the ileum of SFBmono mice (Figures 3A). To directly test whether IL-22 can activate Duox2 expression, ileal enteroids were

AC C

stimulated with recombinant IL-22. Both Duox2 and Duoxa2 were induced about 15-fold within 18 hours (Figure 3C) and DUOX protein became clearly detectable at the luminal surface of enteroids (Figure 3D). In contrast, the proinflammatory cytokine TNFα was unable to induce the Duox2 expression pathway in enteroids (Supplementary Figure S3B). To investigate whether IL22 is essential to maintain Duox2 expression in vivo, we examined whether disrupted IL-22signaling in mice abrogates Duox2 expression. As expected, IL22-/-, IL23R-/- and RORgt-/(deficient in both TH17 and ILC development) mice all lacked ileal IL22 expression compared to wt controls sharing the same environment (Figure 3E). Accordingly, the former were also 7

ACCEPTED MANUSCRIPT

deficient in expression of the IL-22 target genes Reg3g and Saa1. In stark contrast, Duox2 and Duoxa2 were both upregulated in mice lacking IL-22-mediated defense (Figure 3F), indicating that IL-22 is not essential for high ileal DUOX2 expression. Interestingly, induction of Duox2 in

RI PT

these IL-22 deficient models was associated with higher level of mucosa-adherent SFB (Figure 3F), further corroborating the concept that increased commensal-epithelial interaction can trigger Duox2 expression independently of IL-22. Exposure of ileal enteroids to sterile microbial

SC

extracts prepared from either SFBneg or SFBpos mice induced epithelial toll-like receptor downstream targets, but completely failed to induce Duox2 (Supplementary Figure S4),

response.

M AN U

suggesting that active bacteria, rather than soluble bacterial products, are critical for the Duox2

DUOX supports luminal containment of bacteria

To investigate further the role of the DUOX response, we utilized mice lacking functional 6

(Figure 4A; Supplementary Figure S1B). A ROS-inducible SFB

TE D

DUOX enzymes (Duoxa-/-)

catalase gene (SFB-kat) (Supplementary Figure S5) was measured as a marker of H2O2 exposure. We found that kat expression of mucosal, but not luminal, SFB was markedly higher

EP

in wt compared to Duoxa-/- mice (Figure 4B), confirming DUOX deficiency status of Duoxa-/mice and the ability of DUOX to modulate redox-sensitive pathways in mucosa-adherent SFB.

AC C

The expression of several other tested SFB genes was not under control of DUOX activity indicating specificity of the SFB-kat response (Supplementary Figure S6A). In contrast to SFBkat, expression of epithelial anti-oxidative enzymes was not significantly affected by DUOX status (Supplementary Figure S6B). Thus, DUOX activity does not lead to global changes in epithelial redox status, at least under homeostatic conditions. Duoxa-/- mice did not manifest signs of spontaneous intestinal inflammation (such as, body weight loss or cellular infiltration) (Supplementary Figure S7) and SFB colonization levels did not differ between Duoxa-/- mice and

8

ACCEPTED MANUSCRIPT

cohoused wt littermates nor did the level of mucosa-associated ileal microbiota surveyed using 16S qPCR assays specific for the major bacterial phyla (Supplementary Figure S8). Although considered a strict anaerobe unable to survive within host tissues, SFB or

endocytosis

17,18

16

, potentially involving epithelial

RI PT

remnants thereof are translocated across the epithelial barrier

. We therefore investigated whether induction of DUOX2 by commensal

bacteria regulates their transepithelial passage, an integral part of small intestinal immune

SC

surveillance. As proxy for transepithelial flux of bacterial DNA, we compared the relative concentration of bacterial DNA in mesenteric lymph nodes (MLN) and corresponding mucosal

M AN U

samples. MLN-to-mucosa ratios for γ−Proteobacteria and SFB were significantly elevated in Duoxa-/- mice compared to littermate controls sharing the same environment (Figure 4C; Supplementary Figure S9). Paracellular permeability to dextran (4 kDa) was not altered in Duoxa-/- mice (Figure 4D) excluding an unspecific defect in the intestinal epithelial barrier. The ability of DUOX2 to restrict translocation of indigenous bacteria appeared to be

pathogens,

such

as,

Campylobacter jejuni

21

TE D

congruent with in vitro studies, where DUOX2 conferred cell-autonomous protection against Salmonella

Typhimurium

19

,

Listeria

monocytogenes

20

,

and

. To assess whether DUOX interfered with pathogen translocation, mice

EP

were orally challenged with Salmonella Typhimurium, which preferentially targets the small intestinal epithelium

22

. Following pretreatment with streptomycin, acute infection induced ileal

AC C

Duoxa2 expression to a level observed in mice with an SFB-containing microbiota (Supplementary Figure S11A). Salmonella colonization was not different in Duoxa-/- mice and wt controls (Figure 4E). The epithelial chemokines Cxcl1 and Ccl20 are robustly induced by acute Salmonella infection in vitro and in vivo, a response attributed to stimulation of toll-like 5 receptors

23,24

. Both chemokines showed exacerbated induction in the ileum of infected Duoxa-/-

mice compared to infected controls, compatible with increased activation of basolateral receptors (Supplementary Figures S11B and C). That Duoxa-/- mice were less able to contain luminal Salmonella was further indicated by increased early systemic dissemination of the 9

ACCEPTED MANUSCRIPT

pathogen (Figure 4E; Supplementary Figure S12). Unspecific intestinal permeability in infected mice was indistinguishable between Duoxa-/- and wt mice (Figure 4D). Overall, these studies indicate that DUOX reduces early systemic dissemination of a bona fide epithelial-invasive

RI PT

pathogen providing further evidence as to its role in maintaining the innate epithelial barrier in the small intestine.

SC

Loss of DUOX2 augments SFB-induced changes in ileal gene expression

To further examine whether loss of DUOX activity perturbs immune homeostasis, we analyzed genome-wide expression profiles in the ileal mucosa of Duoxa-/- and cohoused wt

M AN U

littermates (Figure 5A). We identified genes with consistent induction in Duoxa-/- mice (Figure 5B). Functional pathway analysis revealed an enrichment of annotations related to innate defense and inflammatory responses (Supplementary Figure S13). Since DUOX2 was strongly induced by SFB (Figure 2C) and restricted their mucosal passage (Figure 4C), we hypothesized

TE D

that loss of DUOX activity would exaggerate the effects of SFB on host gene expression. We used gene set enrichment analysis (GSEA) to test whether SFB-regulated genes

15

show

concordant expression differences between Duoxa-/- and wt littermate controls. Genes strongly

EP

upregulated (or downregulated) by monocolonization of GF mice with SFB (or by cohousing of B6-Jax with B6-Tac animals, respectively) were significantly enriched (P<.001; 1000

AC C

permutations) among the genes upregulated (or downregulated) in Duoxa-/- (Figures 5D and 5E). There was also a trend towards higher expression of IL-17/22 cytokines in Duoxa-/- mice (Supplementary Figure S14). Results of these studies imply that SFB not only induces DUOX2 expression, but that normal DUOX activity may dampen other SFB-induced innate mucosal responses under homeostatic conditions.

Dysbiotic microbiota from IBD patients confers Duox2 induction in human-microbiota associated mice

10

ACCEPTED MANUSCRIPT

Our findings above indicate that murine DUOX2 functions as an epithelial first-line defense system affecting normal mucosal immune homeostasis. In humans, DUOX2 and DUOXA2 have been identified among the top upregulated genes in the ilea of IBD patients

9

RI PT

including those without ileal inflammation, suggesting a role in abnormal immune homeostasis preceding the manifestation of histological lesions. In these patients, dysbiotic changes of the mucosal microbiota have been described, although a causative relationship to DUOX2

SC

upregulation has not been established. To explore whether abnormal microbiota is sufficient to explain overexpression of DUOX2 in the pre-clinical stage of IBD, we analyzed Duox2

donors. As observed previously

25

M AN U

expression in GF mice following association with human microbiota from IBD patients or healthy , association of mice with normal human microbiota has little

or no effect on the expression of host defense genes highly responsive to mouse microbiota (Figure 6A). However, significantly higher induction of the DUOX2 system was observed among mice inoculated with dysbiotic fecal samples from patients with active colitis. Although intestinal

TE D

samples from mice colonized with healthy or dysbiotic human microbiota did not differ in the overall mucosa-adherent eubacterial load, there was higher mucosal association with members of the family of Enterobacteriaceae (Figure 6B). While the specific microbial species responsible

EP

for DUOX2 induction are unknown and likely donor specific, it is tempting to speculate that, in the context of dysbiotic microbiota, indigenous pathobionts gain increased access to the

AC C

intestinal epithelium triggering a DUOX2 defense response.

The gene expression changes in DUOX defective mice resemble mucosal dysbiosis associated changes in non-inflamed ilea of IBD patients Since a DUOX defect exaggerated the ileal immune response to epithelial-attaching SFB, we hypothesized that a defect in DUOX would trigger similar pathogenetic changes as those observed in non-inflamed ilea affected by mucosal dysbiosis. Cross-species GSEA revealed that genes with strongest upregulation in non-inflamed ilea of patients with cCD 9 were

11

ACCEPTED MANUSCRIPT

significantly enriched among genes upregulated in Duoxa-/- animals, whereas genes with suppressed expression in cCD patients showed concordant downregulation in Duoxa-/- (Figure 6C). Hence, a loss of DUOX activity in mice leads to subtle gene expression changes that

AC C

EP

TE D

M AN U

SC

RI PT

recapitulated the abnormalities found in non-inflamed ilea of patients with mucosal dysbiosis.

12

ACCEPTED MANUSCRIPT

Discussion Our current study establishes mammalian DUOX2 as a critical modulator of mutualistic hostmicrobiota interactions that are fundamental in maintaining gut immune homeostasis. While the 14

, our results

RI PT

induction of murine Duox2 by the normal microbiota has been reported recently

provide a link between an epithelial-attaching commensal and DUOX2 activation. Induction does not depend on mucosal IL-23/22 cytokine circuitry, although the latter can boost

SC

expression of DUOX2. DUOX activity modulates redox-signaling in mucosa-associated commensals and restricts the translocation of bacterial material into the GALT system, thereby

M AN U

dampening microbiota-induced mucosal immune responses. Ultimately, our study provides a functional link between DUOX2 induction in early stages of IBD and the associated changes in mucosal microbiota. Not only is DUOX2 induced by constituents found in the dysbiotic flora of IBD patients, but lack of the DUOX defense system is sufficient to cause ileal gene expression changes reminiscent of those in an early pathogenetic stage of IBD associated with mucosal

TE D

dysbiosis.

There are several lines of evidence that support the concept that direct commensal epithelial contact is a primary trigger for DUOX2 expression. We showed that monocolonization

EP

with SFB was sufficient for high-level DUOX2 induction corresponding to the mucosal abundance of SFB along the intestinal tract. This finding was in contrast to a recent report

AC C

showing that other indigenous bacteria that, unlike SFB, are normally kept at distance from the epithelium, did not stimulate Duox2 expression

14

. Consistent with the concept that DUOX2

induction is triggered by access of bacteria to the epithelium, we found that microbial extracts prepared from either SFBneg or SFBpos microbiota were not sufficient to induce Duox2 in ileal enteroids (Supplementary Figure S4). Arguing against a role of soluble factors is also the fact that microbiota-induced Duox2 expression at homeostasis does not depend on toll-like receptor signaling since it was not abolished in Myd88-/-Trif-/- mice

14

. The regulation of DUOX2 by

epithelial contact with constituents of the microbiota is consistent with a role of mammalian

13

ACCEPTED MANUSCRIPT

DUOX2 as sentinel response against potential threats to the epithelial barrier. In SFBneg SPF mice, induction of DUOX2 was still higher in the small intestine compared to the colon, despite the latter having higher bacterial load (bacteria per ml luminal content: ileum ~108; colon ~1011).

which is less penetrable for bacteria-sized particles

26

RI PT

This observation is likely related to the distinct physical properties of the colonic mucus layer, . To directly examine SFB-induced cell-

autonomous signaling and its effects on Duox2 expression will require the coculture of SFB with

culture of SFB

27

and enteroid-derived monolayers

, such studies should become feasible in

M AN U

the future.

28

SC

highly differentiated intestinal epithelial cells in vitro. Given the recent progress in the in vitro

Epithelial innate defense responses are coordinated by IL-22, which stimulates expression of secreted antimicrobial effectors

29

(Figure 7). IL-22 is produced in TH17 cells and

ILC found in the intestinal lamina propria, Peyer’s patches and MLN

30

, whereas IL-22 receptor

is almost exclusively detected in epithelial cells. A master regulator for activation of the IL-22

TE D

pathway is IL-23 produced by lamina propria macrophages upon contact with bacteria or sensing of bacterial products

31

. We showed that IL-22 robustly induced Duox2 in enteroids

indicating that activation of the IL-23/22 pathway can amplify DUOX2-mediated defense.

EP

However, in contrast to expression of Reg3g or Saa1, expression of Duox2 was upregulated rather than diminished in IL-22 deficient animals. In this scenario, a lack of antimicrobial

AC C

effectors allowed increased mucosal access of indigenous bacteria (e.g., SFB) inducing Duox2 expression (Figure 7C). In terms of Duox2 expression, increased bacterial-epithelial contact in IL-22 deficient mice apparently overrides the lack of IL-22 mediated stimulation. We thus hypothesize that the first line defense provided by DUOX2 restricts activation of the IL-22 pathway under homeostatic conditions, the latter being strongly activated following bacterial sensing by lamina propria macrophages (Figure 7A). In fact, even in an SPF environment (SFBpos), Duoxa-/- displayed a trend towards higher ileal expression of IL-17/22 cytokines (Figure 7B; Supplementary Figure S14).

14

ACCEPTED MANUSCRIPT

We found that loss of DUOX activity increased mucosal penetration of a microbiota subset at homeostasis despite normal paracellular permeability. One potential mechanism is the suppression of bacterial virulence within an oxidative microenvironment. For instance, in vitro

capsule synthesis and thereby invasion of epithelial cells

21

RI PT

exposure of Campylobacter jejuni to DUOX2-generated H2O2 suppresses polysaccharide . We showed here that DUOX was

sufficient to regulate expression of a redox-sensitive response element (putative perR-kat operon) in mucosa-associated SFB. Such DUOX-dependent change in the redox-status of

SC

juxtaepithelial bacteria was also evident in our prior study of gastric Helicobacter felis infection 6.

M AN U

Hence, DUOX-generated H2O2 can modulate protein function within mucosa-associated bacteria, potentially suppressing virulence behavior of indigenous pathobionts. In addition, DUOX may also support epithelial-cell intrinsic defense mechanisms that contain endocytosed bacteria, a concept compatible with the protective effect of DUOX2 in epithelial invasion studies 19,20

.

Endocytosed

are

(xenophagy).

targeted

Such

for

epithelial

lysosomal

degradation

xenophagy

delays

via

early

selective Salmonella

TE D

macroautophagy

bacteria

dissemination to extraintestinal sites delipidation enzyme ATG4B

32,33

and may be facilitated by oxidative inactivation of the

34

. It is thus an attractive hypothesis that in intestinal epithelium,

EP

DUOX-generated H2O2 supports the targeting of autophagy activity to endocytosed bacteria. This concept would also be consistent with the previous finding that DUOX2 co-localizes at the 20

, which can directly

AC C

bacterial entry site with the bacterial pattern recognition receptor NOD2 recruit the autophagocytic protein ATG16L1 35.

Although low level of transepithelial uptake of bacteria is part of the normal immune

surveillance, exaggerated translocation of bacteria into Peyer's patches is a feature found in CD patients, despite normal permeability to protein and absent inflammation

36,37

. The genes most

specifically associated with CD are crucial for epithelial containment of intracellular commensals 32

and invasive pathogens, such as, Salmonella in animal models

32,33,38

. The mild phenotype

observed in these models is not unlike the phenotype of Duoxa-/- mice (Figure 7B). The robust

15

ACCEPTED MANUSCRIPT

upregulation of DUOX2 in non-inflamed ilea of colon-only CD patients 9 could therefore provide a compensatory response limiting bacterial translocation. In fact, we showed that a defect in the DUOX response alone is sufficient to cause ileal gene expression profiles reminiscent of those

RI PT

found in noninflamed ilea of cCD patients, suggesting that a functional defect in the DUOX2 system could be a novel susceptibility event in CD. Here we also showed that dysbiotic microbiota from IBD patients, but not microbiota from healthy donors, was able to trigger the

SC

DUOX2 system when transferred into GF mice. Mice reconstituted with a dysbiotic microbiota showed a higher abundance of mucosa-associated Enterobacteriaceae. In this context, it is interesting that adherent, invasive E. coli have been frequently isolated from mucosal samples

M AN U

of CD patients 39.

Since unbalanced production of ROS can exacerbate inflammation

40

, DUOX2

upregulation in IBD is often deemed to be deleterious. Here we demonstrate that loss of DUOX activity not only increases mucosal bacterial uptake, but caused an ileal gene expression profile

TE D

reminiscent of early CD-associated changes, indicating a distinct paradigm for the role of DUOX2 in early CD pathogenesis. Accordingly, the upregulation of DUOX2 in patients with quiescent ileal disease can be interpreted as a sentinel response against increased commensal-

EP

epithelial interaction reflecting a defective host defense mechanism that normally keeps commensals at bay. Thus, increased ileal DUOX2 level may prove to be an important marker of

AC C

perturbed mucosal homeostasis early in the pathogenesis of IBD.

16

ACCEPTED MANUSCRIPT

Acknowledgments: We thank X. De Deken and F. Miot for providing DUOX antibodies. This study was supported by the National Institutes of Health grants RO1DK087708-01 (J.Y.K.) and RO1DK055732-15

Colitis Foundation of America (N.K.) and

RI PT

(J.L.M.), a JSPS Postdoctoral Fellow for Research Abroad (S. K. and H. N.-K.), the Crohn’s and the Michigan Gastrointestinal Peptide Research

AC C

EP

TE D

M AN U

SC

Center NIDDK 5P30DK034933 (H.G., N. K.).

17

ACCEPTED MANUSCRIPT

REFERENCES

1.

Goto Y, Ivanov, II. Intestinal epithelial cells as mediators of the commensal-host immune crosstalk. Immunol Cell Biol 2013;91:204-14. Geiszt M, Witta J, Baffi J, et al. Dual oxidases represent novel hydrogen peroxide

RI PT

2.

sources supporting mucosal surface host defense. FASEB J 2003;17:1502-4. 3.

El Hassani RA, Benfares N, Caillou B, et al. Dual oxidase2 is expressed all along the digestive tract. American journal of physiology. Gastrointestinal and liver physiology

Ha EM, Oh CT, Bae YS, et al. A direct role for dual oxidase in Drosophila gut immunity. Science 2005;310:847-50.

5.

M AN U

4.

SC

2005;288:G933-42.

Chavez V, Mohri-Shiomi A, Garsin DA. Ce-Duox1/BLI-3 generates reactive oxygen species as a protective innate immune mechanism in Caenorhabditis elegans. Infection and immunity 2009;77:4983-9.

Grasberger H, El-Zaatari M, Dang DT, et al. Dual oxidases control release of hydrogen

TE D

6.

peroxide by the gastric epithelium to prevent Helicobacter felis infection and inflammation in mice. Gastroenterology 2013;145:1045-54. Aerssens J, Camilleri M, Talloen W, et al. Alterations in mucosal immunity identified in

EP

7.

the colon of patients with irritable bowel syndrome. Clinical gastroenterology and

AC C

hepatology : the official clinical practice journal of the American Gastroenterological Association 2008;6:194-205.

8.

Yanai H, Ben-Shachar S, Baram L, et al. Gene expression alterations in ulcerative colitis

patients after restorative proctocolectomy extend to the small bowel proximal to the pouch. Gut 2014;64:756-64.

9.

Haberman Y, Tickle TL, Dexheimer PJ, et al. Pediatric Crohn disease patients exhibit specific ileal transcriptome and microbiome signature. J Clin Invest 2014;124:3617-33.

10.

Grasberger H, De Deken X, Mayo OB, et al. Mice deficient in dual oxidase maturation

18

ACCEPTED MANUSCRIPT

factors are severely hypothyroid. Mol Endocrinol 2012;26:481-92. 11.

Zheng Y, Valdez PA, Danilenko DM, et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med 2008;14:282-9. Cox JH, Kljavin NM, Ota N, et al. Opposing consequences of IL-23 signaling mediated

RI PT

12.

by innate and adaptive cells in chemically induced colitis in mice. Mucosal Immunol 2012;5:99-109.

Eberl G, Marmon S, Sunshine MJ, et al. An essential function for the nuclear receptor

SC

13.

RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat Immunol

14.

M AN U

2004;5:64-73.

Sommer F, Backhed F. The gut microbiota engages different signaling pathways to induce Duox2 expression in the ileum and colon epithelium. Mucosal Immunol 2014.

15.

Ivanov, II, Atarashi K, Manel N, et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 2009;139:485-98.

Obata T, Goto Y, Kunisawa J, et al. Indigenous opportunistic bacteria inhabit

TE D

16.

mammalian gut-associated lymphoid tissues and share a mucosal antibody-mediated symbiosis. Proc Natl Acad Sci U S A 2010;107:7419-24. Yamauchi KE, Snel J. Transmission electron microscopic demonstration of phagocytosis

EP

17.

and intracellular processing of segmented filamentous bacteria by intestinal epithelial

18.

AC C

cells of the chick ileum. Infect Immun 2000;68:6496-504. Caselli M, Holton J, Boldrini P, et al. Morphology of segmented filamentous bacteria and

their patterns of contact with the follicle-associated epithelium of the mouse terminal ileum: implications for the relationship with the immune system. Gut Microbes 2010;1:367-72.

19.

Botteaux A, Hoste C, Dumont JE, et al. Potential role of Noxes in the protection of mucosae: H2O2 as a bacterial repellent. Microbes Infect 2009;11:537-44.

20.

Lipinski S, Till A, Sina C, et al. DUOX2-derived reactive oxygen species are effectors of

19

ACCEPTED MANUSCRIPT

NOD2-mediated antibacterial responses. J Cell Sci 2009;122:3522-30. 21.

Corcionivoschi N, Alvarez LA, Sharp TH, et al. Mucosal reactive oxygen species decrease virulence by disrupting Campylobacter jejuni phosphotyrosine signaling. Cell

22.

RI PT

host & microbe 2012;12:47-59. Haraga A, Ohlson MB, Miller SI. Salmonellae interplay with host cells. Nat Rev Microbiol 2008;6:53-66.

Sierro F, Dubois B, Coste A, et al. Flagellin stimulation of intestinal epithelial cells

SC

23.

triggers CCL20-mediated migration of dendritic cells. Proc Natl Acad Sci U S A

24.

M AN U

2001;98:13722-7.

Vijay-Kumar M, Carvalho FA, Aitken JD, et al. TLR5 or NLRC4 is necessary and sufficient for promotion of humoral immunity by flagellin. Eur J Immunol 2010;40:352834.

25.

Gaboriau-Routhiau V, Rakotobe S, Lecuyer E, et al. The key role of segmented

TE D

filamentous bacteria in the coordinated maturation of gut helper T cell responses. Immunity 2009;31:677-89. 26.

Johansson ME, Phillipson M, Petersson J, et al. The inner of the two Muc2 mucin-

EP

dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci U S A 2008;105:15064-9.

Schnupf P, Gaboriau-Routhiau V, Gros M, et al. Growth and host interaction of mouse

AC C

27.

segmented filamentous bacteria in vitro. Nature 2015.

28.

Moon C, VanDussen KL, Miyoshi H, et al. Development of a primary mouse intestinal

epithelial cell monolayer culture system to evaluate factors that modulate IgA transcytosis. Mucosal Immunol 2014;7:818-28.

29.

Liang SC, Tan XY, Luxenberg DP, et al. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med 2006;203:2271-9.

20

ACCEPTED MANUSCRIPT

30.

Ivanov, II, McKenzie BS, Zhou L, et al. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 2006;126:1121-33. Kinnebrew MA, Buffie CG, Diehl GE, et al. Interleukin 23 production by intestinal

RI PT

31.

CD103(+)CD11b(+) dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense. Immunity 2012;36:276-87.

Benjamin JL, Sumpter R, Jr., Levine B, et al. Intestinal epithelial autophagy is essential

SC

32.

for host defense against invasive bacteria. Cell Host Microbe 2013;13:723-34. Conway KL, Kuballa P, Song JH, et al. Atg16l1 is required for autophagy in intestinal

M AN U

33.

epithelial cells and protection of mice from Salmonella infection. Gastroenterology 2013;145:1347-57. 34.

Scherz-Shouval R, Shvets E, Fass E, et al. Reactive oxygen species are essential for autophagy and specifically regulate the activity of Atg4. EMBO J 2007;26:1749-60. Travassos LH, Carneiro LA, Ramjeet M, et al. Nod1 and Nod2 direct autophagy by

TE D

35.

recruiting ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immunol 2010;11:55-62.

Keita AV, Salim SY, Jiang T, et al. Increased uptake of non-pathogenic E. coli via the

EP

36.

follicle-associated

epithelium

in

longstanding ileal

Crohn's

disease.

J

Pathol

37.

AC C

2008;215:135-44.

Salim SY, Silva MA, Keita AV, et al. CD83+CCR7- dendritic cells accumulate in the

subepithelial dome and internalize translocated Escherichia coli HB101 in the Peyer's patches of ileal Crohn's disease. Am J Pathol 2009;174:82-90.

38.

Lapaquette P, Glasser AL, Huett A, et al. Crohn's disease-associated adherent-invasive E. coli are selectively favoured by impaired autophagy to replicate intracellularly. Cell Microbiol 2010;12:99-113.

39.

Darfeuille-Michaud A, Boudeau J, Bulois P, et al. High prevalence of adherent-invasive

21

ACCEPTED MANUSCRIPT

Escherichia coli associated with ileal mucosa in Crohn's disease. Gastroenterology 2004;127:412-21. 40.

Biasi F, Leonarduzzi G, Oteiza PI, et al. Inflammatory bowel disease: mechanisms,

AC C

EP

TE D

M AN U

SC

Author names in bold designate shared co-first authors.

RI PT

redox considerations, and therapeutic targets. Antioxid Redox Signal 2013;19:1711-47.

22

ACCEPTED MANUSCRIPT

FIGURE LEGENDS

Figure 1. Intestinal DUOX2 expression depends on microbial colonization. Relative Duox2 (A)

RI PT

and Duoxa2 (B) mRNA expression in GF (n=5) and SPF (n=7) mice. Data represent geometric means±95% CI. dd, duodenum; je, jejunum; il, ileum; co, colon; re, rectum. (C) Immunoblot of DUOX2 protein. ACTB, β-actin loading control. (D, E) Relative mRNA expression of Duox1 and

SC

Nox1. Data represent geometric means±95% CI. (F) Effect of acute enteral antibiotic treatment on ileal Duox2 and Duoxa2 expression. Mice were analyzed 24 hours following oral gavage with

M AN U

streptomycin (20 mg; Abx); SPF, sham treated control. Bars indicate geometric means. ****, P<.0001; ***, P<.001; **, P<.01; *, P<.05.

Figure 2. Mucosa-adherent SFB are a dominant inducer of ileal DUOX2 expression. (A) Mucosa-adherent SFB (16S-rRNA) and Duox2 mRNA level in SFBneg (B6-Jax; n=5) and SFBpos

TE D

(B6-Tac; n=5) mice. Data represent geometric means±95% CI. dd, duodenum; je, jejunum; il, ileum; co, colon; re, rectum. (B) DUOX2 protein expression in ilea of B6-Jax and B6-Tac mice. Each lane represents an individual mouse. ACTB, β-actin loading control. (C, D) Mucosa-

EP

associated SFB and expression of Duox2 mRNA and protein in mice mono-associated for one week with SFB (SFBmono; n=5) or sham-treated GF controls (n=5). Data represent geometric

AC C

means±95% CI. (E) Detection of DUOX2 protein by indirect immunofluorescence (red) and SFB by in situ hybridization (green) in the terminal ileum of GF and SFBmono mice. Scale bars, 10 µm. (F) Ileal mucosa-adherent SFB (16S-rRNA) in mice treated with oral streptomycin (Abx) or sham treated controls (SPF). ***, P<.001; **, P<.01; *, P<.05.

Figure 3. IL-22 can augment DUOX2 expression but is not essential for DUOX2 induction by microbial colonization. (A) Expression of IL22 and Reg3g along the intestinal tract of GF and

23

ACCEPTED MANUSCRIPT

SFBmono mice (n=5 per group). Data represent geometric means±95% CI. Note lower colonic expression of IL22 and Reg3g despite high level of mucosal SFB and DUOX2 (Fig 2C). (B) Acute microbial regulation of ileal IL22 expression. SPF (SFBpos) mice were analyzed 24 hours

RI PT

following oral gavage with streptomycin (Abx) or sham treatment (SPF). (C) Ileal enteroids were cultured with or without IL-22 (50 ng/ml for 18 h) and gene expression of selected genes determined by RT-qPCR. (D) Immunofluorescence of DUOX2 protein in IL-22-stimulated ileal

SC

enteroids. Cdh1, E-cadherin. (E) Ileal expression of IL22 and IL-22 target genes in wt and IL-22 deficient mice (IL22-/-, IL23R-/-, RORgt-/-). (F) Expression of DUOX2 subunit genes and mucosal

M AN U

SFB-colonization. Bars in panels E and F indicate median values. ****, P<.0001; ***, P<.001; **, P<.01; *, P<.05.

Figure 4. DUOX2 restricts transepithelial uptake of bacteria in the small intestine. (A) Detection of DUOX2 protein (red) at the epithelial brush border in the terminal ileum of wt but not Duoxa-/-

TE D

littermates; the basolateral cell marker E-cadherin (CDH1) is shown in green; scale bars represent 50 µm (left panels) and 20 µm (right panels), respectively. (B) SFB-specific catalase (kat) expression in mucosa-adherent and luminal SFB. (C) Graph depicts the ratio of 16S rDNA

EP

in MLN vs ileal mucosa indicative of transepithelial bacterial flux. Dashed lines connect mean bacterial DNA level of Duoxa-/- mice and cohoused littermate controls. Eu, eubacteria; Firm,

AC C

Firmicutes; Bac, Bacteroidetes; Prot, Gammaproteobacteria; Actino, Actinobacteria. (D) In vivo intestinal permeability for 4 kDa dextran in Duoxa-/- and wt mice at baseline, following acute enteral Salmonella infection (ST), and after treatment with dextran sulfate sodium (DSS) to induce unspecific epithelial injury. (E) Acute systemic dissemination of enteral Salmonella Typhimurium in Duoxa-/- and wt animals 24 h post enteral infection.

Figure 5. Loss of DUOX activity disturbs mucosal homeostasis in the terminal ileum. (A) Experimental setup for gene expression profiling. (B) Expression heat maps depicting selected 24

ACCEPTED MANUSCRIPT

genes upregulated in the ileum of Duoxa-/- animals. (C) Ileal gene expression analyzed by RTqPCR. Mean expression in Duoxa-/- animals is plotted relative to the mean in cohoused wt littermates (set to 1) in cage-wise comparisons (n=7). **, P<.01. (D, E) Genes controlled by 15

were

RI PT

SFB-monocolonization or by cohousing of B6-Jax (SFBneg) with B6-Tac (SFBpos) mice

tested for correlation with genes affected by loss of DUOX activity using GSEA (see Supplementary Methods). Within each plot, genes are sorted for their relative ileal expression in

SC

Duoxa-/- mice (left side: up in Duoxa-/-; right side: down in Duoxa-/-). Genes upregulated (downregulated) by introduction of SFB are significantly correlated with those upregulated

M AN U

(downregulated) in mice with loss of DUOX activity. Core enriched genes are listed in Supplementary Tables S16-S19. FDR, false discovery rate q-value; NES, normalized enrichment score.

Figure 6. DUOX2 is induced by constituents of the microbiota from IBD patients and acts as a

TE D

compensatory mucosal defense pathway. (A) Gene expression in colonic mucosa of mice colonized for two weeks with fecal material from healthy donors or patients with ulcerative colitis-associated dysbiosis. Bars indicate median values. Kruskal-Wallis test; ***, P<.001; **,

EP

P<.01; *, P<.05. (B) 16S rRNA level in mucosal samples corresponding to (A). *, P<.05. (C) Genes dysregulated in the non-affected ileum of patients with colon-only CD (cCD vs healthy 9

were tested for correlation with genes affected by loss of DUOX2 activity using

AC C

controls)

GSEA. Genes upregulated (downregulated) in non-inflamed tissue from CD patients are significantly enriched among those upregulated (downregulated) in mice with loss of DUOX activity. Leading edge gene subsets are depicted in Tables S20 and S21. FDR, false discovery rate q-value; NES, normalized enrichment score.

Figure 7. Model for the integration of the DUOX2 system into the intestinal epithelial defense response. (A) Epithelial contacting microbes (e.g., SFB) induce DUOX2 by an IL-22-

25

ACCEPTED MANUSCRIPT

independent pathway at homeostasis. DUOX2 activity triggers an anti-oxidative response (kat) in mucosa-adherent SFB but does not prevent their colonization. (B) Lack of DUOX2 activity leads to increased uptake of bacterial material (e.g., SFB, Proteobacteria). Expression of

RI PT

compensatory host defense systems resulting in a proinflammatory milieu. (C) Lack of IL-22 dependent mucosal defense leads to mucosal dysbiosis and compensatory induction of DUOX2. (D) In IBD-associated mucosal dysbiosis, increased epithelial contact with and uptake

SC

of indigenous pathobionts triggers a compensatory DUOX2 response before the onset of clinical inflammation. Sensing of bacterial factors by antigen-presenting cells (APC) activates the IL-

M AN U

23/IL-22 cascade for secretion of antimicrobial effectors and further enhancement of DUOX2

AC C

EP

TE D

expression.

26

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT

Supplementary Materials and Methods Animals Duoxa-/- and gender-matched wt littermates were cohoused (3-5 animals/cage) in microisolator

RI PT

cages under SPF conditions 1. Food and water were supplied ad libitum, with the latter including a supplemental dose of L-thyroxine to maintain euthyroidism of Duoxa-/- mice 2. For experiments involving Duoxa-deficient mice, animals used were in a pure 129S6 genetic background, except

SC

for studies shown in Fig. S9 and S12 that employed mice backcrossed for ten generations into C57BL6 background. All of the latter were confirmed to be homozygous carriers of the G169D Slc11a1 variant (rs47476426) genotyped using a HypCH4III endonuclease (New England

M AN U

Biolabs) restriction fragment length polymorphism. Il22-/-, Il23r-/-, and RORgt-/- mice (all in B6 background) have been described previously

3-5

. C57BL6 mice with distinct resident microbiota

were purchased from Taconic Farms and Jackson Laboratory, respectively. For all studies, mice were used at 9-12 weeks of age. Studies were approved by the University of Michigan

TE D

Institutional Animal Care and Use Committee (PRO-00004497 and PRO-00002436).

Mono-association of mice with SFB

EP

GF mice were aseptically transferred to microisolator cages and housed in sterile laminar-flow hoods. Mice were orally gavaged with a freshly prepared suspension of frozen cecal material 6

or GF controls. Tissues were collected one week following treatment. All

AC C

from SFBmono mice

mice remained bacteriologically sterile except for the presence of SFB (unculturable, positive gram-staining) in monocolonized mice.

Tissue collection Animals were euthanized by isoflurane overdose. MLN, liver and spleen were harvested aseptically. Intestinal segments were collected from the duodenum (immediately following the

1

ACCEPTED MANUSCRIPT

pylorus), jejunum (halfway between stomach and cecum), ileum (terminal portion), colon (midportion) and rectum. The isolated segments were opened longitudinally and rinsed thrice with PBS. Samples for nucleic acid extraction were snap frozen in liquid nitrogen. Samples for

RI PT

paraffin-embedding were fixed in 10% formalin. For cryosectioning, samples were snap-frozen in Tissue-Tek O.C.T. compound (Andwin Scientific, Woodland Hills, CA).

Histology and morphometric analysis

SC

Serial 4 µm sections of formalin-fixed paraffin-embedded samples were stained with H&E. For morphometry, the terminal ileum was scored for height of villi and depth of crypts on transverse

M AN U

sections at 200× magnification (Figure S7). For each animal, mean values were determined from at least 10 well oriented villus-crypt units. To assess mucosal macrophage accumulation, sections were histochemically stained for F4/80 (clone A3-1; 1:200; Abcam ab6640) and counterstained with hematoxylin. Average F4/80-positive cell number per villus-crypt unit was

TE D

determined by analyzing at least 20 villus-crypt units per animal.

Real-time reverse transcription PCR (RT-qPCR)

EP

Total RNA was prepared using TRIzol reagent, treated with deoxyribonuclease and cleaned up on RNeasy spin columns (Qiagen). RNA was reverse transcribed with Superscript II (Life

AC C

Technologies) using random hexamer priming. Concentration and purity of RNA preparations were determined on a NanoDrop ND-1000 UV spectrophotometer. PCR amplifications were performed using a C1000 Thermal Cycler (Bio-Rad) with SYBR Green dye (Molecular Probes, Carlsbad, CA) and Platinum Taq DNA polymerase (Invitrogen). Each reaction was performed in triplicates with the following conditions: 1 min at 95°C, 40 cycles of 10 s at 95°C and 1 min at 65°C. Amplification specificity was confirmed by melting curve analysis of products. Gene expression of host genes was normalized to Hprt1 mRNA. Expression stability of Hprt1 was confirmed for all samples by comparison with a second house keeping gene, Polr2a. The 2

ACCEPTED MANUSCRIPT

expression of SFB genes was normalized to SFB-specific 16S rRNA. Primer sequences are listed in Supplementary Table S15.

RI PT

Microarray-based gene expression profiling Total RNA was prepared using TRIzol reagent, treated with deoxyribonuclease and cleaned up on RNeasy spin columns (Qiagen). RNA integrity numbers (RIN) were determined using a Bioanalyzer instrument (Agilent Technologies) and ranged from 9.2 to 9.6 (mean: 9.5) with

SC

28S/18S ratios between 1.8 and 1.9. Target labeled cRNA were hybridized to GeneChip Mouse Genome 430 2.0 arrays (Affymetrix). Data were normalized with the RMA procedure using the

M AN U

affy package of Bioconductor implemented in the R statistical language. The dataset is accessible from the NCBI's Gene Expression Omnibus through series GSE60933. For GSEA 7, genes regulated by SFB colonization were selected from GSE18348

8

based on 2.5-fold

upregulation or 2-fold downregulation (unadjusted P<.05) in the comparisons of SFBmono mice

TE D

with GF mice and cohoused B6-Jax (+B6-Tac) with B6-Jax mice, respectively. Genes significantly up- or downregulated in the non-affected ilea of patients with cCD compared to ilea of healthy controls have been reported by Haberman et al.

9

(GSE57945). Genes were ranked

EP

by geometric means of expression ratios of cohoused Duoxa-/- and wt controls. Significance of

AC C

the enrichment score was calculated from 1000 random, size-matched gene set permutations.

DNA isolation and 16S qPCR Genomic DNA was extracted from tissue samples as described (Table S15) were used under validated conditions

11-14

10

. Phyla-specific PCR primers

. Relative bacterial loads were compared

using the 2−ΔΔCt method by normalizing 16S signal to the host DNA amplification signal.

16S rRNA in situ hybridization and immunostaining of tissue sections For staining of frozen sections, thawed 8 µm sections were briefly fixed in 4% freshly prepared

3

ACCEPTED MANUSCRIPT

formaldehyde for 5 min, washed twice in PBS, and then blocked with 20% donkey serum in PBS. Primary antibodies used were a pan-DUOX antiserum (1:1,000)

15

or normal rabbit IgG

(control; Santa Cruz Biotechnology, Santa Cruz, CA), an anti-Salmonella Typhimurium LPS

RI PT

monoclonal antibody (clone 1E6; 1:1,000) (GeneTex), and rat anti-E-cadherin (1:2,000) (Life Technologies). The staining was developed using Alexa Fluor-conjugated secondary antibodies (Life Technologies) and DNA counterstained with DAPI.

Sequential in 16S rRNA situ hybridization and immunodetection followed protocols 16

. Briefly, Carnoy's solution-fixed sections were hybridized in a

SC

outlined previously in detail

humid chamber for 2 hours at 50°C with 5 ng/µl Alexa Fluor 488 labeled oligonucleotide 11

M AN U

SFB1008 (AF488-5'- GCGAGCTTCCCTCATTACAAGG-3')

in a formamide-free hybridization

buffer. Following washes in hybridization buffer and PBS, sections were blocked and stained for DUOX protein as described above.

TE D

Enteric Salmonella Typhimurium infection model

Salmonella enterica serovar Typhimurium (strain SL1344) was grown at 37°C with shaking (150 rpm) in Luria-Bertani (LB) broth containing 100 µg/ml streptomycin. In the streptomycinpretreated model

17

, mice in 129S6 background were given 20 mg streptomycin orally followed

EP

24 hours later by oral gavage with 107 cfu S. Typhimurium (1 OD600 ~ 6x108 cfu/ml) in Hepes

AC C

buffer (100 mM, pH 8.0) or with sterile buffer alone. In the thyphoid model, mice in C57BL6 background received 107 cfu S. Typhimurium by oral gavage without prior antibiotic pretreatment. Mice were euthanized 24 hours following infection. Livers were removed aseptically followed by collection of intestinal content from ileum, cecum, and colon. All samples were weighed and homogenized in 4°C cold PBS/0.1% Triton X-100. Cfu were determined by culturing serial dilutions on LB agar plates with 100 µg/ml streptomycin.

In vivo intestinal permeability assay 4

ACCEPTED MANUSCRIPT

Intestinal permeability was assessed by measuring the enteral uptake of fluorescein isothiocyanate-conjugated dextran (FD4, 4 kDa, Sigma)

18

. Serum was obtained four hours after

gavage with FD4 (0.6 mg per gram body weight). Serum FD4 levels were determined by

RI PT

fluorometry (ex/em, 490/530 nm) using standards serially diluted in mouse serum.

Ileal enteroid culture

19

The excised mouse

SC

The enteroid culture method was modified from the study by Sato et al.

ileum (∼6 cm) was opened longitudinally, rinsed with PBS, then incubated in ice-cold PBS

M AN U

containing 3 mM EDTA for 30 min at 4°C. After manual shaking for 30 sec, the tissue was moved to fresh cold PBS and shaken for 2 min. The tissue fragments were allowed to settle and the supernatant was collected and passed through a 70-µm cell strainer to remove tissue fragments. Crypts were separated from suspended single cells by centrifugation at 150 g (2 min). The crypt pellet was resuspended with Matrigel (BD Bioscience) for seeding into 24 well

TE D

plates (50 µl drop per well). After polymerization of the Matrigel, 0.5 ml culture medium composed of advanced DMEM/F12 supplemented with Hepes (10mM), N2-supplement (1:100), B-27 supplement (1:50), L-glutamine (1:100), penicillin/streptomycin (1:100), 500 ng/ml R-

EP

spondin1, 100 ng/ml noggin, 50 ng/ml Wnt-3a and 100 ng/ml epidermal growth factor was added (all from Life Technologies). The media and growth factors (except for Wnt-3a) were

AC C

changed every 4 days. For passage at 7–10 days post-plating, wells were rinsed twice with icecold PBS. Matrigel containing the enteroids was resuspended in PBS and passed once through a 30 gauge needle. Enteroid fragments were pelleted at 200 g (1 min), washed once with icecold DMEM/F12, centrifuged again, and resuspended in Matrigel for plating. Enteroids were stimulated by incubation in growth medium containing either recombinant murine IL-22 (50 ng/ml) or TNFα (60 ng/ml) (R&D Systems) for 18 hours. For immunostaining, washed enteroids were fixed in 1% freshly prepared formaldehyde (5 min), washed again, and

5

ACCEPTED MANUSCRIPT

snap frozen in O.C.T. compound. For mRNA expression studies, culture medium was aspirated and the matrigel drop containing enteroids directly homogenized in TRIzol for subsequent RNA

RI PT

extraction.

DSS-induced intestinal inflammation model

To induce intestinal inflammation by dextran sulfate sodium salt (DSS), cohoused Duoxa-/- and wt littermates received drinking water with 3% DSS (36–50 kDa; MP Biomedicals) (refreshed

SC

daily). To test whether DUOX status affects the extent of epithelial damage and/or epithelial wound healing in this model, mice were exposed to DSS for seven days, followed by one day on

M AN U

regular drinking water to initiate epithelial restitution. The mice were checked each day for morbidity and their weights were recorded. In vivo permeability assay was performed as described above (in vivo intestinal permeability assay). Weight loss and recovery were

TE D

indistinguishable between Duoxa-/- and wt mice exposed to repeat DSS cycles (Figure S10).

Colonization of mice with healthy and dysbiotic human fecal microbiota Since mucosal dysbiosis in CD patients is not typically reflected by pronounced shifts in the 24

, dysbiotic fecal samples were obtained from patients with

EP

microbial composition in the lumen

active ulcerative colitis (dysbiosis at the family/phylum level confirmed by Illumina 16S rRNA

AC C

sequencing; data not shown). Frozen stool samples from patients and healthy control donors were resuspended under anaerobic conditions and used to infect individual GF mice by gavage. Samples from the proximal colon were analyzed two weeks following microbial challenge.

Western blotting Tissue samples were homogenized in Tissue Protein Extraction Reagent (T-PER, Thermo Scientific) containing a cocktail of protease inhibitors (Complete; Roche Applied Science) and incubated for 1 h at 4°C. The lysates was centrifuged 15 min at 10,000 rpm and concentration of 6

ACCEPTED MANUSCRIPT

total soluble protein determined using the bicinchoninic acid method (BCA; Life Technologies). Equal amounts of solubilized proteins were diluted 3:1 in 4x reducing Laemmli buffer (BioRad) before loading and separation by SDS-PAGE electrophoresis. DUOX proteins were detected 15

and β-actin was detected as loading control (mAb C4;

RI PT

with pan-DUOX antibody (1:2,000)

Santa Cruz Biotechnologies). For densitometry of bands, average density profile plots for individual lanes were generated and the peak areas above background level measured using

SC

the wand tool in ImageJ software 20.

M AN U

Statistics

Log-transformed expression data from unpaired groups were analyzed using Welch's t-test (multiple comparisons adjustment: Bonferroni) or with one-way ANOVA and Bonferroni post-hoc tests. The Wilcoxon matched-pairs signed-rank test was used to test for differences between genotype groups in mixed housing experiments. Each cage was analyzed as a pair of the

TE D

means obtained in Duoxa-/- and cohoused wt littermates (n=2-3 mice per genotype and cage).

AC C

EP

Data were analyzed using GraphPad Prism 6.0 (San Diego, CA).

7

ACCEPTED MANUSCRIPT

Supplementary References 1.

Grasberger H, El-Zaatari M, Dang DT, et al. Dual oxidases control release of hydrogen peroxide by the gastric epithelium to prevent Helicobacter felis infection and

2.

RI PT

inflammation in mice. Gastroenterology 2013;145:1045-54. Grasberger H, De Deken X, Mayo OB, et al. Mice deficient in dual oxidase maturation factors are severely hypothyroid. Mol Endocrinol 2012;26:481-92. 3.

Zheng Y, Valdez PA, Danilenko DM, et al. Interleukin-22 mediates early host defense

4.

SC

against attaching and effacing bacterial pathogens. Nat Med 2008;14:282-9. Cox JH, Kljavin NM, Ota N, et al. Opposing consequences of IL-23 signaling mediated

M AN U

by innate and adaptive cells in chemically induced colitis in mice. Mucosal Immunol 2012;5:99-109. 5.

Eberl G, Marmon S, Sunshine MJ, et al. An essential function for the nuclear receptor RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat Immunol

6.

TE D

2004;5:64-73.

Umesaki Y, Okada Y, Matsumoto S, et al. Segmented filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and induce MHC

EP

class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial cells in the ex-germ-free mouse. Microbiol Immunol 1995;39:555-62. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a

AC C

7.

knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl

Acad Sci U S A 2005;102:15545-50.

8.

Ivanov, II, Atarashi K, Manel N, et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 2009;139:485-98.

9.

Haberman Y, Tickle TL, Dexheimer PJ, et al. Pediatric Crohn disease patients exhibit specific ileal transcriptome and microbiome signature. J Clin Invest 2014;124:3617-33.

10.

Gillilland MG, 3rd, Erb-Downward JR, Bassis CM, et al. Ecological succession of

8

ACCEPTED MANUSCRIPT

bacterial communities during conventionalization of germ-free mice. Appl Environ Microbiol 2012;78:2359-66. 11.

Snel J, Heinen PP, Blok HJ, et al. Comparison of 16S rRNA sequences of segmented

RI PT

filamentous bacteria isolated from mice, rats, and chickens and proposal of "Candidatus Arthromitus". Int J Syst Bacteriol 1995;45:780-2. 12.

Bacchetti De Gregoris T, Aldred N, Clare AS, et al. Improvement of phylum- and classspecific primers for real-time PCR quantification of bacterial taxa. J Microbiol Methods

Matsuda K, Tsuji H, Asahara T, et al. Sensitive quantitative detection of commensal bacteria

by

rRNA-targeted

2007;73:32-9. 14.

reverse

transcription-PCR.

M AN U

13.

SC

2011;86:351-6.

Appl

Environ

Microbiol

Huijsdens XW, Linskens RK, Mak M, et al. Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR. J Clin Microbiol 2002;40:4423-7. De Deken X, Wang D, Many MC, et al. Cloning of two human thyroid cDNAs encoding

TE D

15.

new members of the NADPH oxidase family. The Journal of biological chemistry 2000;275:23227-33.

Johansson ME, Hansson GC. Preservation of mucus in histological sections,

EP

16.

immunostaining of mucins in fixed tissue, and localization of bacteria with FISH.

17.

AC C

Methods Mol Biol 2012;842:229-35. Grassl GA, Valdez Y, Bergstrom KS, et al. Chronic enteric salmonella infection in mice leads to severe and persistent intestinal fibrosis. Gastroenterology 2008;134:768-80.

18.

Napolitano LM, Koruda MJ, Meyer AA, et al. The impact of femur fracture with associated soft tissue injury on immune function and intestinal permeability. Shock 1996;5:202-7.

19.

Sato T, Vries RG, Snippert HJ, et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009;459:262-5.

9

ACCEPTED MANUSCRIPT

20.

Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 2012;9:671-5.

21.

Kuwahara T, Ogura Y, Oshima K, et al. The lifestyle of the segmented filamentous

whole-genome sequencing. DNA Res 2011;18:291-303. 22.

RI PT

bacterium: a non-culturable gut-associated immunostimulating microbe inferred by

Pamp SJ, Harrington ED, Quake SR, et al. Single-cell sequencing provides clues about the host interactions of segmented filamentous bacteria (SFB). Genome Res

23.

SC

2012;22:1107-19.

Reimand J, Arak T, Vilo J. g:Profiler--a web server for functional interpretation of gene

24.

M AN U

lists (2011 update). Nucleic Acids Res 2011;39:W307-15.

Gevers D, Kugathasan S, Denson LA, et al. The treatment-naive microbiome in newonset Crohn's disease. Cell Host & Microbe 2014;15:382-392

AC C

EP

TE D

Author names in bold designate shared co-first authors.

10

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S1. Topology model of the DUOX/DUOXA complex and gene targeting strategy in Duoxa-deficient mice. (A) Topology model depicting the heterodimeric structure of a functional DUOX enzyme complex. (B) Arrangement of DUOX and DUOXA subunit genes on mouse chromosome 2 and targeting strategy to disrupt function of DUOX enzymes. Duoxa+, wt

AC C

EP

TE D

allele; Duoxa-, Duoxa-deficient allele.

11

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S2. Correspondence of DUOX protein expression with relative Duox2 mRNA expression in mice associated with distinct microbiota. Relative DUOX protein expression was determined by densitometry of Western blots depicted in Figures 1 and 2 using ImageJ 20. a.u., arbitrary densitometric units.

12

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S3. (A) Induction of cytokines in the ileum of mice monocolonized for one week with SFB. GF, germ-free controls. (B) Ileal enteroids were treated for 18 hours with

TE D

cytokines at the indicated concentration. Recombinant IL-22 but not TNFα is sufficient to

AC C

EP

robustly induce Duox2 in vitro. ***, P<.001; **, P<.01; *, P<.05; ns, P>.05.

Supplementary Figure S4. Sterile microbial extracts do not induce Duox2 expression in ileal enteroids. Sonicates of cecal contents of B6-Jax (SFBneg) and B6-Tac (SFBpos) mice were sterile-filtered (0.2 µm) and added to ileal enteroids cultured in complete growth medium (20 mg original wet weight/ml medium). Expression of Duox2, Ccl20, Cxcl1, and Saa1 were evaluated after exposure for 16 hours. *, P<.05; **, P<.01.

13

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S5. Putative perR-kat operon in the SFB genome. Region of the SFB genome depicting the location of the kat (catalase) gene preceded by a putatively H2O2sensitive transcriptional repressor (putative perR; fur-homolog sequence). This arrangement

EP

TE D

M AN U

observed DUOX2-dependent induction of SFB-kat in vivo.

SC

suggests a perR-kat operon for H2O2-induced derepression of kat providing a rationale for the

AC C

Supplementary Figure S6. Effect of DUOX status on anti-oxidative gene expression in ileal mucosa and mucosa-associated SFB. (A) Relative gene expression in mucosa-adherent SFB. kat, catalase (SFBM_1159); myoAg, myosin-crossreactive antigen-like (SFBM_0327); fliC2, flagellin (SFBM_0642); adprt, adenin-phosphoribosyltransferase homolog (SFBSU_007G84); piplc, phosphoinositide phospholipase C homolog (SFBM_0755); fnbp, fibronectin-binding protein (SFBM_0986). Except for kat, genes were selected based on a putative role in SFBepithelial interaction 21,22. (B) Relative ileal expression of antioxidant enzymes in DUOX intact (wt) vs DUOX deficient (Duoxa-/-) mice. Values represent mean±SEM of n=3 independent expression ratios (intra-cage comparisons). *, P<.05; ns, P>.05.

14

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S7. Absence of DUOX activity in SPF mice does not lead to spontaneous intestinal inflammation. (A) Body weight gain of Duoxa-/- animals and wt

AC C

littermates. Values indicate mean±SD of n=17-22 mice per group. m, males; f, females. (B) Exemplar hematoxylin and eosin stained sections of the small intestine of wt and Duoxa-/littermates. Arrows in lower panels (20x objective magnification; ileum) indicate method of measurement of the height of villi (hv) and depth of crypts (dc). (C) Data show mean hv and dc values of wt (n=10) and Duoxa-/- (n=9) littermates. All mice were males, between 11-13 weeks of age. (D) Exemplar histochemical staining for the macrophage marker F4/80. Shown are transverse sections of the ileal mucosa of a wt and Duoxa-/- littermate pair. (E) Average number of F4/80-positive cells per villus-crypt unit. Values were determined by counting positive cells of at least 10 well-oriented villus-crypt units per animal. ns, P>.05.

15

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S8. Effect of DUOX status on bacterial DNA level in ileal mucosa and MLN. Relative level of group-specific 16S rDNA in ileal (A) and MLN (B) samples from Duoxa-/-

M AN U

and cohoused littermate controls. Dashed lines connect mean bacterial DNA level of Duoxa-/and wt mice in intra-cage comparisons. For comparison between cages/litters, relative amounts were normalized within each cage (level in wt animals set to 1). Eu, eubacteria; Firm, Firmicutes; Bac, Bacteroidetes; Prot, Proteobacteria; Actino, Actinobacteria. *, P<.05, two-sided

AC C

EP

TE D

Wilcoxon matched-pairs signed rank test.

Supplementary Figure S9. Effect of DUOX status on bacterial DNA level in ileal mucosa and MLN in B6 mice. Relative level of 16S rDNA in ileal mucosal and MLN samples from Duoxa-/and wt littermates in B6 genetic background. Mice from different litters were cohoused (mixed genotypes) after weaning. Bedding was mixed weekly between cages. Relative SFB 16S DNA level in MLN and ileal mucosa were determined in three months old mice by qPCR and normalized relative to the tissue genomic DNA level (mean level in wt mice set to 1). ns, P>.05; *, P<.05; **, P<.01; Mann-Whitney test.

16

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S10. Body weight change and survival in the DSS-induced intestinal inflammation model. Three months old mice (male 129S6) were treated with 7-day cycles of 3% DSS in drinking water followed by 14 days recovery period on regular drinking water. DSStreated Duoxa-/- and wt mice did not differ in body weight change (A) or survival rate (B). Body

AC C

EP

TE D

weight data represent mean±SEM.

Supplementary Figure S11. Acute enteral Salmonella Typhimurium (ST) infection model. (A) Induction of Duoxa2 expression in the ileum 24 hours following enteral infection with ST. Abx, sham-infected animals pretreated with streptomycin. (C, D) Ileal expression of epithelial chemokines Cxcl1 and Ccl20 during acute ST infection. ***, P<.001; **, P<.01; *, P<.05. Data were log-transformed before analysis to approximate Gaussian distribution. Bars indicate the geometric means.

17

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S12. Typhoid model of acute enteral Salmonella Typhimurium (ST) infection. B6 Duoxa-/- and wt littermates (10 generation of backcrossing onto C57BL/6

AC C

background; all homozygous for the G169D Slc11a1 mutant) were orally infected with 1.5x107 cfu ST without antibiotic conditioning. (A) Systemic dissemination (liver, spleen) and ileal colonization 48 h following infection. Data represent geometric means±95% CI. (B) Detection of ST within ileal Peyer's 48 h following oral gavage with ST. Indirect Immunofluorescence detection of ST-specific lipopolysaccharide (mAb clone 1E6; 1:1,000; Genetex; green). Purple, DNA counterstained with DAPI.

18

RI PT

ACCEPTED MANUSCRIPT

Supplementary Figure S13. Functional enrichment analysis of genes affected by DUOX status. Genes upregulated in Duoxa-/- mice (n=99 genes with mean >1.4 fold vs cohoused Gene Ontology database using the g:GOSt program

. Listed P values are adjusted for multiple

TE D

M AN U

comparisons using the Bonferroni method.

23

SC

littermate controls) were tested for enrichment within the Biological Process terms subset of the

/-

EP

Supplementary Figure S14. Ileal expression of IL-17/22 cytokines. Mean expression in Duoxaanimals is plotted relative to the mean in co-housed wt littermates (set to 1). **, P<.01; two-

AC C

sided Wilcoxon matched-pairs signed rank test.

19

ACCEPTED MANUSCRIPT

Supplementary Table S15 qPCR primers

name

5'-3' sequence

gene

DUOXA2-F

GCCTGGCTTTGCTCACCA

Duoxa2

DUOXA2-R

GAGGAGGAGGCTCAGGAT

DUOXA1-F

CATCACCCTCACAGGCACC

DUOXA1-R

GGAATGCCACCCACAGCA

DUOX1-F

CCCACGTTACCATTTCCATCA

DUOX1-R

CATCTGCATAGCTGGCTGGA

DUOX2-F

GGACAGCATGCTTCCAACAAGT

DUOX2-R

GCCTGATAAACACCGTCAGCA

NOX1-F

CAGAGCCACTGACATCCTGA

NOX1-R

CAGACTCGAGTATCGCTGACA

SAA1-F

GCTACTCACCAGCCTGGTCT

SAA1-R

GGCCTCTCTTCCATCACTGA

CCL20-F

GTACTGCTGGCTCACCTCT

CCL20-R

CATCTTCTTGACTCTTAGGCTGA

CXCL1-F

CTGCACCCAAACCGAAGTCAT

CXCL1-R

TTGTCAGAAGCCAGCGTTCAC

NOS2-F

CTGAACTTGAGCGAGGAGCA

NOS2-R

GTGCCAGAAGCTGGAACTCT

IL17a-F

GGACTCTCCACCGCAATGA

IL17a-R

GGCACTGAGCTTCCCAGATC

IL17f-F

CCCCATGGGATTACAACATCAC

IL17f-R

CATTGATGCAGCCTGAGTGTCT

IL22-F

CCCAGTCAGACAGGTTCCA

IL22-R

TGATCTCTCCACTCTCTCCA

Duoxa1

SC

Duox1

RI PT

mouse mRNA-specific primers

Duox2

M AN U

Nox1

Saa1

Ccl20

EP

TE D

Cxcl1

Nos2 Il17a

Il17f

AC C

Il22

SFB-specific primers name

5'-3' sequence

gene

SFB736F

11

GACGCTGAGGCATGAGAGCAT

16S rDNA

SFB844R

11

GACGGCACGGATTGTTATTCA

(SFB)

GTAGATGGTAACTCGGGAAGTACT

SFBM_1159

kat-F kat-R

CTCCCATGGAACGAGCAGTGT

piplc-F

CCTACTCTAGGAGAAGCAAGAGGA

piplc-R

GGTAAAACTCCACCATGACCATTCA

myoag-F

GTGGTGGCTGGGATATGTGGA

SFBM_0755 SFBM_0327

20

ACCEPTED MANUSCRIPT

myoag-R

CACCCGACTAATTGACCCTTAGGT

fibrobp-F

GCTGGTAGCCATGTTATCCTTGCA

fibrobp-R

CCATTCCTGGTTTTGCATGTGGCA

flic2-F

GGTGTAAGCATCGGGAATATGGGT

flic2-R

CAGCTGTGTTATCTGTTGATGCGA

adprt-F

GCGAGCTTCCCTCATTACAAGG

adprt-R

ACCATCCTGAATCTTCTCCAACA

SFBM_0986 SFBM_0642

bacteria group-specific primers

UniR514

12 12

928F-Firm

Firm1040R

12

5'-3' sequence

gene

ACTCCTACGGGAGGCAGCAGT

16S rDNA

ATTACCGCGGCTGCTGGC

(universal)

TGAAACTYAAAGGAATTGACG

16S rDNA

ACCATGCACCACCTGTC

(Firmicutes)

SC

UniF334

12

M AN U

name

RI PT

SFBSU_007G84

798cfbF

12

CRAACAGGATTAGATACCCT

16s rDNA

cfb967R

12

GGTAAGGTTCCTCGCGTAT

(Bacteroidetes)

TCGTCAGCTCGTGTYGTGA

16S rDNA

CGTAAGGGCCATGATG

(γ-Proteobact.)

1080γF

12

γ1202R

12

Act920F3

12

TACGGCCGCAAGGCTA

Act1200R

12

TCRTCCCCACCTTCCTCCG

(Actinobacteria)

En-lsu-3F

13

TGCCGTAACTTCGGGAGAAGGCA

23S rDNA

(Enterobacteriaceae)

Ecoli-F

CATGCCGCGTGTATGAAGAA

16S rDNA

Ecoli-R

14

CGGGTAACGTCAATGAGCAAA

(E. coli)

TE D

TCAAGGACCAGTGTTCAGTGTC

14

AC C

EP

En-lsu-3'R

13

16S rDNA

21

ACCEPTED MANUSCRIPT

Supplementary Table S16 Genes upregulated in SFBmono (GSE18348) 8 and Duoxa-/- mice (leading edge gene subset corresponding to left panel of Fig. 5D) up in SFB vs GF (>2.5 fold; p<0.05): leading-edge subset (core enrichment):

56 37

Rank in gene list

-/-

Duoxa vs wt

0

3.63

SAA1

2

2.47

IFIT2

5

1.99

HEMT1

11

1.84

SAA2

13

1.77

HK2

21

1.65

USP18

29

1.54

PLA2G5

33

CXCL9

50

SLC28A2

57

SMPDL3B

69

ZBP1

83

SLC6A14

98

SFB

mono

vs GF

0.09

13.15

0.15

126.35

0.19

11.78

0.23

6.06

0.27

12.96

0.31

3.82

0.33

3.30

1.52

0.36

3.95

1.45

0.39

3.18

1.41

0.41

3.82

1.39

0.43

5.11

1.36

0.45

6.73

1.34

0.47

21.29

1.33

0.49

3.69

1.33

0.51

6.61

M AN U

1600029D21RIK

Running ES

SC

Gene name

RI PT

# of genes mono

104

NOS2

107

IGTP

125

1.31

0.52

5.92

129

1.30

0.54

2.91

154

1.29

0.56

4.59

236

1.24

0.56

2.98

246

1.24

0.58

3.24

254

1.24

0.59

3.20

268

1.23

0.61

2.64

290

1.23

0.62

3.13

336

1.21

0.63

4.80

378

1.21

0.64

3.76

LY6D CCL28 STOM CEBPD GBP6 DMBT1 BHMT PTK6

AC C

NFKBIZ

EP

CASP4

TE D

TIFA

381

1.21

0.65

3.38

MPA2L

421

1.20

0.66

3.17

IIGP2

440

1.20

0.67

4.10

TGM2

454

1.19

0.68

3.06

SOCS3

593

1.18

0.68

4.52

MAL

642

1.17

0.69

4.26

UPP1

720

1.16

0.69

4.14

PSMB8

844

1.15

0.69

3.75

GZMB

858

1.15

0.70

9.68

TCRB-J

1090

1.14

0.69

2.60

CD38

1113

1.14

0.70

6.08

SERPINA3G

1180

1.13

0.70

2.88

22

ACCEPTED MANUSCRIPT

Supplementary Table S17 Genes downregulated in SFBmono (GSE18348) 8 and Duoxa-/- mice (leading edge gene subset corresponding to right panel of Fig. 5D) # of genes mono

Rank in gene list

-/-

Duoxa vs wt

Running ES

13782

0.59

SLC5A4B

13779

0.65

1300013J15RIK

13776

0.68

FMO5

13775

0.68

SLC7A8

13772

0.70

VMD2L1

13761

0.72

FABP1

13694

0.77

ACY1

13687

2810439F02RIK

13666

AQP7

13606

BC089597

13552

VWA1

13538

CYP3A11

13505

ARG2

13494

CYP2D26

13464

C1QDC2

13463

PLOD2

0.33

-0.06

0.35

-0.11

0.49

-0.16

0.34

-0.20

0.41

-0.24

0.41

-0.28

0.54

0.77

-0.31

0.51

0.78

-0.33

0.46

0.80

-0.36

0.36

0.81

-0.38

0.23

0.81

-0.40

0.51

0.82

-0.43

0.27

0.82

-0.45

0.46

0.82

-0.47

0.54

-0.49

0.52

0.83

-0.51

0.48

13165

0.85

-0.51

0.43

13019

0.86

-0.52

0.44

12989

0.86

-0.54

0.42

AC C

FBP1

vs GF

0.82

EP

DNMT2

mono

13423

TE D

SPSB4

SFB

0.00

SC

SLC5A4A

M AN U

Gene name

65 20

RI PT

down in SFB vs GF (>0.6 fold; p<0.05): leading-edge subset (core enrichment):

23

ACCEPTED MANUSCRIPT

Supplementary Table S18 Genes upregulated in B6-Jax cohoused with B6-Tac (GSE18348) 8 and in Duoxa-/- mice (leading edge gene subset corresponding to left panel of Fig. 5E)

-/-

Duoxa vs wt

Running ES

Jax(+Tac) vs Jax

Plet1

0

3.63

0.07

77.30

SAA1

2

2.47

0.12

28.04

RETNLB

4

2.06

UBD

10

1.85

HEMT1

11

1.84

SAA2

13

1.77

FUT2

20

HK2

21

SLFN4

24

PLA2G5

33

SAA3

40

CEACAM10

48

CXCL9

50

SMPDL3B

69

IIGP1

SC

Rank in gene list

M AN U

Gene name

RI PT

# of genes 71 46

up in Jax(+Tac) vs Jax (>2.5 fold; p<0.05): leading-edge subset (core enrichment):

0.16

46.51 5.21

0.23

19.74

0.26

11.07

1.66

0.29

13.80

1.65

0.32

5.15

1.60

0.34

2.66

1.52

0.36

10.10

1.49

0.39

3.06

1.45

0.41

3.10

1.45

0.43

3.58

1.39

0.44

2.96

79

1.38

0.46

2.55

83

1.36

0.48

3.08

86

1.36

0.50

2.89

98

1.34

0.51

3.24

104

1.33

0.53

4.33

107

1.33

0.54

8.23

116

1.32

0.56

4.33

117

1.32

0.57

8.79

154

1.29

0.58

3.69

161

1.29

0.60

2.70

SLC5A9

178

1.27

0.61

2.87

LY6A

183

1.27

0.62

3.43

CD177

225

1.25

0.63

4.63

STEAP1

243

1.24

0.64

4.85

STOM

246

1.24

0.65

4.18

CEBPD

254

1.24

0.66

3.44

DMBT1

290

1.23

0.67

3.17

BHMT

336

1.21

0.68

5.10

PTK6

381

1.21

0.69

2.61

TGM2

454

1.19

0.69

3.29

MUC4

473

1.19

0.70

2.60

SOCS3

593

1.18

0.70

8.16

ADM SLC6A14 TIFA NOS2 IGK-V32 TAT LY6D

AC C

MYL7

EP

ZBP1

TE D

0.20

24

ACCEPTED MANUSCRIPT

601

1.17

0.71

4.31

MAL

642

1.17

0.72

5.35

UPP1

720

1.16

0.72

2.65

AQP4

787

1.16

0.72

6.52

GZMB

858

1.15

0.72

3.83

CD38

1113

1.14

0.71

5.14

SERPINA3G

1180

1.13

0.71

3.27

PFKFB3

1196

1.13

0.72

6.41

RDH16

1198

1.13

0.73

2.66

CCND1

1243

1.13

0.73

2.56

AC C

EP

TE D

M AN U

SC

RI PT

IL18

25

ACCEPTED MANUSCRIPT

Supplementary Table S19 Genes downregulated in B6-Jax cohoused with B6-Tac (GSE18348) 8 and in Duoxa-/- mice

# of genes 141 70

down in Jax(+Tac) vs Jax (<0.5 fold; p<0.05): leading-edge subset (core enrichment): Rank in gene list

-/-

Duoxa vs wt

13787

0.56

SLC5A4A

13782

0.59

SLC5A4B

13779

0.65

1300013J15RIK

13776

0.68

FMO5

13775

0.68

PCK1

13774

0.68

TREH

13757

CYP27A1

13754

OPLAH

13726

CES1

13699

FABP1

13694

BMP8B

13693

METTL7A

13682

AI451617

13675

BC021608

Running ES

Jax(+Tac) vs Jax

0.00

0.37

-0.03

0.28

-0.06

0.44

-0.08

0.23

-0.10

0.21

-0.12

0.20

0.73

-0.14

0.42

0.73

-0.16

0.38

0.75

-0.17

0.44

0.76

-0.19

0.27

0.77

-0.20

0.34

0.77

-0.22

0.37

0.77

-0.23

0.35

0.78

-0.24

0.41

13673

-0.26

0.26

13666

0.78

-0.27

0.31

13660

0.79

-0.28

0.20

13627

0.79

-0.29

0.36

13606

0.80

-0.30

0.19

13561

0.81

-0.31

0.36

BC089597

13552

0.81

-0.32

0.44

13538

0.81

-0.33

0.30

13508

0.82

-0.34

0.30

13505

0.82

-0.35

0.05

13494

0.82

-0.36

0.22

SLC6A20A

13489

0.82

-0.37

0.26

SELENBP1

13465

0.82

-0.38

0.34

CYP2D26

13464

0.82

-0.39

0.18

C1QDC2

13463

0.82

-0.40

0.40

CAT

13434

0.83

-0.41

0.84

SPSB4

13423

0.83

-0.42

0.40

ABCC2

13390

0.83

-0.43

0.19

C920025E04RIK

13384

0.83

-0.44

0.31

OSBPL1A

13378

0.83

-0.45

0.43

SLC22A4

13369

0.84

-0.46

0.41

EPHX2

13335

0.84

-0.46

0.38

2810439F02RIK CUBN BST1 AQP7

VWA1 SLC5A11 ARG2

AC C

CYP3A11

EP

0.78

SULT1A1

TE D

M AN U

SUSD2

SC

Gene name

RI PT

(leading edge gene subset corresponding to right panel of Fig. 5E)

26

13330

0.84

-0.47

0.20

PDZK1

13258

0.84

-0.48

0.24

ALDH1A7

13229

0.85

-0.48

0.44

CML5

13209

0.85

-0.49

0.37

PLOD2

13165

0.85

-0.50

0.27

GPR172B

13156

0.85

-0.51

0.44

TSPAN5

13133

0.85

-0.51

0.39

CBR1

13096

0.86

-0.52

0.42

METTL7A

13026

0.86

-0.52

0.41

DNMT2

13019

0.86

-0.53

0.43

FBP1

12989

0.86

-0.54

0.29

EHHADH

12924

0.87

-0.54

0.41

TBC1D24

12893

0.87

-0.54

0.36

GUCA2B

12878

0.87

-0.55

0.39

TMEM43

12876

0.87

-0.56

0.41

TYKI

12851

0.87

-0.56

0.23

NR1D2

12834

0.87

-0.57

0.43

CYP4V3

12694

0.88

-0.57

0.18

HEXB

12653

0.88

-0.57

0.39

MME

12599

0.88

-0.57

0.14

AW491445

12459

0.89

-0.57

0.25

UGT2B5

12445

0.89

-0.58

0.25

PPARGC1A

12443

0.89

-0.58

0.29

RDH7

12413

0.89

-0.59

0.09

CYP3A44

12386

0.89

-0.59

0.32

HSD17B4

12378

0.89

-0.60

0.42

12284

0.89

-0.60

0.21

12183

0.90

-0.60

0.43

12051

0.90

-0.59

0.35

11983

0.90

-0.59

0.23

11886

0.91

-0.59

0.42

11827

0.91

-0.59

0.38

11803

0.91

-0.59

0.44

11795

0.91

-0.60

0.39

CYP4B1 APOC3 THRSP SLC5A6 MMP15

M AN U

AC C

0610009A07RIK

TE D

BMP1

EP

ANGPTL4

RI PT

CYP3A25

SC

ACCEPTED MANUSCRIPT

27

ACCEPTED MANUSCRIPT

Supplementary Table S20 Genes upregulated in cCD (Ref. 9, Tbl. S10) and Duoxa-/- mice (leading edge gene subset corresponding to upper panel of Fig. 6C)

-/-

Rank in gene list

Duoxa vs wt

Running ES

0

2.55

SAA1

1

2.47

0.04

IL1RL1

2

2.30

IFI44

6

1.87

SAA2

12

1.77

MMP3

13

S100A9

15

HK2

19

AREG

20

TLR2

23

S100A8

24

CXCL10

27

TLR4

29

CXCL1

SC

ST3GAL4

M AN U

Gene name

RI PT

# of genes 287 172 53

upregulated in cCD vs Ctrl: with expression data for mouse homolog: leading-edge subset (core enrichment):

cCD vs Ctrl 2.12 5.82

0.11

1.65

0.14

1.54

0.16

5.98

1.76

0.19

15.13

1.68

0.21

6.04

1.65

0.23

2.75

1.64

0.25

2.26

1.58

0.27

1.94

1.55

0.29

8.62

1.54

0.31

4.24

1.53

0.32

1.73

35

1.50

0.34

3.63

43

1.45

0.36

6.42

46

1.45

0.37

4.53

50

1.42

0.39

4.94

64

1.39

0.40

9.24

68

1.38

0.41

2.81

74

1.36

0.42

1.87

77

1.36

0.44

2.05

88

1.34

0.45

7.32

94

1.33

0.46

1.57

135

1.29

0.47

2.70

CD177

194

1.25

0.47

4.69

SLAMF7

203

1.24

0.48

1.88

CCL28

204

1.24

0.49

2.34

STEAP1

210

1.24

0.50

1.99

MTHFD2

222

1.24

0.51

1.63

DMBT1

244

1.23

0.51

2.16

MSR1

268

1.22

0.52

1.70

ADAMTS1

296

1.21

0.52

1.71

ANXA3

304

1.21

0.53

1.66

NFKBIZ

315

1.21

0.54

2.33

STEAP4

347

1.20

0.54

2.18

CXCL9 CXCL11 CXCL5 CA1 ZBP1 ADM SLC6A14 LY6D

AC C

TIFA

EP

IL1B

TE D

0.08

28

ACCEPTED MANUSCRIPT

374

1.19

0.55

1.89

MUC4

391

1.19

0.56

5.30

TNFRSF17

405

1.19

0.56

1.60

DUSP6

472

1.18

0.56

1.57

STAT1

542

1.17

0.56

2.36

CD274

548

1.17

0.57

2.31

GBP1

555

1.17

0.57

2.57

NPL

686

1.15

0.57

1.57

CH25H

723

1.15

0.57

1.71

PTGFR

724

1.15

0.58

1.52

CD86

772

1.15

0.58

1.62

CYP7B1

776

1.15

0.58

1.85

CCR1

782

1.15

0.59

1.73

MMP10

809

1.14

KCNE3

883

1.14

CD38

897

1.14

LCP2

918

1.13

GBP4

961

M AN U

SC

RI PT

TGM2

AC C

EP

TE D

1.13

29

0.59

9.42

0.59

1.70

0.60

1.76

0.60

1.50

0.60

1.91

ACCEPTED MANUSCRIPT

Supplementary Table S21 Genes downregulated in ileum of cCD patients 9 and Duoxa-/- mice (leading edge gene subset corresponding to lower panel of Fig. 6C)

Rank in gene list

Duoxa-/- vs wt

Running ES

11293

0.56

SLC2A2

11286

0.66

FMO5

11284

0.68

PCK1

11283

0.68

TREH

11268

0.73

PDK2

11267

0.73

HMGCS2

11261

XPNPEP2

11260

REEP6

11252

LEAP2

11232

ACE

11225

ESPN

11216

ACY1

11208

OSR2

11207

ANPEP

cCD vs Ctrl

0.00

0.34

-0.03

0.36

SC

SUSD2

M AN U

Gene name

RI PT

# of genes 285 163 72

downregulated in cCD vs Ctrl: with expression data for mouse homolog: leading-edge subset (core enrichment):

0.53

-0.08

0.36

-0.10

0.30

-0.12

0.62

0.73

-0.14

0.27

0.73

-0.15

0.26

0.75

-0.17

0.31

0.76

-0.19

0.44

0.76

-0.20

0.45

0.77

-0.22

0.57

0.77

-0.23

0.62

0.77

-0.25

0.60

11186

0.79

-0.26

0.48

11154

0.80

-0.27

0.63

11139

0.80

-0.28

0.55

11137

0.80

-0.30

0.31

11124

0.80

-0.31

0.59

11121

0.80

-0.32

0.60

11050

0.82

-0.33

0.33

11044

0.82

-0.34

0.67

11036

0.82

-0.35

0.36

11017

0.82

-0.36

0.57

10964

0.83

-0.37

0.36

SLC13A1

10919

0.84

-0.37

0.29

EPHX2

10898

0.84

-0.38

0.61

SULT2B1

10874

0.84

-0.39

0.50

GGT1

10871

0.84

-0.40

0.60

HTR1D

10863

0.84

-0.41

0.37

PDZK1

10832

0.84

-0.42

0.36

SOAT2

10820

0.85

-0.42

0.20

ABP1

10793

0.85

-0.43

0.58

SI

10745

0.85

-0.44

0.46

ABCG8

10732

0.85

-0.45

0.50

TM6SF2

10701

0.85

-0.45

0.36

CD8B AQP7 METTL7B DBP SLC5A11 SEMA6C SLC15A1 CYP2S1

AC C

SLC13A2

EP

AQP1

TE D

-0.06

30

10680

0.86

-0.46

0.40

SLC9A3R1

10677

0.86

-0.47

0.62

SLC39A4

10676

0.86

-0.48

0.53

BCAN

10668

0.86

-0.49

0.63

FBP1

10593

0.86

-0.49

0.49

DNASE1

10549

0.87

-0.49

0.39

ACOX2

10537

0.87

-0.50

0.57

ITIH3

10534

0.87

-0.51

0.31

KHK

10216

0.88

-0.49

0.38

GPD1

10195

0.88

-0.49

0.42

CHAD

10179

0.89

-0.50

0.45

SLC6A4

10168

0.89

-0.50

0.27

DAK

10158

0.89

-0.51

0.59

DPEP1

10007

0.89

CLDN15

9983

0.89

MLXIPL

9953

0.90

PKLR

9936

0.90

AMN

9892

GP2

9859

NPY

9855

APOC3

9742

PHYH

9734

SFRP5

9666

DGAT1

9578

C6

9536

KLKB1

SLC22A5 MEP1A FGFR3 RDH5 LCT NR1I3 HSD3B1

AC C

RGS11

SC

0.31

-0.51

0.53

-0.51

0.48

-0.52

0.30

0.90

-0.52

0.44

0.90

-0.52

0.39

0.90

-0.53

0.32

0.90

-0.53

0.23

0.90

-0.53

0.56

0.91

-0.53

0.24

0.91

-0.53

0.60

0.91

-0.53

0.21

9518

0.91

-0.53

0.52

9511

0.91

-0.54

0.37

9433

0.91

-0.54

0.47

9422

0.92

-0.54

0.58

9252

0.92

-0.53

0.50

9235

0.92

-0.53

0.65

9203

0.92

-0.54

0.64

9181

0.92

-0.54

0.19

9081

0.93

-0.54

0.42

9079

0.93

-0.54

0.30

9070

0.93

-0.54

0.59

TE D

ASPA

-0.50

EP

TM4SF5

RI PT

GAL3ST1

M AN U

ACCEPTED MANUSCRIPT

31