Infant Gut Microbiome Associated With Cognitive Development

Infant Gut Microbiome Associated With Cognitive Development

Accepted Manuscript Infant Gut Microbiome Associated with Cognitive Development Alexander L. Carlson, Kai Xia, M. Andrea Azcarate-Peril, Barbara D. Go...

6MB Sizes 34 Downloads 184 Views

Accepted Manuscript Infant Gut Microbiome Associated with Cognitive Development Alexander L. Carlson, Kai Xia, M. Andrea Azcarate-Peril, Barbara D. Goldman, Mihye Ahn, Martin A. Styner, Amanda L. Thompson, Xiujuan Geng, John H. Gilmore, Rebecca C. Knickmeyer PII:

S0006-3223(17)31720-1

DOI:

10.1016/j.biopsych.2017.06.021

Reference:

BPS 13249

To appear in:

Biological Psychiatry

Received Date: 21 November 2016 Revised Date:

31 May 2017

Accepted Date: 12 June 2017

Please cite this article as: Carlson A.L., Xia K., Azcarate-Peril M.A., Goldman B.D., Ahn M., Styner M.A., Thompson A.L., Geng X., Gilmore J.H. & Knickmeyer R.C., Infant Gut Microbiome Associated with Cognitive Development, Biological Psychiatry (2017), doi: 10.1016/j.biopsych.2017.06.021. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

TITLE PAGE

Short Title: Infant gut microbiome and cognition

RI PT

Title: Infant Gut Microbiome Associated with Cognitive Development

Authors: Alexander L. Carlson1, Kai Xia2, M. Andrea Azcarate-Peril3,4, Barbara D. Goldman5,6, Mihye Ahn7, Martin A. Styner2,8, Amanda L. Thompson9,10, Xiujuan Geng11,12, John H. Gilmore2, Rebecca C. Knickmeyer2*

SC

Affiliations: 1

Neuroscience Curriculum, University of North Carolina, Chapel Hill, NC, USA Department of Psychiatry, University of North Carolina, Chapel Hill, NC, USA 3 Department of Medicine, University of North Carolina, Chapel Hill, NC, USA 4 Microbiome Core Facility, University of North Carolina, Chapel Hill, NC, USA 5 Department of Psychology and Neuroscience, University of North Carolina, Chapel Hill, NC, USA 6 Frank Porter Graham Child Development Institute, University of North Carolina, Chapel Hill, NC, USA 7 Department of Mathematics and Statistics, University of Nevada, Reno, NV, USA 8 Department of Computer Science, University of North Carolina, Chapel Hill, NC, USA 9 Department of Anthropology, University of North Carolina, Chapel Hill, NC, USA 10 Department of Nutrition, University of North Carolina, Chapel Hill, NC, USA 11 Department of Psychology Lab of Neuropsychology and Lab of Social Cognitive Affective Neuroscience, University of Hong Kong, Hong Kong 12 State Key Lab of Brain and Cognitive Sciences, University of Hong Kong, Hong Kong

TE D

M AN U

2

AC C

EP

Correspondence to: Rebecca C. Knickmeyer, Department of Psychiatry, 343 Medical Wings C, Campus Box #7160, University of North Carolina, Chapel Hill NC 275997160, Email: [email protected] Key Words: microbiota, infant, cognition, gut, brain, MRI Abstract Word Count: 224 Text Word Count: 4000 Number of Figures: 5 Number of Tables: 1 Supplemental Information: 2 files Supplement 1: PDF file (contains all supplemental material except Table S3) Supplement 2: Excel file (contains Table S3 only)

Alexander L. Carlson

1

ACCEPTED MANUSCRIPT

ABSTRACT BACKGROUND: Studies in rodents provide compelling evidence that microorganisms

RI PT

inhabiting the gut influence neurodevelopment. In particular, experimental manipulations that alter intestinal microbiota impact exploratory and communicative behaviors and cognitive performance. In humans, the first years of life are a dynamic time in gut

colonization and brain development, but little is known about the relationship between

SC

these two processes. METHODS: We tested whether microbial composition at 1 year of age is associated with cognitive outcomes using the Mullen Scales of Early Learning and

M AN U

with global and regional brain volumes using structural MRI at 1 and 2 years of age. Fecal samples were collected from 89 typically developing one-year-old infants. 16S rRNA amplicon sequencing was used for identification and relative quantification of bacterial taxa. RESULTS: Cluster analysis identified 3 groups of infants defined by their

TE D

bacterial composition. Mullen scores at age 2 differed significantly between clusters. In addition, higher alpha diversity was associated with lower scores on the overall composite score, visual reception scale, and expressive language scale at age 2.

EP

Exploratory analyses of neuroimaging data suggest the gut microbiome has minimal effects on regional brain volumes 1 and 2 years of age. CONCLUSIONS: This is the first

AC C

study to demonstrate associations between the gut microbiota and cognition in human infants. As such, it represents an essential first step in translating animal data into the clinic.

Alexander L. Carlson

2

ACCEPTED MANUSCRIPT

TEXT INTRODUCTION

RI PT

The gut microbiome is a complex microbial ecosystem which varies between individuals and may be a key modulator of neurodevelopment through the microbiomegut-brain axis (1; 2). In rodents, experimental manipulations that alter the intestinal

microbiota impact anxiety and depression-related behaviors in a multiple well-established

SC

paradigms (3–6). Cognitive effects have also been reported (7; 8). Early development

appears to be of critical importance as bacterial colonization of germ-free mice does not

M AN U

normalize anxiety phenotypes at 10 weeks of age (9), but does normalize anxiety phenotypes at 3 weeks of age (10). Behavioral changes are accompanied by changes in neurochemistry, gene expression, dendritic morphology, and subcortical brain volumes (5; 10–15). In humans, altered microbial composition of the gut has been reported in

TE D

children with autism (16–18) and adults with depression (19; 20) and linked to childhood temperament (21) and adult cognition (22), but no studies have addressed when these relationships emerge or directly examined which brain regions may be involved.

EP

The first year of life is the foundational period for microbial colonization of the gut and the most rapid and dynamic phase of postnatal brain development. Gut

AC C

colonization is initially determined by method of delivery (23). Subsequently, the diversity of species within each individual (alpha diversity) increases rapidly as facultative aerobic Enterobacteriaceae give way to strict anaerobes, which are then displaced by a mixture of Clostridiales (24). Environmental factors influencing colonization include feeding practices (breast versus formula, introduction of solid foods etc.), day care attendance, illness, and exposure to antibiotics (25; 26). The microbiome is

Alexander L. Carlson

3

ACCEPTED MANUSCRIPT

also influenced by genetics with 8.8% of taxa showing heritability greater than 0.2 (27). All these factors contribute to significant inter-individual variation (28). While this dynamic progression is transpiring in the gut, several foundational processes are

RI PT

simultaneously occurring in the brain including the proliferation, migration, and

apoptosis of glia, myelination of axons, and synaptogenesis (29). These processes are

emergence of various cognitive functions.

SC

accompanied by dramatic changes in brain tissue volumes (30; 31) and the rapid

A relationship may exist between these two concurrent processes, but this has not

M AN U

been empirically demonstrated. In this prospective, longitudinal study, we tested if the 1year-old gut microbiome was associated with cognitive outcomes at 1 and 2 years of age. We hypothesized that infant gut microbiome samples would cluster into groups of community similarity and that cognitive ability would differ between clusters.

TE D

Specifically, we predicted that overall cognitive performance would be highest in clusters with an abundance of putatively beneficial microorganisms such as Lactobacillus (32) or Bacteroides (4). We also predicted that lower alpha diversity (indicating a less mature

EP

microbiome) would be correlated with lower cognitive performance given reports that low alpha diversity in infancy precedes negative health outcomes including type 1

AC C

diabetes (33) and asthma (34). We also conducted an exploratory analysis to examine whether composition of the gut microbiome at 1 year was associated with global and regional brain volumes assessed through structural magnetic resonance imaging at 1 and 2 years.

METHODS AND MATERIALS

Alexander L. Carlson

4

ACCEPTED MANUSCRIPT

Study Population We recruited 89 one-year-old infants (twins and singletons) from two prospective longitudinal studies of early brain development at the University of North Carolina at

RI PT

Chapel Hill (30; 31; 35; 36). Exclusion criteria for the parent studies included fetal

ultrasound abnormalities and major medical illness of the mother. Informed written

consent was obtained from the parent/legal guardian of each subject. This study was

SC

approved by the Institutional Review Board of the University of North Carolina at Chapel Hill.

M AN U

Microbiome Analysis

Parents collected approximately 200 mg of fecal material from a single diaper, placed it in a tube filled with Allprotect reagent (Valencia, CA), and returned it through overnight shipping. Once received, samples were stored at -80°C until analysis. 16S rRNA

TE D

amplicon sequencing of the V1-V2 gene region (37; 38) was performed on the Illumina MiSeq platform for identification and relative quantification of bacterial taxa as previously described (25; 39). Bioinformatics was performed with Quantitative Insights

EP

Into Microbial Ecology (QIIME) software (40). The de novo algorithm was used for OTU picking and chimeric sequences were removed with ChimeraSlayer. Taxonomic

AC C

assignment, alpha and beta diversity analysis were done via QIIME (41; 42). Clustering analysis was completed with distance metrics applied to the relative genus abundance from the 89 subjects with Partitioning Around Medoids as the clustering algorithm. Cluster scoring methods were used to assess the optimal number of clusters. See Supplementary Methods for details.

Alexander L. Carlson

5

ACCEPTED MANUSCRIPT

Genera Analysis and Co-occurrence Networks A modified Kruskal Wallis test for zero-inflated data (ZIKW) was applied to identify significant differences in relative genera abundance between clusters (FDR <

RI PT

5%). Permutation was used to ensure accurate p-values. To better understand the unique community dynamics of each cluster, we used one representative genera from each

cluster as a seed to generate co-occurrence networks via Spearman correlations. See

SC

Supplementary Methods for details. Cognitive Testing

M AN U

The Mullen consists of five separate Scales, with their own age-group standardized normative T-scores and percentiles, and an Early Learning (cognitive) Composite (ELC) similar to an IQ score or the Bayley MDI (43). The 5 Scales measure gross motor, fine motor, visual reception, expressive language, and receptive language

TE D

skills. The standardized T-scores of 4 scales (gross motor not included) are combined to create the ELC. The Mullen has good standardization and reliability data, with median internal consistency scores ranging between 0.75 and 0.91, and test-retest correlations

EP

over 0.82 for 1-25 months. Mullen data were collected over a period of three years by several experienced examiners who were blind to microbiome characteristics. All

AC C

cognitive data was screened for quality control and no data warranted exclusion from this study (see Supplementary Methods). This provided cognitive data for 86 subjects at 1 year of age and 69 subjects at 2 years of age. Structural Image Acquisition T1-weighted images were acquired on a Siemens head-only 3T TIM-Trio scanner (Siemens Medical System, Erlangen, Germany) during unsedated natural sleep (median

Alexander L. Carlson

6

ACCEPTED MANUSCRIPT

age at scan 1 = 12.8 months, median age at scan 2 = 25.1 months). Scan parameters at years 1 and 2 were as follows: MP-RAGE time repetition [TR] = 1900 ms, time echo [TE] = 3.74 ms, flip angle = 7°, image resolution = 1x1x1mm. A total of 38 infants at

RI PT

year 1 did not go to sleep or woke up in the scanner (success rate: 57%). A total of 61 infants at year 2 did not go to sleep, woke up in the scanner, or were lost to follow up (success rate: 31%).

SC

Image Analysis

Images were examined to exclude scans with motion and imaging artifacts (year 1

M AN U

n=3, year 2 n=1). Brain tissue was classified as gray matter, white matter, and cerebrospinal fluid using an atlas-moderated iterative expectation maximization segmentation algorithm with T1 images as previously described (30). Lateral ventricle volume was segmented using ITK-SNAP (44) as previously described (31). Gray matter

TE D

was parsed into 90 regions by non-linear warping of a neonatal adaptation of the AAL atlas template as previously described (31; 45). With these methods, we obtained measures of intracranial volume, total gray matter, total white matter, total cerebrospinal

EP

fluid, lateral ventricle volume, and 90-region gray matter volumes at 1 year of age for 46 subjects and at 2 years of age for 27 subjects.

AC C

Association of Cognitive and Brain Outcomes with Cluster Membership and Alpha Diversity

Linear mixed effect models were used to test for effects of cluster membership

and alpha diversity on cognitive performance and brain volumes as well as cluster membership on alpha diversity. Subjects with sensory deficits that would impede cognitive testing (n=2) or MRI abnormalities (n=1, gliosis, chronic venous ischemia)

Alexander L. Carlson

7

ACCEPTED MANUSCRIPT

were excluded from analyses. Likelihood ratio tests were used to test the significance of the coefficient of each cluster and alpha diversity measure. P-values of primary analyses were uncorrected while secondary analyses were adjusted for multiple comparisons using

RI PT

FDR. Sensitivity analyses were conducted to determine the effect of cluster independent of alpha diversity or alpha diversity independent of cluster by including either cluster membership or alpha diversity metrics as a covariate in the reciprocal analyses.

SC

Additional sensitivity analyses looked at change in Mullen scale raw scores from 1 to 2 years as well as 1-year performance in the subset of subjects with data at 2 years. Raw

M AN U

scores are better suited to longitudinal analyses as they are not age-adjusted while tscores are. Demographic and medical variables associated with cluster membership or alpha diversity and neuroimaging or cognitive outcomes were included as covariates (See Supplementary Methods for details).

TE D

Metagenome Prediction from PICRUSt

Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) was used to predict metagenome functional content from the 16S

EP

rRNA sequencing data (46). The PICRUSt pipeline was used to predict the abundance of Kyoto Encyclopedia of Genes and Genomes (KEGG) orthologs by subject at the KO and

AC C

collapsed KEGG pathway levels. This output was grouped by cluster and analyzed for group differences through Statistical Analysis of Taxonomic and Functional Profiles (STAMP) (47).

Alexander L. Carlson

8

ACCEPTED MANUSCRIPT

RESULTS Infant microbiota cluster into three groups

RI PT

There was modest support for clustering subjects into three groups based on

average silhouette width and Calinksi-Harabasz scoring (Figure 1a). The Jensen-Shannon distance metric scored highest for three groups and was used for subsequent analyses.

SC

Clusters differed in the abundance of many genera (Supplementary Table 1) with Cluster 1 characterized by relatively high abundance of Faecalibacterium, Cluster 2 by relatively

M AN U

high abundance of Bacteroides, and Cluster 3 by relatively high abundance of an unnamed genus in the family Ruminococcaceae. Co-occurrence networks show positive and negative correlations between different genera (Fig 1b). Identification of predictor covariates

TE D

Breastfeeding at time of sample collection (1 year), birth method, and paternal ethnicity were significantly different between clusters after FDR-correction (Table 1). Infants in C2 were more likely to be breastfed at 1 year of age and less likely to have

EP

been born via cesarean section. Paternal ethnicity in C2 was 90% white compared to C3 and C1 with 71% and 57% white respectively. Having older siblings was associated with

AC C

increased alpha diversity after FDR correction. Alpha diversity was increased in infants with Black or Asian paternal ethnicity and decreased in infants with Native American paternal ethnicity as compared to white paternal ethnicity (Supplementary Table 1). Cognitive abilities differ between clusters Our primary analysis focused on ELC scores at 1 and/or 2 years of age. Significant differences were observed at 2 years of age (n=69) with C2 showing the

Alexander L. Carlson

9

ACCEPTED MANUSCRIPT

highest performance and C1 showing the lowest performance (Figure 2a; p-value = 0.006). In order to determine how differences in ELC at 2 years of age related to specific functional domains, we performed secondary analyses testing whether the five individual

RI PT

Mullen Scales (gross motor, fine motor, visual reception, receptive language, and

expressive language) differed between clusters at 2 years of age. Receptive language and expressive language were significantly different between clusters after FDR correction

in Mullen outcomes between clusters at 1 year (n=86).

M AN U

Regional gray matter differences between clusters

SC

(Figure 2b, q-value = 0.005, q-value = 0.005). No significant differences were observed

We tested whether global and regional brain volumes differed between clusters at 1 and 2 years of age (n=46, n=27). At 1 year, the right superior occipital gyrus was largest in C2 and smallest in C3 (covariates: cesarean section, paternal ethnicity,

TE D

currently breastfeeding, total intracranial volume; q=0.037). At 2 years of age, the left and right caudate nucleus were smallest in C2 and largest in C3 (covariates: cesarean section, paternal ethnicity, currently breastfeeding, total intracranial volume; q=0.001,

EP

q=0.003). There were no differences in intracranial volume, total white matter, total gray matter, total cerebrospinal fluid, lateral ventricle volume, or other 90-region parcellation

AC C

volumes at 1 or 2 years of age.

Predicted metagenome of gut microbiota differs between clusters Group differences were observed in orthologs and functional categories between

clusters at each level of the collapsed KEGG pathways (Supplementary Table 3; q<0.05). As C2 showed the highest performance on the Mullen Scales, we were particularly interested in metabolic differences unique to this group. At level 2 of the KEGG

Alexander L. Carlson

10

ACCEPTED MANUSCRIPT

pathways, C2 had increased “Metabolism of Cofactors and Vitamins” as well as decreased “Cell Motility.” Within these categories, genes involved in metabolism of biotin, lipoic acid, folate, and ubiquinone and other terpenoid quinones were increased

RI PT

while genes involved in bacterial chemotaxis, flagellar assembly, bacterial motility proteins, and cytoskeleton proteins were decreased. Alpha diversity correlates with cognitive performance

SC

Four measures of alpha diversity, Chao1 (CH1), observed species (OS), Shannon Index (SI), and Faith’s Phylogenetic Diversity (FPD) were tested for associations with

M AN U

the ELC. At 2 years of age, the primary analysis showed a significant negative correlation of ELC with CH1, OS, FPD (Figure 3a; p=0.013, p=0.008, p=0.030). No significant associations were observed at 1 year of age. Secondary analysis of individual Mullen Scales at 2 years of age revealed a significant negative correlation of expressive

TE D

language with CH1 (q=0.002), OS (q=0.009), and FPD (q=0.016) and negative correlation of visual reception with CH1 (q=0.031), OS (q=0.016), and SI (q=0.038) after FDR correction (Figure 3b). Alpha diversity measures accounted for 5 to 23% of the

EP

variance in Mullen scores.

Alpha diversity associated with regional gray matter volumes at 2 years of age

AC C

Secondary analyses testing the association of alpha diversity metrics with brain

volumes at 1 and 2 years of age revealed three regions of significance at age 2 (covariates: older siblings, paternal ethnicity, total intracranial volume). These included the left precentral gyrus (CH1, q=0.025), left amygdala (OS, q=0.046), right angular gyrus (CH1, q=0.025), all with positive directionality. There were no associations with intracranial volume, total gray matter, total white matter, total cerebrospinal fluid, lateral

Alexander L. Carlson

11

ACCEPTED MANUSCRIPT

ventricle volume, or other regional volumes at 2 years of age after FDR correction. Similarly, no significant associations of alpha diversity metrics with 1-year brain volumes

Alpha diversity differs between clusters

RI PT

were observed after FDR correction.

Finally, we tested whether measures of alpha diversity differed between clusters. FPD, SI, OS, and CH1 were all significantly different between clusters with C1 showing

SC

the greatest alpha diversity and C2 showing the least (Fig. 4). Sensitivity Analyses

M AN U

We conducted analyses to determine if cluster membership or alpha diversity had the larger impact on outcomes by including either cluster or individual alpha diversity metrics as a covariate. Most notably, cognitive results of cluster analyses retained significance with CH1, FPD, and SI as covariates, but results were lost with OS (a

TE D

measurement of richness rather than evenness). ELC at 2 years of age was no longer significantly associated with alpha diversity when cluster was included as a covariate (Supplementary Table 4). A second sensitivity analysis assessed the change in Mullen

EP

performance between 1 and 2 years. This was done using raw scores (not age-adjusted) for GM, FM, VR, RL, and EL. Change in performance between 1 and 2 years of age was

AC C

significantly different between clusters for RL and EL (Figure 5, q=0.007, q=0.007). Finally, we performed an analysis of 1-year cognitive outcome by cluster in a subset of subjects also with data at 2 years (n=69) (Supplementary Figure 1). Results remained null in this group.

Alexander L. Carlson

12

ACCEPTED MANUSCRIPT

DISCUSSION There is increasing agreement from preclinical work that the gut microbiota

RI PT

influences brain development during a critical period in early life resulting in long-term changes in behavior. This is the first study to show that variation in the human gut

microbiome is associated with cognition in a cohort of typically developing infants

SC

during the hypothesized sensitive period. This study does not attempt to address a

causative role in the observed relationships, but is an important translational starting

M AN U

point.

Previous work suggests that the human gut microbiome achieves an adult-like state between one to three years of age (48; 49), but to our knowledge this is the first study to test whether distinct groups of subjects, defined by their bacterial composition,

TE D

are present at this age. In adults, several studies have supported the existence of three clusters (sometimes called enterotypes) characterized by the relative abundance of Bacteroides, Prevotella, and unclassified genera in the family Ruminococcaceae (50; 51)

EP

though there is ongoing debate as to whether individual variation is best described in terms of clusters or gradients (52). Our data suggest that at least two of the three

AC C

canonical adult enterotypes, those characterized by differentially increased abundance of Bacteroides and Ruminococcaceae, may already be present at 1 year of age. Alternatively, the clusters we observed may reflect differences in the developmental rate of the gut microbiome. In particular, the cluster with increased abundance of Bacteroides may reflect a subgroup of children with delayed maturation of the gut microbiome, given recent reports that the first two years of life are characterized by a succession of bacterial

Alexander L. Carlson

13

ACCEPTED MANUSCRIPT

taxa in which facultative aerobic Enterobacteriaceae give way to strict anaerobes, including Bacteroides, which are then displaced by a diverse mixture of Clostridiales including Ruminococcaceae, Faecalibacterium, and Lachnospira (24; 53).

RI PT

The environmental and genetic factors influencing cluster membership were not a primary focus of the current study, but we did investigate a number of potentially

important demographic, medical history, and feeding history variables. In keeping with

SC

the conceptualization of C2 as a less mature microbiome, children in C2 were more likely to be breastfed at the time of sample collection. Maturation into an adult-like microbiota

M AN U

is primarily determined by cessation of breast-feeding (49). Birth method was significantly different between clusters with C2 (high levels of Bacteroides) less likely to be born via cesarean section. This is in keeping with prior research showing that cesarean section is associated with reduced levels of Bacteroides shortly after birth as well as

TE D

increased levels of multiple taxa within phyla Firmicutes and Proteobacteria (24). Finally, there was an observed difference in paternal ethnicity between clusters. Maternal race/ethnicity has been previously associated with the infant microbiome (54; 55). This

EP

association could reflect both genetic and environmental factors associated with this sociocultural construct. Importantly, the associations we observed between cluster

AC C

membership and cognitive performance at age 2 were present when controlling for breastfeeding at 1 year, cesarean section, and paternal ethnicity. We did not observe any associations with antibiotic exposure during the first year of life or consumption of formula and other milks. Antibiotic exposure delays microbiota maturation (24), but in the current sample, any taxa suppressed by early antibiotic exposure appear to have rebounded by 1 year. Other factors that might influence cluster membership such as the

Alexander L. Carlson

14

ACCEPTED MANUSCRIPT

type and diversity of solid foods and prenatal stress were not measured in the current study, but would represent a valuable addition to future studies. Clusters at 1 year of age predicted cognitive performance at 2 years of age with

RI PT

C2 (high levels of Bacteroides) showing the highest level of performance (90th

percentile) and C1 (high levels of Faecalibacterium) showing the lowest level of

performance (72nd percentile), though no individuals scored in the cognitively impaired

SC

range (ELC < 70). Examination of the Mullen Scales demonstrated significant

differences in receptive language and expressive language, though a similar pattern of

M AN U

C2>C3>C1 was observed for the visual reception scale as well. It is likely that all three metrics contributed to the overall significant difference in ELC. The receptive language and expressive language findings may have relevance to disorders characterized by language impairments and delays. There are interesting parallels between our work and

TE D

studies in maternal immune activation (MIA) mouse models of neurodevelopmental disorders. MIA mice exhibit altered gut microbiota and decreased ultrasonic vocalizations. These vocalizations were restored through administration of Bacteroides

language group.

EP

fragilis (4), a member of the genus most prevalent in our high performing expressive

AC C

Alpha diversity at 1 year of age also predicted cognitive performance at 2 years of

age. Higher diversity was associated with poorer scores on the ELC, visual reception, and expressive language scales. This was somewhat surprising as high alpha diversity in infancy indicates a more mature, adult-like community and low alpha diversity in infancy is associated with negative health outcomes including type 1 diabetes (33) and asthma (34). It has been hypothesized that functional redundancy provided by a highly diverse

Alexander L. Carlson

15

ACCEPTED MANUSCRIPT

microbiome may allow individuals to better respond to environmental fluctuations, promoting intestinal homeostasis and maintaining human health (24). However, the notion that alpha diversity is always positive has been challenged recently as high alpha

RI PT

diversity has been found in adult subjects with major depressive disorder (19) and ASD (16). Our data add to this growing body of research which suggests increased diversity is not necessarily beneficial for neurocognitive or neuropsychiatric outcomes. Rather,

SC

higher diversity may mean less resources afforded to gut microbiota beneficially

impacting neurodevelopment. In addition, delayed maturation of the gut microbiome may

better cognitive performance.

M AN U

be associated with a prolonged period of cortical plasticity and maturation leading to

Analysis of the change in Mullen scores for receptive language and expressive language from 1 to 2 years of age were also significantly different between clusters. This

TE D

result suggests that the gut microbiome may influence the developmental trajectory of cognition. The contribution of the gut microbiome to cognition at 2 years of age may be a downstream consequence of the community’s influence on development at 1 year of

EP

age—possibly through changes in systemic immunity, circulating short chain fatty acids and other metabolites, including various neuroactive compounds, or neuromodulation via

AC C

vagal stimulation, all of which have been described in animal models (1). Alternative explanations for finding associations at 2 years, but not 1 year, include less accurate cognitive assessment at age 1 due to greater reliance on parental report or that scores at 1 year represent individual differences in maturational pace whereas scores at 2 may represent more persistent differences in cognitive ability.

Alexander L. Carlson

16

ACCEPTED MANUSCRIPT

PICRUSt analysis suggested mechanisms that might underlie microbial effects on neurodevelopment. In C2, there was increased predicted prevalence of genes related to the production of vitamins and cofactors (biotin, lipoic acid, folate, ubiquinone, other

RI PT

terpenoid quinones) while genes involved in pathogenicity (bacterial chemotaxis,

flagellar assembly, bacterial motility proteins, cytoskeleton proteins) were decreased.

The combination of increased neurodevelopmentally important metabolites like folate

SC

(56–58) and reduced pathogenic and inflammatory potential from gut commensals may play a role in the higher cognitive performance of C2. However, PICRUSt analysis is

M AN U

limited as it relies on predicted metagenomic information rather than direct measurement of gene expression. Results may be influenced by primer selection, orthology scheme, and reference genome (46).

In exploratory analyses of regional gray matter volumes, we observed several

TE D

significant associations with microbiome measures. However, these findings were anatomically distributed, mostly unilateral, and varied in direction of effect. Consequently, they should be treated with caution until replicated. Studies incorporating

EP

other neuroimaging phenotypes such as cortical thickness and surface area, diffusion tensor imaging (DTI), and functional connectivity or activation may provide additional

AC C

insights into the neural circuits mediating the microbiome’s impact on cognition. In conclusion, we have shown that microbial composition of the human gut at 1

year of age predicts cognitive performance at 2 years of age, particularly in the area of communicative behavior. Results may have implications for developmental disorders characterized by cognitive or language delay. Strengths of this study include its prospective design, focus on infancy, and incorporation of structural MRI. Limitations

Alexander L. Carlson

17

ACCEPTED MANUSCRIPT

include the following: 1. Microbiota were assessed at a single timepoint when the intake of solid foods varies significantly, potentially resulting in rapid shifts in the gut microbiome (49; 59). Longitudinal studies incorporating multiple measurements of the

RI PT

microbiota would address this limitation and help delineate temporal relationships

between microbial colonization and brain development in human infants. 2. This work took advantage of two ongoing prospective longitudinal studies of early brain

SC

development (30; 31; 35; 36). Consequently, the behavioral outcomes examined were not selected based on their potential relevance to the microbiome. In rodents, the most

M AN U

consistent behavioral alterations following manipulation of the gut microbiota are in the realm of anxiety and depression-related behaviors. Future studies ought to directly probe these domains. 3. Functional differences between clusters were inferred from marker gene data. Future studies using broad-spectrum metabolomics or transcriptomics would

TE D

yield more insight into mechanisms underlying the relationships we observed. Ultimately, with further research, it may become possible to guide the development of the gut

AC C

EP

microbiome through targeted interventions, thereby supporting cognitive development.

Alexander L. Carlson

18

ACCEPTED MANUSCRIPT

ACKNOWLEDGMENTS Jennifer Prater served as lead study coordinator with additional assistance from Dianne Evans and Wendy Neuheimer. Maggie Fox, Haley Parrish, Margo Williams, Mallory

RI PT

Turner, Emma Brink, Monica Ferenz, and Kassidy Jezierski at the FPG Child

Development Institute conducted Mullen Scales of Early Learning assessments. Joe Blocher & Rachel Steiner at the Neuro Image Research and Analysis Laboratories

SC

provided image analysis. We thank the families for their participation in this study. This study was supported by NIH Grants T32 NS007432, P30 DK34987, R01 HD053000,

Treatment of Mental Illness.

M AN U

U01 MH070890, R33 MH104330, and the Foundation of Hope for Research &

Author contributions: Conceptualization, J.H.G., X.G., A.L.T., and R.C.K.; Statistical

TE D

Analysis, K.X., M.A., and M.A.A.; Image analysis, M.A.S.; Behavior analysis: B.D.G.; Microbiome analysis, M.A.A.; Data Curation, A.L.C.; Writing – Original Draft, A.L.C.; Writing – Review & Editing, R.C.K., A.L.C., M.A.A., K.X., M.A., M.A.S., J.H.G., X.G.,

EP

A.L.T. and B.D.G.; Visualization, A.L.C. and K.X.; Supervision, J.H.G. and R.C.K.; Project Administration, A.L.C., and R.C.K.; Funding Acquisition, X.G., J.H.G., and

AC C

R.C.K.

Alexander L. Carlson

19

ACCEPTED MANUSCRIPT

FINANCIAL DISCLOSURES R.C.K is a co-investigator on a grant from Nestle/Wyeth entitled “Interrelationships of Nutrition, Gut Microbiota, as well as Brain & Cognitive Development in Early Life”. The

AC C

EP

TE D

M AN U

SC

RI PT

other authors declare no biomedical financial interests or potential conflicts of interest.

Alexander L. Carlson

20

ACCEPTED MANUSCRIPT

REFERENCES

RI PT

1. Sampson TR, Mazmanian SK (2015): Control of brain development, function, and behavior by the microbiome. Cell Host Microbe. 17: 565–576.

2. Cryan JF, Dinan TG (2012): Mind-altering microorganisms: the impact of the gut

SC

microbiota on brain and behaviour. Nat Rev Neurosci. 13: 701–12.

3. De Palma G, Blennerhassett P, Lu J, Deng Y, Park a. J, Green W, et al. (2015):

mice. Nat Commun. 6: 7735.

M AN U

Microbiota and host determinants of behavioural phenotype in maternally separated

4. Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T, et al. (2013): Microbiota modulate behavioral and physiological abnormalities associated with

TE D

neurodevelopmental disorders. Cell. 155: 1451–1463.

5. Diaz Heijtz R, Wang S, Anuar F, Qian Y, Björkholm B, Samuelsson A, et al. (2011): Normal gut microbiota modulates brain development and behavior. Pnas. 108:

EP

3047–3052.

6. Zheng P, Zeng B, Zhou C, Liu M, Fang Z, Xu X, et al. (2016): Gut microbiome

AC C

remodeling induces depressive-like behaviors through a pathway mediated by the host’s metabolism. Mol Psychiatry. 1–11. 7. Fröhlich EE, Farzi A, Mayerhofer R, Reichmann F, Jačan A, Wagner B, et al. (2016): Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication. Brain Behav Immun. . doi: 10.1016/j.bbi.2016.02.020.

Alexander L. Carlson

21

ACCEPTED MANUSCRIPT

8. Savignac HM, Tramullas M, Kiely B, Dinan TG, Cryan JF (2015): Bifidobacteria modulate cognitive processes in an anxious mouse strain. Behav Brain Res. 287: 59– 72.

RI PT

9. Neufeld K-AM, Kang N, Bienenstock J, Foster JA (2011): Effects of intestinal microbiota on anxiety-like behavior. Commun Integr Biol. 4: 492–4.

10. Clarke G, Grenham S, Scully P, Fitzgerald P, Moloney RD, Shanahan F, et al.

SC

(2012): The microbiome-gut-brain axis during early life regulates the hippocampal serotonergic system in a sex-dependent manner. Mol Psychiatry. 18: 1–8.

M AN U

11. Desbonnet L, Garrett L, Clarke G, Bienenstock J, Dinan TG (2008): The probiotic Bifidobacteria infantis: An assessment of potential antidepressant properties in the rat. J Psychiatr Res. 43: 164–174.

12. Neufeld KM, Kang N, Bienenstock J, Foster JA (2011): Reduced anxiety-like

Motil. 23: 255–265.

TE D

behavior and central neurochemical change in germ-free mice. Neurogastroenterol

13. Sudo N, Chida Y, Aiba Y, Sonoda J, Oyama N, Yu X-N, et al. (2004): Postnatal

EP

microbial colonization programs the hypothalamic–pituitary–adrenal system for stress response in mice. J Physiol. 5581: 263–275.

AC C

14. Bercik P, Denou E, Collins J, Jackson W, Lu J, Jury J, et al. (2011): The intestinal microbiota affect central levels of brain-derived neurotropic factor and behavior in mice. Gastroenterology. 141: 599–609. 15. Luczynski P, Whelan SO, O’Sullivan C, Clarke G, Shanahan F, Dinan TG, Cryan JF (2016): Adult microbiota-deficient mice have distinct dendritic morphological changes: Differential effects in the amygdala and hippocampus. Eur J Neurosci. 1–

Alexander L. Carlson

22

ACCEPTED MANUSCRIPT

13. 16. Finegold SM, Dowd SE, Gontcharova V, Liu C, Henley KE, Wolcott RD, et al.

Anaerobe. 16: 444–453.

RI PT

(2010): Pyrosequencing study of fecal microflora of autistic and control children.

17. Wang L, Christophersen CT, Sorich MJ, Gerber JP, Angley MT, Conlon M a (2013): Increased abundance of Sutterella spp. and Ruminococcus torques in feces of

SC

children with autism spectrum disorder. Mol Autism. 4: 42.

18. Tomova A, Husarova V, Lakatosova S, Bakos J, Vlkova B, Babinska K, Ostatnikova

M AN U

D (2015): Gastrointestinal microbiota in children with autism in Slovakia. Physiol Behav. 138: 179–187.

19. Jiang H, Ling Z, Zhang Y, Mao H, Ma Z, Yin Y, et al. (2015): Altered fecal microbiota composition in patients with major depressive disorder. Brain Behav

TE D

Immun. 48: 186–194.

20. Kleiman SC, Watson HJ, Bulik-Sullivan EC, Huh EY, Tarantino LM, Bulik CM, Carroll IM (2015): The Intestinal Microbiota in Acute Anorexia Nervosa and During

EP

Renourishment: Relationship to Depression, Anxiety, and Eating Disorder Psychopathology. Psychosom Med. 969–981.

AC C

21. Christian LM, Galley JD, Hade EM, Schoppe-Sullivan S, Kamp Dush C, Bailey MT (2015): Gut microbiome composition is associated with temperament during early childhood. Brain Behav Immun. 45: 118–127. 22. Fernandez-Real JM, Serino M, Blasco G, Puig J, Daunis-I-Estadella J, Ricart W, et al. (2015): Gut microbiota interacts with brain microstructure and function. J Clin Endocrinol Metab. 100: 4505–4513.

Alexander L. Carlson

23

ACCEPTED MANUSCRIPT

23. Madan JC, Hoen AG, Lundgren SN, Farzan SF, Cottingham KL, Morrison HG, et al. (2016): Association of Cesarean Delivery and Formula Supplementation With the Intestinal Microbiome of 6-Week-Old Infants. JAMA Pediatr. 170: 1–8.

RI PT

24. Bokulich NA, Chung J, Battaglia T, Henderson N, Jay M, Li H, et al. (2016):

Antibiotics, birth mode, and diet shape microbiome maturation during early life. Sci Transl Med. 8: 1–14.

SC

25. Thompson AL, Monteagudo-Mera A, Cadenas MB, Lampl ML, Azcarate-Peril MA (2015): Milk- and solid-feeding practices and daycare attendance are associated with

M AN U

differences in bacterial diversity, predominant communities, and metabolic and immune function of the infant gut microbiome. Front Cell Infect Microbiol. 5: 3. 26. Koenig JE, Spor A, Scalfone N, Fricker AD, Stombaugh J, Knight R, et al. (2011): Succession of microbial consortia in the developing infant gut microbiome. Proc

TE D

Natl Acad Sci U S A. 108 Suppl: 4578–4585.

27. Goodrich JK, Davenport ER, Beaumont M, Bell JT, Clark AG, Ley RE (2016): Genetic Determinants of the Gut Microbiome in UK Twins Correspondence. Cell

EP

Host Microbe. 19: 731–743.

28. Dogra S, Sakwinska O, Soh S-E, Ngom-Bru C, Brück WM, Berger B, et al. (2015):

AC C

Rate of establishing the gut microbiota in infancy has consequences for future health. Gut Microbes. 6: 321–5. 29. Stiles J, Jernigan TL (2010): The basics of brain development. Neuropsychol Rev. 20: 327–348.

30. Knickmeyer RC, Gouttard S, Kang C, Evans D, Wilber K, Smith JK, et al. (2008): A structural MRI study of human brain development from birth to 2 years. J Neurosci.

Alexander L. Carlson

24

ACCEPTED MANUSCRIPT

28: 12176–82. 31. Gilmore JH, Shi F, Woolson SL, Knickmeyer RC, Short SJ, Lin W, et al. (2012): Longitudinal development of cortical and subcortical gray matter from birth to 2

RI PT

years. Cereb Cortex. 22: 2478–2485.

32. Bravo JA, Forsythe P, Chew M V, Escaravage E, Savignac HM, Dinan TG, et al.

(2011): Ingestion of Lactobacillus strain regulates emotional behavior and central

SC

GABA receptor expression in a mouse via the vagus nerve. Proc Natl Acad Sci U S A. 108: 16050–5.

M AN U

33. Kostic ADD, Gevers D, Siljander H, Vatanen T, Hyötyläinen T, Hämäläinen A-M, et al. (2015): The Dynamics of the Human Infant Gut Microbiome in Development and in Progression toward Type 1 Diabetes. Cell Host Microbe. 17: 260–273. 34. Abrahamsson TR, Jakobsson HE, Andersson AF, Bj??rkst??n B, Engstrand L,

TE D

Jenmalm MC (2014): Low gut microbiota diversity in early infancy precedes asthma at school age. Clin Exp Allergy. 44: 842–850. 35. Gilmore JH, Lin W, Prastawa MW, Looney CB, Vetsa YSK, Knickmeyer RC, et al.

EP

(2007): Regional Gray Matter Growth, Sexual Dimorphism, and Cerebral Asymmetry in the Neonatal Brain. J Neurosci. 27: 1255–1260.

AC C

36. Gilmore JH, Schmitt JE, Knickmeyer RC, Smith JK, Lin W, Styner M, et al. (2010): Genetic and environmental contributions to neonatal brain structure: A twin study. Hum Brain Mapp. 31: 1174–1182. 37. Edwards U, Rogall T, Blöcker H, Emde M, Böttger EC (1989): Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 17: 7843–7853.

Alexander L. Carlson

25

ACCEPTED MANUSCRIPT

38. Fierer N, Hamady M, Lauber CL, Knight R (2008): The influence of sex, handedness, and washing on the diversity of hand surface bacteria. Proc Natl Acad Sci U S A. 105: 17994–9.

RI PT

39. Romano-Keeler J, Azcarate-Peril MA, Weitkamp J-H, Slaughter JC, McDonald WH, Meng S, et al. (2016): Oral colostrum priming shortens hospitalization without changing the immunomicrobial milieu. J Perinatol. 1–6.

SC

40. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. (2010): correspondence QIIME allows analysis of high- throughput community

M AN U

sequencing data Intensity normalization improves color calling in SOLiD sequencing. Nat Publ Gr. 7: 335–336.

41. Lozupone C, Knight R (2005): UniFrac : a New Phylogenetic Method for Comparing Microbial Communities. Appl Environ Microbiol. 71: 8228–8235.

TE D

42. Lozupone C, Hamady M, Knight R (2006): UniFrac-an online tool for comparing microbial community diversity in a phylogenetic context. BMC Bioinformatics. 7: 371.

EP

43. Mullen E (1995): Mullen Scales of Early Learning: AGS Edition, AGS. Circle Pines: American Guidance Service Inc.

AC C

44. Yushkevich PA, Piven J, Hazlett HC, Smith RG, Ho S, Gee JC, Gerig G (2006): User-guided 3D active contour segmentation of anatomical structures: Significantly improved efficiency and reliability. Neuroimage. 31: 1116–1128. 45. Shi F, Yap PT, Wu G, Jia H, Gilmore JH, Lin W, Shen D (2011): Infant brain atlases from neonates to 1- and 2-year-olds. PLoS One. 6. doi: 10.1371/journal.pone.0018746.

Alexander L. Carlson

26

ACCEPTED MANUSCRIPT

46. Langille M, Zaneveld J, Caporaso JG, McDonald D, Knights D, Reyes J, et al. (2013): Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat Biotechnol. 31: 814–21.

RI PT

47. Parks DH, Tyson GW, Hugenholtz P, Beiko RG (2014): STAMP: Statistical analysis of taxonomic and functional profiles. Bioinformatics. 30: 3123–3124.

48. Yatsunenko T, Rey FE, Manary MJ, Trehan I, Dominguez-Bello MG, Contreras M, et

SC

al. (2009): Human gut microbiome viewed across age and geography. Nature. 457: 222–227.

M AN U

49. Bäckhed F, Roswall J, Peng Y, Feng Q, Jia H, Kovatcheva-Datchary P, et al. (2015): Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe. 17: 690–703.

50. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. (2011):

TE D

Enterotypes of the human gut microbiome. Nat May. 12: 174–180. 51. Falony G, Joossens M, Vieira-Silva S, Wang J, Darzi Y, Faust K, et al. (2016): Population-level analysis of gut microbiome variation. Science (80- ). 352: 560–564.

EP

52. Knights D, Ward TL, McKinlay CE, Miller H, Gonzalez A, McDonald D, Knight R (2014): Rethinking enterotypes. Cell Host Microbe. 16: 433–437.

AC C

53. Planer JD, Peng Y, Kau AL, Blanton L V., Ndao IM, Tarr PI, et al. (2016): Development of the gut microbiota and mucosal IgA responses in twins and gnotobiotic mice. Nature. 534: 263–6. 54. Levin A, Sitarik A, Havstad S, Fujimura K, Wegienka G, Andrea C-B, et al. (2016): Joint effects of pregnancy, sociocultural, and environmental factors on early life gut microbiome structure and diversity. Sci Reports. 6: 31775.

Alexander L. Carlson

27

ACCEPTED MANUSCRIPT

55. Stearns JC, Zulyniak MA, de Souza RJ, Campbell NC, Fontes M, Shaikh M, et al. (2017): Ethnic and diet-related differences in the healthy infant microbiome. Genome Med. 9: 32.

RI PT

56. Chatzi L, Papadopoulou E, Koutra K, Roumeliotaki T, Georgiou V, Stratakis N, et al. (2012): Effect of high doses of folic acid supplementation in early pregnancy on

in Crete, Greece. Public Health Nutr. 15: 1728–1736.

SC

child neurodevelopment at 18 months of age: the mother–child cohort “Rhea” study

57. Julvez J, Fortuny J, Mendez M, Torrent M, Ribas-Fito N, Sunyer J (2009): Maternal

M AN U

use of folic acid supplements during pregnancy and four-year-old neurodevelopment in a population-based birth cohort. Paediatr Perinat Epidemiol. 23: 199–206. 58. Roza SJ, van Batenburg-Eddes T, Steegers E a P, Jaddoe VW V, Mackenbach JP, Hofman A, et al. (2010): Maternal folic acid supplement use in early pregnancy and

TE D

child behavioural problems: The Generation R Study. Br J Nutr. 103: 445–452. 59. De Meij TGJ, Budding AE, De Groot EFJ, Jansen FM, Kneepkens CMF, Benninga MA, et al. (2016): Composition and stability of intestinal microbiota of healthy

AC C

EP

children within a Dutch population. FASEB J. 30: 1512–1522.

Alexander L. Carlson

28

ACCEPTED MANUSCRIPT

FIGURE LEGENDS

SC

RI PT

Figure 1. Infant gut microbiome at 1 year of age clusters into three groups A. Distance metrics (unweighted Unifrac, weighted Unifrac, Jensen-Shannon, Root JensenShannon, Bray-Curtis) were scored with average silhouette width (SW), Calinski-Harabasz (CH), and prediction strength to identify the number of clusters with most support. Modest support for clustering into three groups was supported by SW and CH. B. (Top) Boxplots of genera selected as seed regions for co-occurrence networks. (Bottom) Co-occurrence networks show positive and negative correlations between different genera.

M AN U

Figure 2. Performance on Mullen Scales of Early Learning at 2 years of age differs between clusters A. Individual value plot showing performance on the Mullen Early Learning Composite by cluster (p-value = 0.006). B. Individual value plot showing secondary analysis of the Mullen Scale performance by cluster (receptive language q-value = 0.005, expressive language q-value = 0.005). Covariates for both analyses: cesarean section, paternal ethnicity, currently breastfeeding, sex, maternal education, paternal age, paternal ethnicity, twin status, income.

TE D

Figure 3. Alpha diversity is negatively correlated with cognitive scores at 2 years of age A. Plots of primary analysis, Early Learning Composite versus alpha diversity measures, show negative correlations. Covariates: older siblings, paternal ethnicity, sex, maternal education, paternal age, twin status, income B. Secondary analyses with the separate Mullen Scales show a negative association of expressive language with alpha diversity. Covariates: older siblings, paternal ethnicity, sex, maternal education, paternal age, twin status, income.

EP

Figure 4. Clusters differ by three measures of alpha diversity Individual value plots of Faith’s Phylogenetic Diversity, Shannon Index, Observed Species, and Chao1 by cluster. Covariates: cesarean section, paternal ethnicity, currently breastfeeding, older siblings.

AC C

Figure 5. Change in receptive language and expressive language scales from 1 to 2 years of age differs between clusters Plot of average raw scores by cluster from 1 to 2 years of age. (receptive language q=0.007, expressive language q=0.007) Covariates: sex, age at Mullen testing, maternal education, paternal education, paternal ethnicity, twin status, total household income, maternal psychiatric history

Alexander L. Carlson

29

ACCEPTED MANUSCRIPT

Table 1. Demographic characteristics of group and clusters

Sex NICU

Maternal Ethnicity

Paternal Ethnicity

Surgical Anesthesia Older Siblings Currently Breastfed

Currently Given Formula Given Milk Other Than Breastmilk or Formula

Type of Other Milk

Symptoms of Illness in Previous Week

2.2

0

60 23 5

67.4 25.8 5.6

30 20 3

Cluster 3 N % 10 58.8 3 17.6 3 17.6 1 5.9 7 41.2 10 58.8 2 11.8 15 88.2 13 76.5 4 23.5 11 64.7 6 35.3 10 58.8 7 41.2 5 29.4 12 70.6 12 70.6 3 17.6 0 0

0

0

0

2

11.8

56.6 37.7 5.7

17 1 0

89.5 5.3 0

13 2 2

76.5 11.8 11.8

1

1.1

0

0

1

5.3

0

0

5 84 42 47 32 57 64 25 19 70 77

5.6 94.4 47.2 52.8 36 64 71.9 28.1 21.3 78.7 86.5

2 51 32 21 14 39 40 13 11 42 47

3.8 96.2 60.4 39.6 26.4 73.6 75.5 24.5 20.8 79.2 88.7

1 18 4 15 14 5 9 10 3 16 15

5.3 94.7 21.1 78.9 73.7 26.3 47.4 52.6 15.8 84.2 78.9

2 15 6 11 4 14 15 2 5 12 15

11.8 88.2 35.3 64.7 23.5 76.5 88.2 11.8 29.4 70.6 88.2

No

12

13.5

6

11.3

4

21.1

2

11.8

12

13.5

6

11.3

4

21.1

2

11.8

72

80.9

45

84.9

15

78.9

12

70.6

AC C

Ever Given Formula

2

Cluster 2 N % 7 36.8 7 36.8 5 26.3 0 0 6 31.6 13 68.4 4 21.1 15 78.9 4 21.1 15 78.9 6 31.6 13 68.4 11 57.9 8 42.1 4 21.1 15 78.9 18 94.7 1 5.3 0 0

SC

Single or Twin Gestation

Cluster 1 % 41.5 24.5 28.3 5.7 20.8 79.2 9.4 90.6 50.9 49.1 56.6 43.3 52.8 47.2 18.9 81.1 67.9 28.3 3.8

M AN U

Cesarean Section

N 22 13 15 3 11 42 5 48 27 26 30 23 28 25 10 43 36 15 2

TE D

Maternal Psychiatric History Paternal Psychiatric History

Overall % 43.8 25.8 25.8 4.5 27 73 12.4 87.6 49.4 50.6 52.8 47.2 55.1 44.9 21.3 78.7 74.2 21.3 2.2

High Middle Low Not Available Yes No Yes No Yes No Twin Singleton Male Female Yes No White Black Asian Native American White Black Asian Native American Yes No Yes No Yes No Yes No Yes No Yes

EP

Income

N 39 23 23 4 24 65 11 78 44 45 47 42 49 40 19 70 66 19 2

RI PT

Descriptive Variable

Breastmilk Exclusively Cow's Milk Other (almond, soy) Yes

5

5.6

2

3.8

0

0

3

17.6

43

48.3

20

37.7

10

52.6

13

76.5

No

46

51.7

33

62.3

9

47.4

4

23.5

Yes

12

13.5

6

11.3

3

15.8

3

17.6

Gastrointestinal

Alexander L. Carlson

Q-Value 0.804

0.432 0.544 0.035* 0.432 0.956 0.841

0.190

0.049*

0.544 0.059 0.012* 0.071 0.558 0.934

0.432

0.059 0.804

30

ACCEPTED MANUSCRIPT

Symptoms in Previous Week Antibiotics within Last Year Antibiotics During Pregnancy

77

86.5

47

88.7

16

84.2

14

82.4

Yes No Yes No

30 59 17 72

33.7 66.3 19.1 80.9

15 38 10 43

28.3 71.7 18.9 81.1

8 11 3 16

42.1 57.9 15.8 84.2

7 10 4 13

41.2 58.8 23.5 76.5

N

Overall Mean ± SD

N

Cluster 1 Mean ± SD

N

89

263.72 ± 16.74

53

262.94 ± 15.72

19

268.32 ± 18.4

89

2917.31 ± 690.21

53

2885.09 ± 706.73

19

3129.47 ± 645.65

89

8.75 ± .79

53

8.87 ± 0.48

19

8.47 ± 1.39

89

31.9 ± 4.93

53

31.74 ± 5.08

19

30.95 ± 5.06

89

16.72 ± 2.61

53

16.62 ± 2.8

19

17.74 ± 2.33

89

34.06 ± 5.89

53

34.13 ± 6.06

19

33.53 ± 6.95

89

15.61 ± 3.4

53

15.43 ± 3.49

M AN U 19

16.56 ± 3.17

0.912

Cluster 3 Mean ± SD

17

261.00 ± 17.94

0.432

17

2780.65 ± 671.66

0.432

17

8.71 ± 0.59

0.316

17

33.47 ± 4.17

0.432

17

15.88 ± 1.93

0.432

17

34.42 ± 4.11

0.689

17

15.09 ± 3.37

0.432

RI PT

N

SC

Cluster 2 Mean ± SD

0.614

Q-Value

AC C

EP

TE D

Descriptive Variable Gestational Age at Birth (days) Birth Weight (grams) Apgar at 5 Minutes Maternal Age at Birth (years) Maternal Education (years) Paternal Age at Birth (years) Paternal Education (years)

No

Alexander L. Carlson

31

ACCEPTED MANUSCRIPT

TE D

M AN U

SC

RI PT

A.

AC C

EP

B.

EP

TE D

M AN U

SC

RI PT

B.

AC C

A.

ACCEPTED MANUSCRIPT

A.

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

B.

ACCEPTED MANUSCRIPT

225

125

q-value < 0.001

q-value < 0.001

115

150 125 100

105 95 85 75 65 55

M AN U

45

75

35 25

50 1

2 Cluster

3

EP

4.5 4

AC C

3.5 3 2.5 2

Faith’s Phylogenetic Diversity

TE D

5

1

2 Cluster

13

q-value = 0.020 5.5

Shannon Index

RI PT

Chao1

175

SC

Observed Species

200

3 q-value = 0.001

12 11 10 9 8 7 6 5 4

1

2 Cluster

3

1

2 Cluster

3

ACCEPTED MANUSCRIPT

Longitudinal Trajectory of Receptive Language Raw Score 30

q-value = 0.007 Cluster 1 Cluster 2

RI PT

Cluster 3

SC

Raw Score

25

M AN U

20

15

Year 1

Longitudinal Trajectory of Expressive Language Raw Score q-value = 0.007 Cluster 1 Cluster 2 Cluster 3

20

EP AC C

Raw Score

25

TE D

30

Year 2

15

Year 1

Year 2

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Infant Gut Microbiome Associated With Cognitive Development

RI PT

Supplement 1

Supplementary Methods and Materials DNA Isolation

SC

Participating families were provided with a sample collection kit that included 2 tubes (one for backup) each containing 1 ml Allprotect reagent (Valencia, CA). Parents were instructed to

M AN U

collect approximately 200mg of feces from a single soiled diaper, immediately place it in a tube completely submerged in reagent, and return through overnight mail (samples submerged in Allprotect can be stored up to 7 days at 15-25oC). Once received, the tubes were stored at -80°C until analysis. At the completion of the study, stool samples (200 mg) were transferred to sterile

TE D

2 ml tubes containing 200 mg of 212-300 μm glass beads (Sigma, St. Louis, MO) and 1.4 ml of Qiagen ASL buffer (Valencia, CA). Bead-beating was then carried out for 5 minutes in 1 minute intervals in a Qiagen TissueLyser II at 30Hz. Subsequently, samples were incubated at 95°C for

EP

5 minutes and centrifuged at 21000 x g for 5 minutes. To remove PCR inhibitors, supernatants were transferred to new 2 ml-tubes containing InhibiEx inhibitor adsorption tablets (Qiagen) and

AC C

vortexed vigorously. After a brief centrifugation, supernatants were aspirated and transferred to a new tube with Qiagen AL buffer containing Proteinase K (600IU/ μl). Samples were then incubated at 70°C for 10 minutes. DNA was purified using a standard on-column purification method with Qiagen buffers AW1 and AW2 as washing agents, and eluted in 10mM Tris (pH 8.0).

1

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

16S rRNA Amplicon Sequencing 12.5 ng of total DNA was amplified using a combination (4:1) of Universal and Bifidobacteriumspecific primers targeting the V1-V2 region of the bacterial 16S rRNA gene (1; 2); primer

RI PT

sequences contained overhang adapters appended to the 5’ end of each primer for compatibility with Illumina sequencing platform. The complete sequences of the primers were: 8F - 5’

SC

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGAGTTTGATCCTGGCTCAG3’ BifidoF- 5’

M AN U

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGGGTTCGATTCTGGCTCAG3’ 338R - 5’

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCCTCCCGTAGGAGT3’ Master mixes contained 12.5 ng of total DNA, 0.2 µM of each primer and 2x KAPA HiFi

TE D

HotStart ReadyMix (KAPA Biosystems, Wilmington, MA). The thermal profile for the amplification of each sample had an initial denaturing step at 95°C for 3 minutes, followed by a cycling of denaturing of 95°C for 30 seconds, annealing at 55°C for 30 seconds and a 30 second

EP

extension at 72°C (25 cycles), a 5-minute extension at 72°C and a final hold at 4°C. Each 16S amplicon was purified using the AMPure XP reagent (Beckman Coulter, Indianapolis, IN).

AC C

Next, each sample was amplified using a limited cycle PCR program, adding Illumina sequencing adapters and dual‐index barcodes (index 1(i7) and index 2(i5)) (Illumina, San Diego, CA) to the amplicon target. The thermal profile for the amplification of each sample had an initial denaturing step at 95°C for 3 minutes, followed by a denaturing cycle of 95°C for 30 seconds, annealing at 55°C for 30 seconds and a 30 second extension at 72°C (8 cycles), a 5minute extension at 72°C and a final hold at 4°C. The final libraries were again purified using

2

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

the AMPure XP reagent (Beckman Coulter), quantified and normalized prior to pooling. The DNA library pool was then denatured with NaOH, diluted with hybridization buffer and heat denatured before loading on the MiSeq reagent cartridge (Illumina) and on the MiSeq instrument

RI PT

(Illumina). Automated cluster generation and paired–end sequencing with dual reads were performed according to the manufacturer’s instructions.

SC

Sequencing Data Analysis

Multiplexed paired-end fastq files were produced from the sequencing results of the Illumina

M AN U

MiSeq using the Illumina software configureBclToFastq. The paired-end fastqs were joined into a single multiplexed, single-end fastq using the software tool fastq-join. Demultiplexing and quality filtering was performed on the joined results. Quality analysis reports were produced using the FastQC software. Bioinformatics analysis of bacterial 16S amplicon sequencing data

TE D

was conducted using the Quantitative Insights Into Microbial Ecology (QIIME) software (3). OTU picking was performed on the quality filtered results using pick_de_novo_otus.py. Chimeric sequences were detected and removed using ChimeraSlayer. Alpha and beta diversity

EP

analysis were performed on the data set using the QIIME routines: alpha_rarefaction.py and beta_diversity_through_plots.py (4; 5), respectively. Summary reports of taxonomic assignment

AC C

by sample and all categories were produced using QIIME summarize_taxa_through_plots.py and summarize_otu_by_cat.py.

Microbiota Clustering In order to identify groups of subjects with similar microbial communities, we applied various distance metrics including Jensen-Shannon distance (JSD), square root of JSD (rJSD),

3

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

unweighted UniFrac distance, weighted UniFrac distance and Bray-Curtis distance (BC) to the relative genus abundance in each individual. Both UniFracs were computed using QIIME, JSD, rJSD and BC were computed using R or R package phyloseq. Partitioning Around Medoids

RI PT

(PAM) was used as the clustering algorithm. Results were assessed for the optimal number of clusters using the Calinski-Harabasz (CH) Index, silhouette index (SI), and prediction strength (PS). We also evaluated the performance of the clustering by using between-class analysis

SC

through R package ade4 using JSD as input. The between-class analysis is a particular case of principal components analysis (PCA) with an instrumental variable. The between-class analysis

M AN U

enables us first to find the principal components based on the center of gravity of each group in a way to highlight differences between groups and then to link each sample with its group. The visualization plot of between-class analysis indicates the quality of clustering and the

TE D

homogeneity of the samples in each cluster.

Genera Analysis and Co-occurrence Networks A

modified

Kruskal

Wallis

test

for

zero-inflated

data

(ZIKW)

(http://www-

EP

stat.wharton.upenn.edu/~wanjiew/Testzero.pdf) was applied to identify significant differences in relative genera abundance between clusters. This method is designed to adjust for excessive

AC C

zeros in the data and has higher statistical power compared to standard rank-based tests making it ideal for microbiome analysis. We corrected for multiple comparisons using BenjaminiHochberg false discovery rate (FDR < 5%). Due to the relatively small sample size, a permuted method was used to obtain more accurate p-values. To better understand the unique community dynamics of the 1 year microbiome, we used one representative genera from each cluster as a seed to generate co-occurrence networks. To be selected as a seed, the following criteria had to

4

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

be met: 1) the genus must show a significant difference between clusters after FDR correction, 2) the genus must have a median relative abundance value above 0.01 in at least 1 cluster, and 3) the median value for that genus must be higher in the cluster it represents than in the other 2

RI PT

clusters. Where multiple genera met these criteria, the one with the highest test statistic was selected. Spearman correlations were computed between Faecalibacterium (representing Cluster 1), Bacteroides (representing Cluster 2), and an unnamed genus of Ruminococcaceae

SC

(representing Cluster 3) and all other genera. Absolute correlations above 0.3 transformed into connections between two genera in the co-occurrence genera network. Genera with less than 1%

M AN U

abundance were removed from the networks. The Cytoscape (6) package was used to generate the network figures with a spring-based layout.

Quality Control for Cognitive Testing

TE D

Given the potential challenges of cognitively assessing 1 and 2 year olds, quality control is very important. Cognitive testing staff members are well-versed in testing materials and highly skilled in handling and engaging infants and toddlers for sessions that run from 30 to 60 minutes. The

EP

goal is to obtain data that are representative of the child’s potential. Parents are asked about the representativeness of their child’s behavior during the assessment, and testing staff record their

AC C

impressions of the child’s state following the assessment to note if there are concerns about the representativeness of scores. Staff and research interns review the videos of these sessions and systematically score 8 behavioral dimensions on a 4-point scale for each of the 5 Mullen Scales. The dimensions include levels of overall alertness, focused attention, freedom from apprehension, freedom from negative affect, cooperativeness, persistence, flexibility, and

5

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

enthusiasm. These ratings are then used to make decisions about what performance data may be compromised, necessitating exclusion from data analyses.

RI PT

Predictor Covariate Identification

Relevant variables were created based on literature review of important factors that may influence early gut microbiome development. In order to identify environmental variables that

SC

could act as confounders due to their association with cluster membership or alpha diversity, we generated contingency tables with the Fisher Exact Test for categorical variables and performed

M AN U

linear mixed effect model (LMM) for continuous variables (see Table 1 and Supplementary Table S1). Binary categorical variables were filtered by requiring at least a 5% frequency in the study population. The p-values of both the Fisher’s Exact Test and LMM were combined and corrected for multiple comparisons using FDR. Variables with q-values less than 0.05 were used

TE D

as covariates in the subsequent predictive models for cluster or alpha diversity analyses. The following is a list of variables assessed and how they were created: income (subjects were stratified into low (<200% federal poverty level), middle (200%-400% federal poverty level),

EP

high (>400% federal poverty level), or not told groups based on the reported household income and federal poverty level for the household size at the year of visit), maternal & paternal

AC C

psychiatric history (binary variable created for self-report or medical record positive for psychiatric history of schizophrenia spectrum disorder, bipolar disorder, depressive disorder, anxiety disorder, obsessive-compulsive disorder, attention-deficit/hyperactivity disorder, Tourette’s syndrome, or autism spectrum disorders), cesarean section (medical record review), single or twin gestation (medical record review), sex (medical record review), >24hr stay in neonatal intensive care (medical record review), maternal ethnicity (parental report), paternal

6

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

ethnicity (parental report), surgical anesthesia (medical record review), older siblings (parental report and medical record review), currently breastfeeding (parental report), ever given formula (parental report), currently given formula (parental report), given milk other than breastmilk or

RI PT

formula (parental report), type of other milk (such as almond, soy, coconut from parental report), symptoms of illness in previous week (parental report), gastrointestinal symptoms in previous week (parental report), antibiotics within last year (binary variable created from parental report

SC

and medical record review where oral antibiotics count as a positive finding), antibiotics during pregnancy (medical record review), gestational age at birth (medical record review), birth weight

M AN U

(medical record review), Apgar at 5 minutes (medical record review), maternal age at birth (parental report), maternal education (parental report), paternal age at birth (parental report), paternal education (parental report).

TE D

Covariate Identification for Outcome Variables

As part of the larger parent studies, a moment-based method (7; 8) to select fixed effects in linear mixed effects models was used to identify important covariates for global brain volumes (1 year

EP

n=526, 2 year n=375), regional brain volumes (1 year n=526, 2 year n=375), Mullen scores (1 year n=820, 2 year n=681), and longitudinal Mullen scores from 1 to 2 years (n=618). A list of

AC C

potential predictors was considered that included sex, birth weight, twin status, delivery method, Apgar score at 5 minutes, gestational age at birth, stay in neonatal intensive care unit for more than 24 hours, Chiari I malformation, mild ventriculomegaly, major infection from birth to 1 year, major infection from 1 to 2 years, surgical anesthesia from birth to 1 year, surgical anesthesia from 1 to 2 years, age at 1 year MRI/2 year MRI/1 year Mullen/2 year Mullen, maternal education, paternal education, maternal age, paternal age, maternal ethnicity, paternal

7

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

ethnicity, maternal psychiatric history, paternal psychiatric history, maternal smoking during pregnancy, total household income. For fixed effects selection, an adaptive Lasso penalty using the feasible generalized least squares estimator as an initial was applied. The BIC statistic was

RI PT

used to select the tuning parameter of the adaptive Lasso. Twins were treated as repeated measures. Before applying our variable selection method, all covariates were standardized and the response variable was centered. Bootstrap methods were applied 1000 times to assess the

SC

stability of the results. Variables were included as covariates for global volumes if they were selected more than 800 times for at least one volume. Variables were included as covariates for

M AN U

regional volumes if they were selected more than 800 times for at least 5% of ROIs. Variables were included as covariates for single time point Mullen cognitive outcomes and longitudinal Mullen outcomes from 1 to 2 years if they were selected more than 800 times for at least 5% of

TE D

cognitive metrics.

Covariates:

EP

1 Year Global Brain Volumes: birth weight, sex, age at 1 year MRI, twin status, maternal education, paternal education 2 Year Global Brain Volumes: age at 2 year MRI, sex, birth weight, paternal education

AC C

1 Year Regional Brain Volumes: Intracranial Volume 2 Year Regional Brain Volumes: Intracranial Volume

1 Year T-Score Mullen Outcomes: Age at Mullen Testing 2 Year T-Score Mullen Outcomes: sex, maternal education, paternal age, paternal ethnicity, twin status, income

8

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

1-2 Year Difference Raw Score Mullen Outcomes: sex, age at Mullen testing, maternal education, paternal education, paternal ethnicity, twin status, total household income, maternal psychiatric history

RI PT

Cluster: Cesarean section, paternal ethnicity, currently breastfeeding

AC C

EP

TE D

M AN U

SC

Alpha Diversity: Paternal ethnicity, older siblings

9

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Supplementary Table S1. Modified Kruskal Wallis test for zero-inflated data to test for significant differences in relative genera abundance between clusters.

1.87E-05 0.0004 0.0071 0.0513 0.0007 9.99E-06 0.0002 0.0053

0.0001 0.0007 0.0160 0.0638 0.0010 0.0001 0.0005 0.1493

0 0.0004 0.0085 0.1022 0.0042 1.29E-05 0.0002 0.0240

EP

AC C

statistic

pval

qvala

86.82 79.54 78.20 77.89 70.24 66.33 64.27 63.52 52.01 50.93 47.20 41.69 41.11 39.85 38.61 38.55 33.20 31.45 30.33 28.96 26.94 25.89 23.60 22.92 22.49 22.03 21.26

0.0000 0.0000 0.0000 0.0000 0.0000 0.0005 0.0003 0.0009 0.0028 0.0039 0.0531 0.0753 0.1491 0.1716 0.1990 0.0204 0.1291 0.4951 0.5223 0.5952 0.1038 0.3609 0.8206 0.2235 0.6597 0.8865 0.8945

0.0000 0.0000 0.0000 0.0000 0.0000 0.0038 0.0027 0.0060 0.0165 0.0207 0.2147 0.2661 0.4331 0.4331 0.4794 0.0983 0.4025 0.9545 0.9545 0.9998 0.3438 0.7970 0.9998 0.5150 0.9998 0.9998 0.9998

20.95 20.61 19.65 19.35 19.15 18.58 16.13 15.94

0.1686 0.8617 0.9267 0.9368 0.9490 0.4651 0.9582 0.9782

0.4331 0.9998 0.9998 0.9998 0.9998 0.9481 0.9998 0.9998

RI PT

cluster3 median 0.0014 0.0033 0.0545 0.0063 0.0342 0.0368 0.0132 0.0024 2.00E-05 2.00E-05 0.0107 0.0001 0.0035 0.0078 0.0419 5.70E-06 1.46E-05 0.0004 0.0085 0.0621 1.79E-05 0.0001 0.0040 3.14E-05 0.0001 0.0102 0.0007

M AN U

SC

cluster2 median 0.5046 0.0008 0.0004 2.10E-05 0.0018 0.0029 0.0002 0.0010 1.31E-05 6.49E-06 4.76E-05 3.90E-05 0.0005 0.0008 0.0037 5.89E-06 1.18E-05 0.0001 0.0076 0.0150 2.67E-05 0.0003 0.0063 4.20E-05 0.0001 0.0030 0.0010

TE D

Bacteroides Clostridiales;f_;g Faecalibacterium Ruminococcaceae;Other Ruminococcaceae;g Clostridiales;Other;Other Lachnospira Ruminococcus Rikenellaceae;g Collinsella Coprococcus Dialister Clostridiaceae;g Dorea Blautia Lactococcus Parabacteroides Prevotella Oscillospira Lachnospiraceae;Other Megamonas Enterococcus Streptococcus Fusobacterium Clostridiaceae;Other Sutterella Unassigned;Other;Other;Other;Other; Other Enterobacteriaceae;Other Coriobacteriaceae;Other Bifidobacterium Lachnospiraceae;g [Eubacterium] Lactobacillus Haemophilus Veillonella

cluster1 median 0.3739 0.0076 0.1555 0.0015 0.0218 0.0297 0.0208 0.0029 0.0015 0.0006 0.0042 0.0003 0.0012 0.0021 0.0152 0.0001 0.0001 0.0001 0.0074 0.0323 1.83E-05 4.16E-05 0.0055 1.67E-05 0.0002 0.0001 0.0007

10

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

0 0.0097 0.0219 0 0 2.00E-05 0 0 1.47E-05 0 0 0 0

statistic

pval

qvala

15.60 15.29 14.96 14.89 13.13

0.0360 0.9853 0.9865 0.1621 0.6232

0.1590 0.9998 0.9998 0.4331 0.9998

11.49 10.21 7.18 6.86 6.26 5.93 4.21 3.83 3.16 2.98 1.97 0.50 0.40

0.0567 0.9994 0.9998 0.6224 0.4412 0.9708 0.5198 0.8577 0.9647 0.6934 0.6076 0.9568 0.9216

0.2147 0.9998 0.9998 0.9998 0.9353 0.9998 0.9545 0.9998 0.9998 0.9998 0.9998 0.9998 0.9998

AC C

EP

TE D

M AN U

Christensenellaceae;g 0 Clostridium 0.0015 [Ruminococcus] 0.0084 Acidaminococcus 0 RF32;f_;g 0 Megasphaera 9.15E-06 Dysgonomonas 0 Phascolarctobacterium 0 Epulopiscium 0 S24-7;g 0 Burkholderiales;Other;Other 0 Catenibacterium 0 [Prevotella] 0 a Gray cells are significant post FDR correction

cluster3 median 0 0.0016 0.0068 0 6.36E-06

RI PT

Paraprevotella Enterobacteriaceae;g Erysipelotrichaceae;g Bilophila Akkermansia

cluster2 median 0 0.0021 0.0033 0 8.6170E06 0 0.0042 0.0305 0 0 3.87E-05 0 0 4.79E-06 0 0 0 0

SC

cluster1 median 0 0.0012 0.0025 0 1.57E-05

11

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Supplementary Table S2. Alpha Diversity Covariate Identification, q-values Faith's Phylogenetic Diversity beta q-valuea Income

Shannon Index beta

0.83

Observed Species beta q-value

q-value 0.39

Chao1 beta

0.42

0.47

-0.46

-0.29

-8.64

-13.74

Mid

-0.27

-0.10

-4.66

-5.90

Not Told

-0.19

0.02

-5.96

-0.26

0.88

0.08

0.98

1.03

Paternal Psychiatric History

-0.22

0.88

-0.27

0.70

Cesarean Section

0.09

0.88

-0.01

Twin Gestation

0.67

0.42

Sex

0.01

NICU

0.13

12.33

0.47

-4.65

0.68

-7.88

0.80

0.98

2.53

0.68

-2.03

0.86

0.31

0.29

0.97

0.15

0.73

0.88

0.25

0.70

0.88

Black

0.25

Asian

0.17

Native American

0.28

Paternal Ethnicity Asian

0.69

Native American

-0.43

TE D

0.59

Surgical Anesthesia

0.06

10.95

0.47

1.13

0.81

1.77

0.86

4.53

0.68

-2.09

0.86

0.84

0.34

0.45

0.13

8.37

13.66

0.14

12.76

24.62

0.21

8.56

11.66

0.60

Black

11.52

M AN U

Maternal Ethnicity

0.81

SC

-0.09

RI PT

High

Maternal Psychiatric History

q-value

0.29

0.05

0.04

0.26

12.26

17.60

0.55

21.83

39.35

0.41

-4.32

-18.43

-0.46

0.88

-0.15

0.98

-4.78

0.68

-15.02

0.75

1.12

0.01

0.38

0.14

11.60

0.06

16.60

0.27

-0.79

0.06

-0.26

0.39

-11.05

0.06

-14.45

0.38

0.51

0.80

0.16

0.73

6.84

0.42

9.27

0.72

0.14

0.88

0.00

0.98

-2.82

0.68

-3.88

0.85

Given Milk Other Than Breastmilk or Formula Type of Other Milk

0.39

0.88

0.08

0.98

5.78

0.68

9.63

0.79

0.16

0.88

0.02

0.98

2.08

0.75

2.34

0.86

Symptoms of Illness in Previous Week Gastrointestinal Symptoms in Previous Week Antibiotics within Last Year

-0.16

0.88

0.01

0.98

-2.10

0.68

-7.03

0.77

-0.08

0.88

-0.30

0.39

-9.08

0.24

-6.86

0.80

-0.30

0.80

-0.36

0.14

-5.61

0.39

-9.96

0.47

Antibiotics During Pregnancy

0.41

0.88

-0.05

0.98

4.94

0.68

6.05

0.80

Gestational Age at Birth

-0.01

0.80

0.00

0.73

-0.20

0.42

-0.20

0.79

Birth Weight

0.00

0.88

0.00

0.87

0.00

0.68

0.00

0.80

APGAR5

-0.04

0.88

-0.02

0.98

-1.49

0.68

2.94

0.80

Maternal Age

-0.04

0.83

-0.02

0.73

-0.34

0.68

-0.41

0.80

Maternal Education

0.01

0.95

-0.01

0.98

-0.50

0.68

-0.78

0.80

Older Siblings Currently Breastfed

AC C

Currently Given Formula

EP

Ever Given Formula

12

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Faith's Phylogenetic Diversity beta q-valuea

Shannon Index beta

q-value

Observed Species beta q-value

Chao1 beta

q-value

Paternal Age

0.01

0.88

0.00

0.98

0.20

0.68

-0.10

0.87

Paternal Education

-0.03

0.88

-0.01

0.98

-0.89

0.45

-0.31

0.86

EP

TE D

M AN U

SC

RI PT

Gray cells are significant post FDR correction

AC C

a

13

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Supplementary Table S3. PICRUSt analysis results. 3a. KEGG Ortholog differences between clusters; 3b. KEGG L3 pathway differences between clusters; 3c. KEGG L2 pathway differences between clusters; 3d - KEGG L1 pathway differences between clusters.

AC C

EP

TE D

M AN U

SC

RI PT

Please note: due to its large size, Supplementary Table S3 is provided as a separate, multisheet Excel file.

14

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Supplementary Table S4. Sensitivity analyses controlling for cluster or alpha diversity in reciprocal analyses.

Cluster w/OS Covariate

Cluster w/SI Covariate

Cluster w/FPD Covariate

ELC (1yr)

0.766

0.711

0.841

0.615

GM (1yr)

0.803

0.821

0.858

0.791

FM (1yr)

0.803

0.821

0.858

0.791

VR (1yr)

0.803

0.821

RL (1yr)

0.803

0.821

EL (1yr)

0.952

0.961

ELC (2yr)

0.026

0.051

GM (2yr)

1.000

0.642

FM (2yr)

0.722

0.536

VR (2yr)

1.000

1.000

RL (2yr)

0.041

0.071

EL (2yr)

0.041

M AN U

SC

Cluster w/CH1 Covariate

TE D

RI PT

Change in Cluster P/Q-Values with Alpha Diversity as Covariate

EP

0.071

0.858

0.791

0.858

0.791

0.979

0.847

0.006

0.026

0.931

0.273

0.931

0.273

1.000

0.212

0.004

0.035

0.004

0.035

Change in Alpha Diversity P/Q Values with Cluster as Covariate OS w/Cluster Covariate

SI w/Cluster Covariate

FPD w/Cluster Covariate

ELC (1yr)

0.806

0.359

0.347

0.246

GM (1yr)

0.981

0.768

0.768

0.788

FM (1yr)

0.981

0.868

0.768

0.669

VR (1yr)

0.768

0.981

0.981

0.967

RL (1yr)

0.367

0.177

0.170

0.040

EL (1yr)

0.669

0.669

0.669

0.367

ELC (2yr)

0.072

0.082

0.983

0.155

AC C

CH1 w/Cluster Covariate

15

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

OS w/Cluster Covariate

SI w/Cluster Covariate

FPD w/Cluster Covariate

GM (2yr)

0.597

0.597

0.783

0.222

FM (2yr)

0.295

0.155

0.783

0.047

VR (2yr)

0.047

0.047

0.047

0.134

RL (2yr)

0.597

0.783

0.783

0.783

EL (2yr)

0.019

0.047

0.576

0.060

RI PT

CH1 w/Cluster Covariate

AC C

EP

TE D

M AN U

SC

No Change Loss of significance Gain of significance

16

ACCEPTED MANUSCRIPT Supplement

TE D

M AN U

SC

RI PT

Carlson et al.

AC C

EP

Supplementary Figure S1. Performance on Mullen Scales of Early Learning at 1 year of age does not differ between clusters in the subset (N=69) of infants with 2 year data. A. Individual value plot showing performance on the Mullen Early Learning Composite by cluster. B. Individual value plot showing secondary analysis of the Mullen Scale performance by cluster. Covariates for both analyses: cesarean section, paternal ethnicity, currently breastfeeding, age at Mullen testing.

17

ACCEPTED MANUSCRIPT Carlson et al.

Supplement

Supplementary References

RI PT

1. Edwards U, Rogall T, Blöcker H, Emde M, Böttger EC (1989): Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 17: 7843–7853. 2. Fierer N, Hamady M, Lauber CL, Knight R (2008): The influence of sex, handedness, and washing on the diversity of hand surface bacteria. Proc Natl Acad Sci U S A. 105: 17994–9.

SC

3. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. (2010): correspondence QIIME allows analysis of high- throughput community sequencing data Intensity normalization improves color calling in SOLiD sequencing. Nat Publ Gr. 7: 335–336.

M AN U

4. Lozupone C, Knight R (2005): UniFrac : a New Phylogenetic Method for Comparing Microbial Communities. Appl Environ Microbiol. 71: 8228–8235. 5. Lozupone C, Hamady M, Knight R (2006): UniFrac-an online tool for comparing microbial community diversity in a phylogenetic context. BMC Bioinformatics. 7: 371.

TE D

6. Christmas, Rowan; Avila-Campillo, Iliana; Bolouri, Hamid; Schwikowski, Benno; Anderson, Mark; Kelley, Ryan; Landys, Nerius; Workman, Chris; Ideker, Trey; Cerami, Ethan; Sheridan, Rob; Bader, Gary D.; Sander C (2005): Cytoscape: a software environment for integrated models of biomolecular interaction networks. Am Assoc Cancer Res Educ B. 12– 16. 7. Ahn M, Zhang HH, Lu W (2012): Moment-based Method for Random Effects Selection in Linear Mixed Models. Stat Sin. 22: 1539–1562.

AC C

EP

8. Knickmeyer RC, Xia K, Lu Z, Ahn M, Jha SC, Zou F, et al. (2016): Impact of Demographic and Obstetric Factors on Infant Brain Volumes: A Population Neuroscience Study. Cereb Cortex. 1–10.

18

ACCEPTED MANUSCRIPT

Supplementary Table S3a - KEGG Ortholog differences between clusters

qvalue 7.46152E-05 6.34616E-05 -0.000150025 8.62544E-05 -0.000140101 -1.40668E-06 1.18768E-06 9.95398E-08 -0.000153665 6.86541E-07 4.34161E-05 3.30742E-05 -0.000184622 -1.87564E-06 -3.92187E-06 -0.000163076 -5.61378E-06 4.65294E-06 2.63476E-05 -1.21897E-05 -0.000157472 1.29578E-05 9.4895E-07 -5.54314E-06 -0.000354045 -0.000151302 5.58672E-05 0.000164149 3.55328E-05 4.27497E-06 -9.80761E-07 -1.99953E-06 -3.18922E-06 -1.74093E-06 -1.7408E-06 -2.76036E-06 -1.74089E-06 4.31722E-06 -8.5005E-06 0.00048376 1.13464E-05 -2.13814E-06 0.000257327 -0.000322913 -1.29223E-06 0.000157882 3.30904E-05 -1.18564E-06 -1.79316E-06 -0.000148901 0.000175508 -2.16273E-06 0.000230866 0.000154198 0.00018551 -0.000151056 6.22267E-06 0.000161186 0.00016172 0.00015937 -0.000157233 -0.000166315 0.000163475 0.000161982 0.000161562 8.61103E-05

RI PT

M AN U

EP

AC C

beta C3 0.00021832 0.000228985 0.000137581 0.000234738 0.00019026 8.13581E-05 7.22099E-05 6.62544E-05 0.000106136 6.83577E-05 0.000167045 0.00011366 0.000154049 0.000137384 0.000136275 0.000113603 7.85088E-05 7.39584E-05 0.000109464 0.000185498 0.000104084 9.95389E-05 6.55459E-05 7.15148E-05 0.000181001 0.000116308 0.000118691 -0.000187985 0.0001108 7.8137E-05 7.62084E-05 7.51706E-05 7.49891E-05 7.47215E-05 7.4721E-05 7.67571E-05 7.47219E-05 8.31572E-05 6.88447E-05 -0.000194984 6.57483E-05 7.05901E-05 -0.000351388 0.000288298 7.19497E-05 -0.000149207 0.000111693 7.57201E-05 7.13375E-05 5.11811E-05 -0.000181638 7.10681E-05 -2.70123E-05 -0.000134222 -0.000175642 6.74317E-05 8.2423E-05 -0.000145121 -0.000114769 -0.000169681 4.01752E-05 8.73256E-05 -0.000141418 -0.000141913 -0.000142048 -0.000186004

SC

beta C2 9.249E-05 0.000100327 0.000219947 9.85976E-05 0.000297879 1.38008E-05 9.70681E-06 9.35114E-06 0.000195749 9.53058E-06 6.10423E-05 4.33251E-05 0.000239531 2.00652E-05 2.78929E-05 0.00023117 2.23596E-05 1.72502E-05 4.87472E-05 4.31982E-05 0.00021442 3.32048E-05 1.07519E-05 1.60129E-05 0.00042839 0.000219338 5.32833E-05 0.000619709 3.84051E-05 2.1372E-05 1.39403E-05 1.41584E-05 1.54248E-05 1.4651E-05 1.46506E-05 1.54872E-05 1.46509E-05 2.59297E-05 1.56327E-05 0.001294768 1.80685E-05 1.21767E-05 0.000976489 0.000524321 1.44311E-05 0.000453011 5.39235E-05 1.8416E-05 1.80977E-05 0.000204723 0.00118096 1.85125E-05 0.000524831 0.000440635 0.000466254 0.000224363 2.92151E-05 0.000448892 0.00042021 0.000529731 0.000206085 0.000239313 0.000452105 0.000452016 0.000451901 0.000432343

TE D

X.Intercept. K01643 K01644 K03313 K01011 K01673 K00122 K08989 K10094 K01057 K09477 K06726 K06956 K07588 K07326 K03404 K03322 K00261 K03855 K00824 K03319 K11065 K01646 K09162 K04086 K01847 K08590 K01007 K07238 K00772 K13256 K09771 K11709 K03638 K11707 K11708 K08680 K11710 K00313 K00370 K04758 K00086 K00015 K00620 K02548 K11719 K06923 K00366 K12982 K01906 K00036 K04759 K01601 K10112 K00805 K07003 K00033 K04744 K06398 K06399 K06179 K08156 K00426 K06407 K06406 K06379 K04070

4.50108E-11 4.50108E-11 4.50108E-11 6.40678E-11 6.40678E-11 7.61534E-11 8.10211E-11 9.87674E-11 1.30575E-10 1.31162E-10 1.47445E-10 1.48624E-10 1.64133E-10 3.51415E-10 5.14634E-10 5.14634E-10 5.14634E-10 5.17245E-10 1.25723E-09 1.3012E-09 1.33939E-09 1.89796E-09 2.0061E-09 2.29754E-09 2.43668E-09 2.43668E-09 2.43668E-09 3.60237E-09 4.18538E-09 4.18538E-09 4.55592E-09 5.01795E-09 5.02063E-09 5.51094E-09 5.51094E-09 5.51094E-09 5.51094E-09 5.7837E-09 5.89227E-09 6.4365E-09 6.4365E-09 6.58931E-09 6.58931E-09 6.74884E-09 6.74884E-09 6.74884E-09 6.74884E-09 7.04241E-09 7.93519E-09 7.93519E-09 7.93519E-09 8.10906E-09 8.71348E-09 9.57197E-09 1.07462E-08 1.14286E-08 1.21694E-08 1.22941E-08 1.31828E-08 1.35806E-08 1.59375E-08 1.67864E-08 1.89089E-08 2.01848E-08 2.08179E-08 2.12111E-08

TE D

0.000123856 -0.000304797 -0.000159937 0.000109269 -4.52023E-05 2.67192E-06 -1.92388E-05 -0.000101843 -1.46719E-05 -0.000150139 8.19214E-05 0.00031695 4.49512E-05 6.61115E-06 -0.00016359 -5.49857E-05 0.000153588 -0.000158689 -0.000164383 -7.87337E-07 -0.000157554 -0.000161607 -0.000159127 -0.000286886 0.000102656 0.000159701 -1.34904E-06 0.000480885 0.000151073 0.000132413 0.000192465 0.000140647 1.1477E-05 2.25409E-05 5.35902E-05 0.000599775 -0.000166506 8.77451E-06 -0.000160792 -0.000155519 0.000139028 -0.000138127 -0.000153598 -0.000157165 -0.000150112 -0.00015779 -3.55466E-06 -0.000271566 -0.000177726 -5.51975E-05 1.39274E-05 0.000138952 -0.000268739 0.000213123 -8.6995E-07 -4.2526E-05 -0.000397021 0.00015361 -0.000315313 0.000234406 0.000250069 -0.00015607 -1.81275E-05 0.000324984 -0.000156684 -0.000162028 0.000223592 -0.000163431 2.82025E-05

SC

M AN U

0.000253118 4.87906E-05 0.00015295 0.000156005 7.6862E-05 -0.00014491 0.000216681 -0.000150597 8.99443E-05 6.46029E-05 -0.000253854 0.000131238 7.83742E-05 3.09174E-05 -0.00025044 -0.000145373 3.22658E-05 7.38732E-06 0.000111865 3.56665E-05 2.8379E-05 3.46371E-05 7.99864E-05 -0.000229391 -0.000164045 8.65886E-05 -0.000409468 -0.000142692 -0.000102267 0.000465944 -0.00012487 8.95166E-05 -0.000196159 -0.000198606 -0.000488015 2.61467E-05 7.59766E-05 0.000108878 3.40836E-05 -0.000139466 7.30178E-05 8.91806E-05 3.34142E-05 8.98158E-05 6.55222E-05 7.26924E-05 0.000182347 1.23842E-05 0.000163772 7.81031E-05 9.44663E-05 0.000112785 -0.000321783 -0.000106422 0.000187641 9.4819E-05 -8.18669E-05 5.29313E-05 -0.00032372 0.000142416 3.34229E-05 0.000107006 -0.000228794 3.16634E-05 2.70981E-05 -0.000160206 2.47582E-05 0.000104962

RI PT

ACCEPTED MANUSCRIPT -0.00020954

EP

0.0004726 0.000549803 0.000212077 0.000139921 0.000109356 1.81335E-05 0.000679639 0.000342179 0.000723978 0.000222545 6.65414E-05 0.000934692 8.01493E-05 2.92413E-05 0.000184052 0.000639567 0.000446447 0.000196327 0.000188401 3.69875E-05 0.000181639 0.000190551 0.000182759 0.000353285 0.001071002 0.001248199 3.01043E-05 0.001507505 0.000443381 0.000364378 0.000542902 0.000462488 3.27501E-05 0.000328864 0.000977745 0.001861834 0.000191539 2.44986E-05 0.000265046 0.000187656 0.000475739 0.000169245 0.000239859 0.000183555 0.000232077 0.000246633 2.16035E-05 0.00074264 0.000217891 0.000345933 2.26605E-05 0.000123273 0.000369469 0.00086855 0.000709446 0.000473528 0.000442321 0.000293835 0.000396608 0.001064711 0.000613392 0.00019354 6.24851E-05 0.001458629 0.0001749 0.000192781 0.000647123 0.000209062 8.8563E-05

AC C

K02226 K03183 K00818 K01751 K08223 K02552 K01006 K03386 K00849 K00970 K06408 K06023 K03273 K06929 K02169 K07301 K06390 K03558 K01580 K13498 K13694 K01422 K01241 K07322 K03324 K00384 K00364 K07258 K06392 K09779 K00852 K01963 K05786 K09768 K00700 K03091 K03473 K09800 K03587 K00860 K03151 K08325 K00425 K07735 K02551 K01079 K08161 K11717 K00259 K01163 K06193 K00042 K00265 K02315 K03695 K03699 K03287 K06334 K01089 K04487 K06901 K06076 K07459 K03308 K01573 K03113 K08384 K04518 K01692

2.35647E-08 2.97969E-08 2.97988E-08 2.97988E-08 3.11319E-08 3.32737E-08 3.32737E-08 3.46796E-08 3.50395E-08 3.78914E-08 3.88896E-08 3.97698E-08 3.99921E-08 4.13898E-08 4.19597E-08 4.30306E-08 4.30306E-08 4.55394E-08 4.66106E-08 4.68883E-08 4.78003E-08 4.78747E-08 4.78747E-08 4.81824E-08 4.81824E-08 4.81824E-08 4.81824E-08 5.29906E-08 5.52505E-08 5.80413E-08 5.8319E-08 6.05704E-08 6.05704E-08 6.05704E-08 6.46063E-08 6.46063E-08 7.46916E-08 7.46916E-08 7.80225E-08 7.80225E-08 7.80225E-08 8.0248E-08 8.06353E-08 8.19475E-08 9.69152E-08 9.94701E-08 1.02448E-07 1.02448E-07 1.02983E-07 1.02983E-07 1.08404E-07 1.0992E-07 1.12787E-07 1.18328E-07 1.18328E-07 1.18382E-07 1.20682E-07 1.20727E-07 1.40216E-07 1.40567E-07 1.44204E-07 1.53343E-07 1.53532E-07 1.61558E-07 1.61877E-07 1.61877E-07 1.62263E-07 1.66181E-07 1.66181E-07

TE D

-0.000167154 3.53617E-07 -0.000237583 -0.000254214 2.06788E-05 0.000126636 -1.20184E-05 -0.000303518 2.22341E-05 0.000552008 7.56969E-05 -0.000296323 -0.000117447 0.000439167 0.000229622 -0.000159944 -0.000157155 -0.0003049 -0.000132194 -0.000307145 0.000146772 -0.000161144 -0.000156917 -0.000158401 0.000107891 7.92804E-05 5.78803E-05 0.000214155 -0.000113194 1.66129E-06 0.000486782 0.00016654 -0.000431567 3.24058E-05 -0.000677058 -0.000542263 -0.000145308 9.88672E-05 -0.000183458 0.000176186 -3.68437E-05 0.000274726 0.000133993 0.000141512 -0.00015509 0.000458016 -0.000133202 0.00026091 -9.54989E-06 -9.63158E-06 -9.63837E-06 -0.00016851 0.00029799 0.000198287 0.00013976 0.000155247 0.00014028 -0.000250941 0.000130067 0.000191523 0.000263087 -5.56148E-06 -0.000208169 1.29058E-05 -0.000166029 -0.000320602 -0.000148091 -5.52598E-05 0.000253847

SC

M AN U

7.72203E-05 1.37567E-05 0.000137999 8.97854E-05 -0.000138549 8.8561E-05 1.36677E-05 9.97759E-05 0.000173101 0.000149079 0.00017678 0.000141049 0.000106696 -0.000173978 1.38025E-05 3.1442E-05 6.10073E-05 8.34502E-05 3.85973E-05 -0.000118125 3.2757E-05 3.00192E-05 0.000106464 -0.000127087 0.000119285 0.000168606 -0.000105728 0.000125498 7.90532E-05 -0.000230116 -8.4052E-05 8.61252E-05 0.000119842 4.5121E-05 2.07492E-05 5.03766E-05 -0.000193953 4.71038E-05 -4.27644E-05 9.87108E-05 -0.000179061 -0.00012737 -8.07813E-05 2.8601E-05 -0.000305162 0.000107841 7.07981E-05 6.43775E-05 6.43176E-05 6.43186E-05 1.62962E-05 -0.000269426 1.80478E-06 -0.000104385 -0.000148257 -9.46351E-05 -1.38283E-05 -0.00012521 -7.61244E-05 1.62588E-05 -0.00021556 0.000130258 8.88326E-05 2.39037E-05 3.46417E-06 8.47996E-05 0.000185392 3.8128E-05

RI PT

ACCEPTED MANUSCRIPT 3.50338E-06

EP

0.000945577 2.34929E-05 0.000828917 0.000383319 5.1016E-05 0.000451168 2.96933E-05 0.00033909 3.04797E-05 0.001452506 7.91041E-05 0.000554771 0.000236033 0.000997885 0.000549022 0.000174227 0.000193824 0.000366776 0.000177195 0.000349676 0.00039807 0.000184994 0.000201947 0.000282752 0.000329606 0.000116941 0.000121954 0.000457221 0.000239966 2.24711E-05 0.001233848 0.000351417 0.000516559 9.96234E-05 0.000808829 0.000671249 0.000220242 0.001120404 0.000188537 0.000495134 5.96948E-05 0.000893381 0.000438341 0.000331538 0.000185774 0.001366161 0.000212919 0.000370739 2.23796E-05 2.23661E-05 2.23733E-05 0.000197103 0.001605987 0.000291764 0.0004103 0.000489717 0.000491813 0.00037568 0.000431627 0.00058517 0.000426405 0.00081534 0.000328299 4.92366E-05 0.00019132 0.000417292 0.000250627 0.000161774 0.000599286

AC C

K03424 K01746 K07566 K02484 K01958 K07015 K08567 K07713 K09698 K00936 K10709 K02342 K07220 K02049 K03660 K09789 K06194 K12340 K00782 K02481 K07576 K01850 K03474 K09014 K06387 K12527 K03271 K06412 K03306 K05311 K00975 K04769 K05595 K01271 K07085 K02429 K09015 K07137 K05340 K00027 K00156 K07007 K06378 K06397 K00281 K00974 K00940 K10118 K00374 K00371 K00373 K03801 K03310 K06333 K06012 K07699 K00878 K02377 K06405 K13292 K10119 K00703 K06911 K06962 K09011 K00024 K01633 K04047 K05799

1.73166E-07 1.73166E-07 1.73166E-07 1.73166E-07 1.73166E-07 1.73166E-07 1.73713E-07 1.77515E-07 1.78131E-07 1.78131E-07 1.81808E-07 1.83821E-07 1.85172E-07 1.85627E-07 1.85627E-07 1.87472E-07 1.93788E-07 2.08734E-07 2.18171E-07 2.18171E-07 2.18171E-07 2.24273E-07 2.29006E-07 2.29006E-07 2.32772E-07 2.37069E-07 2.37301E-07 2.44993E-07 2.44993E-07 2.46282E-07 2.4692E-07 2.56361E-07 2.62074E-07 2.62074E-07 2.62074E-07 2.62074E-07 2.62074E-07 2.75011E-07 2.98339E-07 3.04737E-07 3.04737E-07 3.04737E-07 3.12387E-07 3.13034E-07 3.46849E-07 3.53467E-07 3.5575E-07 3.72288E-07 3.72816E-07 3.72866E-07 3.72866E-07 3.80137E-07 3.82274E-07 3.87384E-07 3.88582E-07 3.93263E-07 4.07171E-07 4.07171E-07 4.10062E-07 4.159E-07 4.25143E-07 4.26655E-07 4.38627E-07 4.39186E-07 4.39186E-07 4.39638E-07 4.39692E-07 4.4314E-07 4.47328E-07

TE D

0.000154215 -0.00017083 0.000207773 -1.39892E-06 0.000115734 -0.000134586 -0.000164761 -3.23967E-06 -0.000144287 -0.000108537 -0.000483973 -2.15652E-05 -3.20019E-05 -2.96272E-06 -0.000361671 0.001058517 -2.9767E-06 -0.000171334 0.000143457 7.51687E-06 -0.000327731 4.40068E-06 -4.77533E-06 4.7224E-05 -0.000297365 -0.000207248 0.000162087 0.000220126 -3.98978E-05 -0.000277014 0.001999983 -0.000142686 -0.000125621 -0.000297376 3.87173E-05 -0.000170386 0.000125819 -0.000383999 0.000132736 -8.23242E-05 0.000343398 0.000380058 0.000285956 0.00016412 -0.00014229 -8.83896E-05 6.96973E-06 -0.000165621 -0.000128593 0.000208015 -0.00014289 0.000128192 -0.000153944 -0.000256874 -0.000146478 1.57169E-05 0.000157572 0.000295445 4.14117E-05 7.10275E-05 0.001885914 4.88923E-05 -0.000380995 -0.000545234 1.22154E-05 -0.000147491 -0.000112463 -3.68755E-05 -0.000132849

SC

M AN U

0.000152145 0.000145035 4.40658E-05 -0.000122182 5.80408E-05 2.51199E-05 6.53863E-05 3.26241E-05 0.000380238 -0.000156077 -0.00020864 0.00018102 6.58778E-05 0.000105231 -0.000451433 6.56996E-05 -2.93989E-06 -0.000135062 7.43908E-05 0.000132242 0.000260203 7.09995E-05 7.17736E-05 5.2314E-05 0.000138272 -0.000126223 -5.80545E-05 0.000100225 9.76151E-05 -0.000503773 3.88159E-05 8.85767E-05 5.27215E-05 8.69068E-05 -0.000129946 -0.000115707 2.99979E-05 -6.64257E-05 0.000113471 -8.01067E-05 -0.000180714 -2.00227E-05 -5.33204E-05 3.41114E-05 6.69452E-05 -8.96169E-05 1.52708E-05 3.98274E-05 2.83017E-05 7.45992E-05 -8.33938E-05 0.000222776 9.59683E-05 0.000152835 -0.000205061 -5.31066E-05 -0.000110945 -0.00023799 6.50896E-05 -0.000421965 6.3613E-05 9.33445E-05 8.65555E-05 9.4153E-05 7.8643E-05 6.38016E-05 0.000102614 2.52132E-05

RI PT

ACCEPTED MANUSCRIPT -0.000163761

EP

0.001226596 0.000388251 0.000492625 5.69006E-06 0.000468789 0.000200298 0.000190046 2.6734E-05 0.000181135 0.001003543 0.001490767 0.000939945 9.16298E-05 2.38972E-05 0.00096017 0.003079329 2.3887E-05 0.000927258 0.000493892 2.93551E-05 0.00046098 0.001390196 3.0457E-05 4.15136E-05 0.000389526 0.001216557 0.000524431 0.000607444 5.78107E-05 0.000435898 0.004845648 0.000220533 0.000261518 0.000390499 4.51235E-05 0.000394355 0.00039361 0.000509338 0.000307885 0.000475382 0.000627852 0.000987706 0.000530809 0.000498144 0.000176502 0.000136957 0.000698758 0.000203597 0.000181995 0.000315648 0.000215385 0.00023269 0.000310697 0.000402329 0.000287108 0.000404646 0.000520938 0.000912347 0.000999695 5.25025E-05 0.004584724 3.05763E-05 0.00051565 0.000680675 3.18095E-05 0.000235159 0.000307353 9.95886E-05 0.000183127

AC C

K00058 K03744 K00336 K11382 K14742 K01805 K13043 K01067 K05776 K01524 K07025 K00548 K03272 K01848 K03654 K09687 K01849 K07056 K00375 K09685 K01802 K02013 K13888 K03079 K12524 K01784 K07658 K03763 K07223 K07259 K02025 K02428 K01737 K03455 K02746 K00606 K07050 K01278 K03784 K01495 K00008 K07979 K03712 K04083 K08138 K07792 K03665 K08999 K02069 K10117 K00811 K07726 K03559 K01372 K02517 K00074 K03500 K14170 K06969 K02009 K02026 K00918 K06896 K01991 K01496 K02523 K01935 K01807 K05306

4.53914E-07 4.59243E-07 4.59243E-07 4.87629E-07 4.93585E-07 4.9945E-07 4.9945E-07 4.9945E-07 4.9945E-07 5.01695E-07 5.06366E-07 5.06366E-07 5.08805E-07 5.08805E-07 5.08805E-07 5.19088E-07 5.19088E-07 5.2982E-07 5.50144E-07 5.74951E-07 5.80497E-07 5.97645E-07 5.97919E-07 6.18841E-07 6.36051E-07 6.44235E-07 6.54733E-07 7.09347E-07 7.23984E-07 7.28515E-07 7.38699E-07 7.86831E-07 7.89826E-07 8.03077E-07 8.09282E-07 8.09485E-07 8.09726E-07 8.25595E-07 8.28573E-07 8.29649E-07 8.29649E-07 8.31767E-07 8.31767E-07 8.31767E-07 8.42877E-07 8.42877E-07 8.45233E-07 8.65473E-07 8.72307E-07 9.01897E-07 9.01905E-07 9.01905E-07 9.01905E-07 9.28061E-07 9.29869E-07 9.37471E-07 9.49089E-07 9.53416E-07 9.56342E-07 9.56342E-07 9.56342E-07 9.56342E-07 9.56342E-07 9.57124E-07 9.63557E-07 9.69102E-07 9.69102E-07 9.69375E-07 9.84741E-07

TE D

0.000120568 -0.000282931 0.000152672 6.86457E-05 0.000315299 -0.000150137 0.000303763 -8.57277E-05 -0.000132732 0.000168687 0.000113334 -0.000199933 -0.000165542 4.01432E-05 4.31118E-05 0.000176976 -0.000151627 0.000129053 -0.000120301 -0.000144587 7.95558E-05 6.84137E-06 0.000417805 -0.000180771 -0.000144589 1.12153E-05 6.99652E-05 5.9354E-05 -0.00070125 -0.000168912 -9.96005E-05 0.000158737 -0.000143282 1.59554E-05 -0.000379839 -5.05763E-05 0.00014028 -1.771E-05 -0.000397829 0.000301074 -1.074E-06 -0.000145948 -0.000251475 0.000175426 -1.55773E-06 3.19801E-07 0.000112031 -0.000275887 8.12795E-05 0.000173552 -0.000155959 -0.000113154 -3.40031E-06 0.000170721 -0.000144456 5.67337E-05 -0.000774058 -0.000149251 -0.000407422 -1.12341E-05 -0.000151128 -0.000150483 -5.24846E-05 0.000112019 -1.12096E-05 0.000370927 6.25964E-05 2.45782E-06 -0.000281688

SC

M AN U

5.00254E-05 -2.71683E-05 0.000102898 7.91179E-05 5.18311E-05 -0.000148478 0.00013313 4.48913E-05 -7.79744E-05 -0.000124773 3.25074E-05 8.18559E-06 7.52555E-05 6.53455E-05 -7.60864E-05 4.57491E-06 -0.000102206 9.38384E-05 8.27857E-05 0.000115968 7.9529E-05 4.7237E-05 -8.44228E-05 8.27593E-05 9.59398E-05 -0.000166481 7.05119E-05 2.53273E-06 9.48542E-05 0.000136598 0.000105186 8.46227E-05 0.000142769 9.08466E-05 0.000115688 -0.000112559 7.54735E-05 -3.03112E-06 -0.000157076 4.043E-05 3.51974E-05 2.40166E-05 -5.96889E-05 4.00852E-05 9.97937E-05 0.000120634 0.000123486 -0.000125907 -3.46062E-06 1.93243E-05 9.43231E-05 0.000106068 -6.53793E-05 0.000103179 0.000172115 0.000156108 0.000112828 0.000227674 8.84885E-05 4.96775E-06 1.73587E-05 0.00025537 6.31979E-05 8.84664E-05 -0.000211056 9.4573E-05 0.000116981 6.92108E-05

RI PT

ACCEPTED MANUSCRIPT -0.000132473

EP

0.000429163 0.000384735 0.000205722 5.11012E-05 0.000965179 0.000218508 0.000753216 0.000294975 0.000201331 0.000563187 0.000419834 0.000332776 0.000204875 3.40271E-05 3.34893E-05 0.000573097 0.000175985 0.000517335 0.000205917 0.000242326 8.09506E-05 3.4524E-05 0.001121786 0.000890552 0.000242351 4.6797E-05 0.000383127 5.22264E-05 0.001184513 0.000967139 0.000287342 0.000152467 0.000241602 9.13049E-05 0.000568076 0.000120306 0.000402514 4.08553E-05 0.000510424 0.0009496 5.70542E-06 0.000216181 0.000357955 0.000376191 5.52945E-06 4.57314E-05 0.000169009 0.000432762 0.000380074 0.000538042 0.000195863 0.000161843 4.52544E-05 0.000499148 0.000262401 0.000134681 0.001722233 0.00024938 0.000664662 4.75808E-05 0.000188518 0.000177494 0.000894755 0.000115925 4.75997E-05 0.001090722 5.60076E-05 0.000107788 0.001198694

AC C

K06385 K00652 K01449 K06306 K02051 K00837 K02647 K01246 K03387 K01420 K06382 K03118 K00346 K10914 K10974 K01356 K11527 K00528 K01661 K02527 K02744 K09767 K07088 K00262 K00912 K03756 K07080 K04565 K01791 K00226 K04564 K10670 K00946 K01611 K03585 K01297 K06393 K03620 K01284 K07171 K04561 K08289 K01201 K02502 K01121 K01835 K00198 K00950 K07105 K04488 K03975 K02230 K03767 K06381 K03270 K03475 K01187 K01186 K03561 K06281 K01468 K11537 K14155 K01286 K06282 K00821 K08092 K09807 K00540

9.94046E-07 1.00172E-06 1.02107E-06 1.02545E-06 1.02987E-06 1.03346E-06 1.03582E-06 1.03953E-06 1.09143E-06 1.12787E-06 1.16366E-06 1.17216E-06 1.1722E-06 1.1722E-06 1.1722E-06 1.17734E-06 1.21091E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22082E-06 1.22123E-06 1.23571E-06 1.23571E-06 1.2493E-06 1.2634E-06 1.2635E-06 1.27857E-06 1.27857E-06 1.30391E-06 1.30827E-06 1.30827E-06 1.30827E-06 1.31754E-06 1.36285E-06 1.37803E-06 1.37803E-06 1.38115E-06 1.3881E-06 1.40246E-06 1.40246E-06 1.41911E-06 1.42263E-06 1.42431E-06 1.44927E-06 1.4645E-06 1.48572E-06 1.55519E-06 1.61775E-06 1.64377E-06 1.67158E-06 1.69284E-06 1.71567E-06 1.71567E-06 1.74013E-06 1.74013E-06 1.74013E-06 1.74013E-06 1.74013E-06 1.74013E-06 1.75093E-06 1.76628E-06 1.79332E-06 1.84292E-06 1.8512E-06

TE D

0.000214065 -0.000234718 -0.00055072 3.93429E-05 -0.000148712 -0.000292295 0.000257495 -0.000243211 -0.000118164 0.000162072 0.000158724 0.000347106 0.000401872 0.000130132 0.000163848 0.001207931 0.00012828 -0.00015045 -0.000145861 -0.000149472 -0.000150696 8.78189E-05 -0.000251772 3.73786E-05 -0.000751444 -6.8909E-06 -0.000531454 0.000158993 -0.000122749 0.000108784 0.000158514 -0.000154916 4.79123E-05 -1.88776E-07 1.20929E-05 0.000229888 -0.000147165 -2.37544E-07 1.22024E-05 9.57723E-06 -0.001145411 5.03824E-06 -0.00016216 -0.000146118 -0.000289836 -0.000376887 0.000137562 3.10912E-05 -1.81912E-06 -0.000142548 0.000156325 -0.000153563 -0.00012084 0.000156983 5.07922E-05 -0.000145613 -0.000336299 -0.000153012 -0.000145641 -0.000122138 1.48284E-05 -0.00014524 -0.000145778 0.000200648 0.000105929 -0.000134935 0.000167811 4.06422E-06 -0.000142786

SC

M AN U

-5.10048E-05 -1.55286E-05 7.85747E-06 2.12064E-05 8.66315E-06 0.000109948 1.38883E-05 8.82531E-05 -5.77329E-05 -7.15134E-05 -0.000418616 -8.99877E-05 -8.24163E-05 -5.52204E-05 -0.000942268 -0.000407841 1.8872E-05 6.83874E-06 4.28033E-06 1.89722E-05 -0.000100873 -8.49999E-05 -0.000123656 0.000140474 -0.000147271 -0.000195335 -5.89792E-05 6.73429E-05 -6.06292E-05 -5.91424E-05 2.53121E-05 2.90243E-05 6.57552E-05 8.18924E-05 -9.29217E-05 -0.000439712 6.569E-05 0.000112171 0.000206131 0.000320421 -0.000111981 -1.02543E-05 5.69517E-05 0.000105453 0.000119169 -7.03678E-05 0.000152258 6.11433E-05 8.54105E-05 -4.45082E-05 -3.41044E-05 1.57008E-05 -3.59545E-05 0.000129543 8.25212E-05 0.00014135 1.6326E-05 8.24645E-05 -1.82172E-05 7.3077E-05 8.32889E-05 8.21517E-05 1.39723E-05 0.000135481 2.86656E-05 -5.612E-05 -0.000218292 3.5171E-05

RI PT

ACCEPTED MANUSCRIPT -5.63903E-05

EP

0.000629935 0.000268665 0.001235362 1.63822E-05 0.000167896 0.000362 0.000553552 0.000332051 0.000268845 0.000486756 0.000479227 0.001279348 0.001374544 0.000520813 0.000480998 0.005670485 0.00197637 0.000211042 0.000206259 0.000190849 0.000235377 0.00087442 0.000354419 0.000705005 0.001237121 0.0006942 0.001256496 0.000488354 0.000209399 0.000270231 0.000488892 0.000186364 3.14563E-05 3.25623E-05 4.3306E-05 0.00067269 0.002474 3.24901E-05 4.83543E-05 0.000104921 0.001737679 0.000671967 0.000251035 0.000275096 0.000447026 0.000545346 0.000516148 8.10066E-05 2.46995E-05 0.000249184 0.000498209 0.000231999 0.000166835 0.000460077 0.000111823 0.000251998 0.000521485 0.00021897 0.000251961 0.000140332 2.04728E-05 0.000252227 0.000252651 0.000272703 8.53801E-05 0.000209374 0.000331214 0.001200181 0.000232341

AC C

K01090 K02472 K01897 K00302 K01041 K01960 K03518 K03771 K06920 K06967 K01677 K03205 K02008 K03621 K14761 K06147 K03497 K04516 K07078 K01712 K03590 K06153 K01425 K03615 K03296 K03613 K03427 K14540 K01438 K06374 K11145 K03644 K11249 K02191 K00832 K08483 K03496 K03399 K01760 K10036 K02014 K00949 K03803 K03787 K03327 K03832 K09747 K09155 K09729 K00748 K01693 K00603 K01183 K09787 K03320 K07277 K01993 K00208 K02535 K06079 K02454 K01627 K06861 K15024 K06971 K07170 K06133 K00688 K03593

1.87059E-06 1.88904E-06 1.88904E-06 1.91153E-06 1.91153E-06 1.95904E-06 2.00896E-06 2.01875E-06 2.02299E-06 2.05613E-06 2.1221E-06 2.1257E-06 2.12694E-06 2.12954E-06 2.15205E-06 2.21522E-06 2.32896E-06 2.32896E-06 2.34084E-06 2.4149E-06 2.43209E-06 2.46158E-06 2.48886E-06 2.53695E-06 2.55757E-06 2.61232E-06 2.68881E-06 2.78193E-06 2.78193E-06 2.8522E-06 2.85492E-06 2.97191E-06 3.0342E-06 3.04363E-06 3.15547E-06 3.15885E-06 3.15885E-06 3.17653E-06 3.17653E-06 3.18955E-06 3.18955E-06 3.21447E-06 3.26184E-06 3.28387E-06 3.32968E-06 3.39315E-06 3.47086E-06 3.49595E-06 3.5319E-06 3.55376E-06 3.55376E-06 3.61793E-06 3.61908E-06 3.65222E-06 3.65222E-06 3.75804E-06 3.75804E-06 3.75804E-06 3.75804E-06 3.75804E-06 3.79004E-06 3.79773E-06 3.88017E-06 3.88017E-06 3.91369E-06 4.06476E-06 4.14682E-06 4.24707E-06 4.35812E-06

TE D

0.00030375 -1.636E-05 0.00026209 1.21613E-05 -3.77216E-05 -0.000192976 -0.000285912 5.4313E-06 -0.000152174 4.60129E-05 -0.000394819 -0.000252556 -0.000144776 -0.000144932 0.000231399 0.000427255 0.000511106 -0.000142407 -0.000143482 -0.000616957 0.000144873 -0.000100586 0.000148003 3.60216E-05 0.000102829 -0.000137795 4.3363E-05 8.3953E-05 8.75203E-05 0.000206787 -0.00010131 0.000108272 -0.001086166 0.000271061 -0.000158032 -0.000254811 4.75243E-08 -0.000146018 0.000660822 0.000127562 -0.000116404 -0.000153447 -4.2731E-06 -1.64033E-05 -0.000153491 -0.000153494 -2.41358E-05 -0.000150819 0.000382653 6.81577E-06 0.0001546 -0.001423344 -6.66089E-05 -0.000291347 -0.000147831 0.000491348 0.001216319 0.000253072 -9.55095E-05 -0.000140322 0.000159033 4.1149E-05 -0.000135726 -0.000251404 -0.000221365 5.86946E-05 5.09133E-06 -5.42164E-06 0.000177104

SC

M AN U

-0.000109393 -0.000148833 8.42679E-05 -0.000117447 -3.62154E-05 0.00010099 7.04871E-05 1.09868E-05 -0.000112257 5.79561E-05 1.48342E-05 8.33265E-05 8.31423E-05 0.000119134 7.29612E-05 0.000421791 1.80434E-05 1.35303E-05 -7.91671E-05 -8.84453E-05 9.3421E-05 -4.96164E-05 0.000144329 -0.00012891 2.44029E-05 -0.000217876 0.000157478 -0.000116805 0.000152017 0.00010906 -9.97077E-05 0.000157929 0.000146877 7.13288E-06 1.22409E-06 8.34143E-05 1.61214E-05 -0.000145887 -6.44337E-05 8.1852E-05 7.87899E-06 0.000180011 7.00067E-05 7.577E-06 7.58737E-06 -8.75909E-05 1.04158E-05 -0.000186581 -0.000150444 -3.42709E-05 -5.09001E-05 0.000183577 3.48947E-05 1.01909E-05 0.000366729 1.32641E-05 -1.12853E-06 9.1832E-05 3.0405E-05 3.85469E-05 3.94978E-05 1.83567E-05 -0.000203671 5.42558E-05 -8.74908E-05 5.24088E-05 4.18245E-05 0.000270282

RI PT

ACCEPTED MANUSCRIPT 2.39742E-05

EP

0.0008223 0.000663399 0.000860275 3.35254E-05 0.00066423 0.000355364 0.00044635 2.92389E-05 0.000210433 0.00098276 0.000637636 0.000467297 0.000251572 0.000251773 0.000510951 0.001127763 0.000749377 0.00020055 0.000177057 0.00122995 0.000491246 0.000240535 0.000516837 8.812E-05 0.00050309 0.000205567 0.001051803 0.000268952 0.000355601 0.000208736 0.000293956 0.000435456 0.001349827 0.000285565 0.000214281 0.001072667 4.9775E-05 0.000215071 0.001458945 0.000396535 0.000258844 0.000205523 0.000162508 3.75016E-05 0.000205448 0.000205438 0.000678366 0.000202704 0.001305641 0.000911312 0.000512635 0.003309246 0.000460733 0.000397444 0.000920301 0.001267161 0.00302088 0.000501752 0.000206277 0.000233652 0.000229181 1.97277E-05 0.000203137 0.000945567 0.000365466 0.000246531 1.45272E-05 1.37323E-05 0.000506224

AC C

K03892 K01880 K07090 K02017 K01893 K01077 K00677 K02575 K01676 K00790 K07154 K06966 K02065 K02066 K13542 K02050 K10441 K02619 K02856 K02005 K03436 K01548 K04517 K02821 K10907 K09125 K06131 K07010 K07035 K02759 K01744 K00797 K12373 K02760 K07164 K00640 K03708 K03775 K07718 K07030 K09457 K00348 K07665 K01821 K00349 K00347 K03584 K00351 K11189 K04043 K03529 K01190 K02190 K03718 K01951 K02034 K02027 K01439 K01911 K02622 K09936 K01444 K01719 K01153 K00639 K01480 K12700 K02585 K02073

4.35812E-06 4.35812E-06 4.42126E-06 4.42574E-06 4.42638E-06 4.44911E-06 4.44997E-06 4.56499E-06 4.5758E-06 4.69932E-06 4.69932E-06 4.79596E-06 4.79596E-06 4.82472E-06 4.86089E-06 4.86089E-06 4.96506E-06 4.99822E-06 5.10316E-06 5.15725E-06 5.21895E-06 5.21895E-06 5.42745E-06 5.42745E-06 5.4558E-06 5.56824E-06 5.75479E-06 5.75479E-06 6.08813E-06 6.09485E-06 6.13901E-06 6.14033E-06 6.14395E-06 6.14395E-06 6.16116E-06 6.16116E-06 6.2695E-06 6.32308E-06 6.3654E-06 6.45261E-06 6.47865E-06 6.49411E-06 6.49411E-06 6.55483E-06 6.6337E-06 6.6337E-06 6.6995E-06 6.73507E-06 6.74051E-06 6.74906E-06 6.75142E-06 6.75142E-06 6.75142E-06 6.75142E-06 6.75142E-06 6.75142E-06 6.77579E-06 7.03603E-06 7.07172E-06 7.13571E-06 7.24655E-06 7.31311E-06 7.37245E-06 7.4409E-06 7.57088E-06 7.57088E-06 7.57088E-06 7.64508E-06 7.67707E-06

TE D

5.72824E-05 -0.000153692 -0.000451766 -4.91127E-05 0.000106458 2.81963E-06 -9.20111E-05 -5.18994E-05 1.85889E-06 -2.88885E-06 -0.000151033 0.000106584 -0.000146351 0.000128452 0.000115528 -0.000139493 -0.000227575 -0.000169498 0.000124247 -0.000150538 0.000155443 -0.000146347 -0.000148247 3.20469E-06 -0.000135557 -0.000193884 -0.000138399 -0.000290707 -0.000136647 -0.000150455 0.000123369 -0.000143839 -4.02585E-05 0.000143014 -4.71613E-05 4.86006E-05 -0.000159343 -0.000114266 -0.000348977 -5.6093E-06 -0.000124065 0.000176329 -1.8644E-05 -0.000149788 3.70226E-05 1.28124E-05 -0.000345264 -0.000225833 -0.000195536 2.52174E-05 1.36039E-05 -0.000400182 -0.00011431 -2.23728E-05 -0.00014375 -0.000276633 -0.000152225 -8.46757E-07 5.11448E-05 3.57979E-05 0.000471113 -0.000143994 0.000158222 -0.000243966 0.000297968 0.000109168 0.000153222 9.56085E-07 0.000484986

SC

M AN U

1.64823E-05 -2.88367E-05 -0.00012371 8.3465E-05 8.96322E-05 4.9395E-05 0.000120885 0.000110366 -0.000139513 1.56136E-05 -9.46747E-05 1.61879E-05 -9.29907E-05 0.000124961 5.57788E-06 -8.73643E-05 -9.37614E-05 -0.000131207 1.08131E-05 -3.38959E-05 7.55633E-06 1.12872E-05 6.76589E-05 0.000181986 7.03508E-05 3.07012E-05 2.69395E-05 4.07751E-06 1.07944E-05 -0.000100754 1.66266E-05 0.000141161 -0.000102341 0.000245798 8.55894E-05 -2.10484E-05 -2.10734E-05 -4.73294E-05 -0.000173168 5.10576E-06 -2.75695E-05 -0.000100897 7.43191E-05 4.05502E-05 7.43557E-05 -0.000100406 -1.71505E-05 -1.83351E-05 0.000113764 -7.52253E-05 -8.8152E-05 0.000182028 -0.000115821 5.99997E-05 -3.91197E-05 7.20197E-06 -0.000143199 3.18822E-05 6.61203E-05 0.000125398 1.41671E-05 -3.81803E-05 -4.03386E-05 0.00020125 -0.00013839 -2.21677E-05 1.01269E-05 0.000323569

RI PT

ACCEPTED MANUSCRIPT 0.000165849

EP

0.000134547 0.000265313 0.000788842 0.00063919 0.000116412 5.60412E-05 0.000109645 0.000338112 7.47564E-05 0.000615852 0.000202513 0.000390606 0.00021483 0.000509713 0.000134938 0.000175506 0.00030092 0.000724847 0.001161818 0.000203353 0.000525071 0.000192291 0.000212566 2.8317E-05 0.000843565 0.000286466 0.000230525 0.00039611 0.00015643 0.000203852 0.000423926 0.000213944 9.70642E-05 0.001145398 0.000118503 4.6507E-05 0.00024058 0.000129519 0.000489998 0.000291135 0.000139982 0.000416838 0.000629826 0.000265474 2.39274E-05 3.58008E-05 0.00046598 0.0002463 0.000431256 5.2691E-05 0.000719835 0.001234217 0.000190378 0.000645854 0.000263674 0.000567683 0.000223847 0.000210528 4.26892E-05 4.06814E-05 0.000834852 0.000211475 0.000524401 0.001170791 0.00026174 0.00060538 0.000486781 2.01134E-06 0.001328479

AC C

K02822 K03733 K07011 K09888 K07112 K01879 K01917 K09790 K13643 K09765 K05516 K06396 K08307 K07738 K01487 K07387 K01238 K01610 K02470 K01277 K01269 K00331 K03281 K09824 K01759 K03305 K02621 K06177 K02002 K07405 K07736 K00029 K07552 K07095 K03293 K01250 K00350 K12343 K13993 K03408 K00697 K02122 K03426 K02536 K11203 K03274 K01051 K08676 K01092 K01679 K12410 K01785 K03328 K03617 K06895 K01711 K05807 K03465 K05814 K02769 K02056 K02426 K07042 K01710 K02761 K00611 K06183 K01781 K02033

7.8577E-06 7.99521E-06 7.99521E-06 8.00313E-06 8.14597E-06 8.3862E-06 8.3862E-06 8.44841E-06 8.54084E-06 8.54084E-06 8.54084E-06 8.62968E-06 8.70739E-06 8.71704E-06 8.90493E-06 8.90493E-06 9.00269E-06 9.05907E-06 9.10475E-06 9.27712E-06 9.38885E-06 9.41075E-06 9.41075E-06 9.42519E-06 9.44851E-06 9.44851E-06 9.46569E-06 9.46569E-06 9.53663E-06 9.65149E-06 9.85324E-06 9.95198E-06 1.05154E-05 1.05776E-05 1.0612E-05 1.06365E-05 1.06781E-05 1.06781E-05 1.09048E-05 1.10716E-05 1.12984E-05 1.12984E-05 1.16873E-05 1.17009E-05 1.19655E-05 1.19912E-05 1.20497E-05 1.2064E-05 1.21004E-05 1.21004E-05 1.21004E-05 1.23377E-05 1.23529E-05 1.24334E-05 1.24965E-05 1.2608E-05 1.26126E-05 1.28722E-05 1.29673E-05 1.32243E-05 1.32367E-05 1.33513E-05 1.36439E-05 1.37992E-05 1.40272E-05 1.41936E-05 1.43475E-05 1.43475E-05 1.44184E-05

TE D

-0.000148179 -0.000136845 0.000102214 -0.00028793 4.80122E-05 -0.000392239 -5.47042E-06 -0.000128615 -9.21994E-05 -9.24001E-05 0.000632448 -0.000391402 3.10145E-06 4.86016E-05 -0.000130438 -0.000141566 -0.00014766 -0.000157156 -8.34846E-05 -0.000141573 -0.000233792 0.000178108 0.00063827 0.00067958 -0.000144506 0.000151972 -9.31972E-05 9.37063E-06 0.00029961 -0.000129103 -8.30623E-05 -0.000143493 -8.26526E-05 -0.000138721 0.000145983 -0.000400135 -2.85827E-05 5.58126E-05 0.000150017 -0.000116259 -0.000234426 0.000308443 3.64973E-05 0.000246374 -5.7516E-07 -0.000120832 0.000123343 -0.000148197 -0.000119819 7.25195E-07 -3.58564E-05 0.000310144 -4.72973E-05 -0.000208203 0.000146547 -0.000295118 7.02826E-05 0.000205619 0.000158587 -0.000208113 -9.67348E-05 0.000151374 -0.000121886 -0.000137696 0.000302092 -0.002869202 -0.000133718 -0.000121536 0.000127189

SC

M AN U

-1.10628E-07 8.76733E-05 6.12952E-05 5.16247E-05 9.94978E-05 4.48972E-05 1.45161E-05 9.07236E-05 9.06269E-05 2.53445E-05 -0.000293205 4.43386E-05 -0.000331605 9.28055E-05 1.72163E-05 4.60264E-06 -4.17413E-06 0.000204301 1.70398E-05 -4.77052E-05 -4.69718E-05 0.000142884 0.000520543 2.85929E-05 -1.79754E-05 0.000104837 7.49527E-05 0.000246447 1.45716E-05 0.000110724 -6.20607E-05 -0.000143357 2.00675E-05 -4.13859E-05 0.000227571 7.06174E-05 -0.000164723 -3.39942E-05 8.73311E-05 -5.0632E-05 6.9419E-05 -0.0001129 -1.89733E-05 3.9808E-05 5.06942E-05 -0.000208857 0.000203013 4.67458E-05 4.05903E-05 9.99172E-05 1.54106E-05 -0.000112883 -5.84273E-05 -5.22056E-05 5.92168E-05 -0.000241979 -0.000128153 -3.45048E-05 -6.49964E-05 6.93959E-05 2.66249E-05 -0.000105532 2.4142E-06 0.000192968 -0.000693053 -8.51581E-05 4.60372E-05 0.00013012

RI PT

ACCEPTED MANUSCRIPT -4.6096E-06

EP

0.000237839 0.000156032 0.000114819 0.000337808 4.22462E-05 0.00068296 1.0304E-05 0.000159948 0.000252017 0.000252175 0.002056101 0.001221657 1.12097E-05 0.002167182 0.000270159 0.000215386 0.000233473 0.000223109 0.000462998 0.00021536 0.000357911 0.00041073 0.002981851 0.001008779 0.000191244 0.000480844 0.000179661 4.98887E-05 0.00037923 0.000297598 0.000356431 0.00037117 0.000573902 0.000196452 0.000509335 0.000704081 4.79405E-05 0.000915133 0.000524349 0.000349077 0.000799134 0.00058659 0.000231613 0.000567727 9.22821E-06 0.000256891 0.000550665 0.001560968 0.000233573 1.14276E-05 0.000103275 0.000721127 0.000634162 0.000236249 0.000309324 0.000541413 0.000451576 0.00067693 0.000502056 0.000230024 0.000517533 0.000416928 0.000280445 0.000155981 0.000577984 0.008378819 0.000918863 0.000167759 0.000191569

AC C

K07037 K02001 K13479 K07148 K05815 K07001 K00355 K11996 K01547 K01546 K02006 K01154 K02168 K00850 K06041 K04762 K09810 K00241 K00382 K03269 K09808 K02160 K07024 K10440 K08191 K06442 K03799 K02825 K02795 K00041 K00721 K00956 K00290 K00895 K06960 K06142 K07334 K01647 K03216 K00240 K01270 K01223 K01962 K07667 K10038 K01654 K02099 K02016 K03811 K07034 K00966 K06409 K03612 K05785 K01512 K07114 K02203 K08591 K03705 K02852 K03589 K07183 K07017 K08169 K02757 K03088 K02040 K05520 K02810

1.45031E-05 1.45521E-05 1.45521E-05 1.47464E-05 1.54995E-05 1.58719E-05 1.61498E-05 1.62922E-05 1.63493E-05 1.63493E-05 1.63578E-05 1.63578E-05 1.63578E-05 1.68026E-05 1.70257E-05 1.76342E-05 1.7674E-05 1.77579E-05 1.77579E-05 1.79339E-05 1.79515E-05 1.82576E-05 1.82924E-05 1.8334E-05 1.84227E-05 1.84553E-05 1.84678E-05 1.8523E-05 1.86777E-05 1.90667E-05 1.95919E-05 1.97321E-05 1.99094E-05 2.00474E-05 2.07378E-05 2.09793E-05 2.11905E-05 2.16205E-05 2.16967E-05 2.18812E-05 2.24713E-05 2.27233E-05 2.30314E-05 2.30314E-05 2.31709E-05 2.35921E-05 2.38706E-05 2.38706E-05 2.38886E-05 2.39017E-05 2.40855E-05 2.41335E-05 2.47366E-05 2.54944E-05 2.61238E-05 2.61752E-05 2.65571E-05 2.65831E-05 2.6962E-05 2.6962E-05 2.74948E-05 2.74948E-05 2.77294E-05 2.77556E-05 2.79262E-05 2.82126E-05 2.8365E-05 2.85425E-05 2.90648E-05

TE D

0.000136682 -0.000139299 1.29083E-05 0.000177187 0.000207934 -0.000292399 -0.000145827 -3.09581E-05 5.7368E-05 -0.000142661 0.000228246 4.2928E-05 1.1839E-05 9.54437E-05 1.02633E-05 1.51602E-05 -5.02667E-05 -0.000130142 0.00018931 0.000682112 0.00018185 -0.000100404 -0.000781522 4.47394E-06 -0.00021544 -0.000120442 0.000169017 -0.000384081 -0.000197861 0.000157737 0.000179489 -0.000151457 0.000178058 5.5876E-05 -8.67847E-05 0.000127774 -0.000188369 0.000482004 9.80782E-05 4.80604E-05 0.000102792 -0.000633039 0.00062962 9.67111E-05 -5.73463E-06 -0.000146989 7.50784E-05 0.000873837 -0.00010899 -0.000117481 4.8648E-06 0.000147196 -0.000221883 0.000253065 4.07672E-06 1.03091E-05 0.000176179 0.000134696 0.000319233 -0.000128668 0.000229727 -0.000114443 4.66111E-06 0.000132802 9.68082E-05 0.000110046 -0.000135067 7.36411E-05 -3.06137E-05

SC

M AN U

-3.12764E-05 6.58555E-05 -7.16255E-05 -9.2601E-05 0.00016418 -5.59487E-05 9.23055E-05 -0.00011421 1.25778E-05 -3.29496E-05 1.84927E-05 0.00012062 -0.000107276 5.80033E-05 6.64457E-05 5.12065E-05 3.53456E-05 -0.000106444 0.000353629 2.48749E-05 0.00011646 -7.32408E-05 4.6905E-05 4.60121E-05 1.0832E-05 1.022E-05 -3.29036E-05 -2.1E-05 -3.62789E-05 -1.34535E-05 -0.000217688 -0.00021651 2.07618E-05 5.28342E-05 9.41851E-06 4.90405E-05 0.000305272 1.73305E-06 -6.09618E-05 -4.29991E-05 -0.000151534 -2.37754E-05 9.13163E-05 -8.79594E-05 -4.18286E-06 0.000101851 -0.00047949 7.50208E-05 2.49295E-05 -0.000240395 -8.12571E-05 0.000125128 -0.000242052 5.12709E-05 -0.000228808 0.000208242 -3.25274E-05 0.000249121 5.48204E-06 -2.06411E-05 -2.53327E-05 4.59069E-05 -5.86033E-05 -8.75066E-05 -1.85121E-05 0.000102723 -6.85497E-05 0.000251111

RI PT

ACCEPTED MANUSCRIPT -5.48647E-05

EP

0.000483962 0.000302205 3.35104E-05 0.000514821 0.000861979 0.000455774 0.000382906 0.000115033 0.000282085 0.000212296 0.000680409 3.405E-05 0.000545913 0.000430774 7.45966E-05 3.3816E-05 8.01934E-05 0.000157697 0.001332169 0.001309199 0.000384722 0.000193014 0.001355214 1.00297E-05 0.000382121 0.000148484 0.000454413 0.001462254 0.000889701 0.00117302 0.001388685 0.001087404 0.001491897 4.3682E-05 0.000256795 0.000207009 0.000263228 0.001470073 0.000956397 0.000131514 0.000265143 0.00224006 0.001416673 0.000117934 0.000114072 0.00020269 7.08291E-05 0.005318911 0.00033011 0.000216283 0.000528092 0.001671399 0.000292365 0.000996555 1.47917E-05 0.001646052 0.000339398 0.000508994 0.00044735 0.000180234 0.000967359 0.000158239 1.05977E-05 0.000360708 0.000289017 0.000217777 0.000245642 0.000814658 0.00044271

AC C

K07742 K01119 K02745 K07473 K00995 K06921 K00957 K07175 K06410 K00257 K00003 K03457 K01695 K11358 K02650 K02747 K02651 K08981 K03798 K10439 K01628 K03116 K01206 K11777 K00979 K09758 K07584 K03530 K07568 K01462 K01714 K00874 K00945 K07074 K01813 K06394 K03839 K02035 K01507 K01583 K06373 K07133 K07720 K02768 K00050 K00338 K02019 K02003 K01467 K01665 K00248 K03499 K01130 K07729 K08314 K02078 K02012 K05896 K02796 K03814 K00854 K05801 K06120 K10254 K13052 K02588 K06975 K03734 K12267

2.96736E-05 2.96858E-05 2.98019E-05 3.0178E-05 3.06059E-05 3.07986E-05 3.10615E-05 3.12669E-05 3.16006E-05 3.16352E-05 3.20363E-05 3.21209E-05 3.22001E-05 3.22001E-05 3.27021E-05 3.30779E-05 3.31622E-05 3.3238E-05 3.3453E-05 3.40033E-05 3.45249E-05 3.47592E-05 3.78366E-05 3.81056E-05 3.87897E-05 3.89163E-05 3.92033E-05 3.92033E-05 3.94535E-05 3.95366E-05 3.9637E-05 4.039E-05 4.04056E-05 4.0787E-05 4.08622E-05 4.12335E-05 4.12335E-05 4.14797E-05 4.19949E-05 4.20252E-05 4.25172E-05 4.31796E-05 4.33558E-05 4.37704E-05 4.43088E-05 4.44413E-05 4.48087E-05 4.50866E-05 4.68238E-05 4.79913E-05 4.79913E-05 4.83235E-05 4.96896E-05 4.99403E-05 5.01102E-05 5.09244E-05 5.26741E-05 5.2919E-05 5.32057E-05 5.32453E-05 5.36723E-05 5.54557E-05 5.54557E-05 5.54557E-05 5.77615E-05 5.84379E-05 5.9031E-05 5.90817E-05 6.08621E-05

TE D

2.38848E-05 -0.000123413 0.000281581 2.47758E-06 -0.000211997 -4.11422E-05 -0.000110609 1.88349E-05 0.000172801 0.000142829 -3.62244E-05 -0.000311283 5.05437E-05 -0.000153573 9.02803E-05 0.000241152 -0.000109268 -0.000196722 -0.000105055 0.000331048 0.000146306 0.000140827 -0.000323835 -0.000127305 0.000142708 0.00035119 0.000145943 9.78429E-06 -1.36231E-05 3.34938E-05 -0.000200844 0.000112137 -0.000286888 -7.18024E-06 0.000423665 -6.18519E-05 -0.000320727 -0.000144529 -2.93734E-05 -0.000116434 0.000204163 7.3427E-05 -0.000149612 -9.37955E-05 -0.00025329 -0.000136391 7.5067E-05 -9.9579E-05 0.000121037 -0.000106773 9.99091E-06 -5.79741E-06 0.000403621 1.6006E-05 0.000154995 6.67558E-05 0.00029257 -1.61826E-06 -0.000122864 0.000886649 0.000189901 -0.000113331 0.000345927 -0.000102906 0.000218086 -9.82614E-05 0.000189134 1.23611E-06 3.29696E-05

SC

M AN U

-0.000152053 5.45287E-05 2.10203E-05 -0.000106453 7.4425E-05 -4.29482E-05 6.68123E-05 0.000137748 -3.63549E-05 0.000102749 1.56673E-05 8.11639E-05 -4.20442E-05 1.4104E-05 1.5429E-05 -4.16809E-06 2.51832E-05 -3.53548E-05 9.2478E-05 7.07479E-05 -3.85652E-05 -9.65898E-06 1.68669E-05 -1.54354E-05 7.10347E-05 -0.000111826 4.28848E-05 7.46143E-05 -0.000207073 -4.82811E-05 0.000118899 2.21676E-05 8.95643E-05 0.000324212 -9.41877E-05 -2.25972E-05 -0.000160386 -0.00010699 1.42808E-05 -5.73849E-05 5.10578E-05 -1.53485E-05 6.23054E-05 1.0892E-05 9.19082E-07 0.000139626 -2.948E-05 -2.95718E-05 -8.71036E-06 4.2428E-05 -6.72563E-05 0.000199772 4.77798E-06 -6.14937E-05 -0.000151909 0.000387333 -8.06386E-05 2.23079E-05 0.000198458 0.00013272 4.55789E-05 0.000263748 -3.57991E-05 -1.86753E-05 2.04647E-05 -4.90984E-05 9.28859E-06 5.51339E-05

RI PT

ACCEPTED MANUSCRIPT 4.61981E-05

EP

2.06955E-05 0.001052851 0.000536273 4.74148E-06 0.000972159 8.1816E-05 0.000134473 2.36225E-05 0.00030652 0.000513772 8.25112E-05 0.000416713 8.45327E-05 0.000698401 8.84093E-05 0.00058708 0.000125533 0.000978053 0.000127002 0.001277164 0.000341701 0.000508023 0.00038474 0.000197707 0.000520209 0.000890308 0.001099144 2.05464E-05 4.13262E-05 0.000398171 0.000236782 0.00023943 0.000410249 5.58873E-05 0.001283674 0.000614543 0.001091509 0.001043613 0.000657821 0.000174238 0.001665748 5.39075E-05 0.000929578 0.000165436 0.000708414 0.000195629 0.000719464 0.000106886 0.000160876 0.000121089 2.10493E-05 9.51432E-05 0.001255239 4.84425E-06 0.000478202 0.001053166 0.000586734 0.000680539 0.000230505 0.001835386 0.000455289 0.00022747 0.000501349 0.000128648 0.000666358 0.000142136 0.000587886 1.70798E-06 0.000768074

AC C

K08323 K01840 K04072 K07494 K01790 K02068 K03694 K02453 K03488 K09772 K03781 K03534 K13922 K03442 K01305 K01193 K02000 K02564 K00684 K01624 K01464 K07574 K03606 K03827 K09157 K02654 K03569 K10560 K01772 K03413 K11934 K00005 K08218 K09773 K02032 K00610 K03797 K00876 K06518 K06885 K00059 K07031 K00791 K03303 K03924 K13378 K03458 K00819 K02103 K03818 K10561 K07181 K02031 K07770 K03609 K03545 K03710 K01950 K01005 K02057 K00926 K11085 K02794 K06891 K03523 K01256 K02018 K09931 K10773

6.22718E-05 6.57175E-05 6.59824E-05 6.59824E-05 6.59824E-05 6.62978E-05 6.6387E-05 6.69895E-05 6.72965E-05 6.76541E-05 6.79347E-05 7.11719E-05 7.14665E-05 7.16577E-05 7.19095E-05 7.34768E-05 7.36803E-05 7.36803E-05 7.38461E-05 7.43456E-05 7.46107E-05 7.67506E-05 8.00231E-05 8.08193E-05 8.08193E-05 8.11846E-05 8.11846E-05 8.18285E-05 8.31282E-05 8.34165E-05 8.37211E-05 8.37211E-05 8.43641E-05 8.43985E-05 8.46121E-05 8.50759E-05 8.50759E-05 8.62553E-05 8.65761E-05 8.70942E-05 8.81519E-05 8.85652E-05 9.16196E-05 9.32965E-05 9.40854E-05 9.41288E-05 9.42072E-05 9.46518E-05 9.49821E-05 9.76512E-05 9.80154E-05 0.000100331 0.0001006 0.0001006 0.000100762 0.000101552 0.000101606 0.000101622 0.000101656 0.000103009 0.000103233 0.000104158 0.000105415 0.00010573 0.000105776 0.000106214 0.000106214 0.000106613 0.000106806

TE D

8.84355E-05 0.000142722 0.000153748 5.85764E-05 1.06031E-05 2.99642E-05 4.26758E-07 3.13866E-05 9.44305E-05 1.73354E-05 1.7302E-05 0.000166574 -6.83368E-05 2.21393E-06 0.000143265 -0.000124379 6.26493E-05 3.04692E-05 3.0748E-05 -9.73994E-05 0.000103938 3.22452E-06 -0.00043919 0.000136747 6.09379E-05 -0.000105533 2.80816E-05 5.16741E-05 -0.000185998 -1.58826E-05 -0.00031424 2.56637E-05 7.55892E-05 4.03207E-05 4.57693E-06 0.000215642 3.51237E-05 0.000122495 -0.000114637 0.000141839 2.39261E-06 0.000174965 -0.000275139 0.000142531 0.000107471 8.0792E-05 -0.000210562 -0.000265691 -0.00012869 5.97159E-05 4.01209E-05 1.53724E-05 0.000137163 2.98401E-05 3.69413E-05 0.000165595 1.87901E-05 -0.000125516 0.000134167 0.00012909 8.90179E-05 0.000215447 0.000339375 -0.00020138 -1.13589E-05 9.52651E-05 9.13256E-05 3.33674E-05 9.84892E-07

SC

M AN U

-9.29078E-05 1.52065E-07 0.000128767 4.14872E-05 -0.00017183 1.02792E-05 3.61991E-05 5.41178E-05 8.37094E-05 8.37397E-05 -0.00010839 6.55545E-05 9.4466E-07 1.70818E-05 1.37886E-05 4.96652E-05 4.19508E-05 -0.000146053 -2.35262E-05 -7.0605E-05 -9.04736E-05 0.000215322 5.37348E-05 3.24064E-05 -3.01436E-05 -0.00013096 -0.000100169 0.000112264 -6.64833E-05 -4.48769E-05 5.20606E-05 -9.87233E-05 3.82838E-05 6.4405E-05 -4.10491E-05 0.000123949 -0.000145397 4.3981E-05 5.92451E-05 3.41649E-05 -2.69576E-05 -3.54408E-05 -3.30253E-05 -7.2021E-05 -0.000171715 -4.50595E-06 -4.24968E-05 6.94988E-05 -2.14595E-05 3.44031E-05 3.44393E-05 5.15404E-05 4.99055E-05 -9.61349E-05 -8.08428E-05 -0.000126677 1.96489E-05 8.66649E-05 -8.76075E-05 5.80521E-05 0.000156615 -4.59472E-05 -1.34527E-06 -0.000101676 -9.14052E-05 -8.79133E-05 3.61471E-05 1.06236E-05

RI PT

ACCEPTED MANUSCRIPT -1.61391E-05

EP

0.000123015 0.000366545 0.00043211 0.000154227 2.72216E-05 0.000269516 2.79211E-06 2.59787E-05 0.000121103 8.13193E-05 8.14128E-05 0.000686493 0.000103284 7.96525E-07 0.000352006 0.000181962 4.06384E-05 3.25908E-05 0.000856242 0.000111431 0.000951149 0.000671805 0.000581054 0.00024854 5.93215E-05 0.000156042 0.000216296 0.000193651 0.000676121 8.6155E-05 0.000510491 3.55862E-05 0.001043968 2.24018E-05 2.49431E-05 0.000658421 0.000555705 0.000444907 0.000197333 0.00049361 1.33052E-05 0.000515251 0.0010802 0.000334516 0.000364659 0.000400406 0.000313455 0.000851744 0.000256106 6.31798E-05 3.76133E-05 1.32577E-05 0.000335053 3.79959E-05 0.000782485 0.001040135 0.000286745 0.000234359 0.000157 0.000272189 6.17456E-05 0.000358983 0.000752513 0.000323358 0.000157116 0.000373068 0.001115248 2.35499E-05 1.80545E-06

AC C

K05341 K07260 K00882 K03800 K06331 K06919 K07535 K10672 K01488 K04656 K04654 K05832 K09922 K00663 K02119 K02361 K01706 K03486 K00705 K13051 K03438 K02039 K01447 K02653 K09153 K09680 K10010 K02405 K00012 K07481 K00971 K01684 K03624 K14977 K09167 K08884 K01696 K10540 K01843 K00798 K07046 K02770 K00566 K03698 K01267 K02392 K01745 K07107 K07386 K06952 K01466 K02688 K03571 K03148 K01775 K03588 K01715 K04773 K03491 K08234 K01222 K02793 K08600 K00983 K13012 K06438 K00655 K00899 K08081

0.000108581 0.000113603 0.000116112 0.000120697 0.000121505 0.000121666 0.000121666 0.000122909 0.000122953 0.000123106 0.000123106 0.000125924 0.000128483 0.000128542 0.000128646 0.000128667 0.000129245 0.000130733 0.000135809 0.000137206 0.000141297 0.000141732 0.000145789 0.000147226 0.000149353 0.000151078 0.000153274 0.000153274 0.000153285 0.000153297 0.000153536 0.000153825 0.000157653 0.000159369 0.000160383 0.000162352 0.000163818 0.000164459 0.000165588 0.000166609 0.000167697 0.000168087 0.000169457 0.000171034 0.000172261 0.000172261 0.000174436 0.00017487 0.000175079 0.000175743 0.000175978 0.000177134 0.000177682 0.00017877 0.00017877 0.000178979 0.000181743 0.000181748 0.000184372 0.000185573 0.000185573 0.000186379 0.0001871 0.0001871 0.000193286 0.000193286 0.000193781 0.000195924 0.000195924

TE D

0.000295973 -0.00010055 -4.54196E-06 -0.000297147 4.74092E-05 -0.000139964 -0.000255327 -7.59803E-05 -0.000205816 -0.00012771 -1.40687E-05 -0.000186271 -0.000111254 0.000250585 1.53916E-05 -5.53829E-05 -2.1929E-05 6.02008E-05 -0.00016434 -0.00011958 -9.5336E-05 1.69816E-05 1.50643E-05 0.000123527 -7.24835E-05 -0.000107264 -7.40266E-05 -9.11819E-05 -0.000130681 -0.0001858 -0.000583296 -0.000126446 1.28255E-05 -9.37088E-05 6.9407E-06 -6.24474E-07 0.00017771 7.77267E-05 -0.000219474 0.000101352 -0.00012037 0.000125843 3.58643E-05 -0.000139868 -0.000135329 -0.000135294 -0.000299991 -0.000135307 -0.000135294 1.19181E-05 -0.000135255 5.96162E-05 -7.01273E-05 6.80755E-05 4.92195E-05 1.01068E-06 0.000100494 -9.43638E-05 -2.3168E-05 -3.9586E-05 -0.000135222 3.29274E-05 4.94776E-05 -2.55732E-05 3.14043E-06 1.68744E-06 -0.000132299 0.000142496 4.32233E-05

SC

M AN U

0.000129253 5.66599E-05 5.24734E-05 -4.89892E-05 -3.92029E-05 -7.67996E-06 -0.000134205 -1.61256E-05 3.6428E-05 6.53168E-05 1.25359E-05 4.01003E-05 0.000147036 -2.58809E-06 3.55025E-05 -9.69692E-05 3.94397E-05 1.685E-05 -6.37248E-06 -3.99801E-05 4.42351E-05 8.89837E-06 -7.00041E-05 0.000108255 3.40747E-05 -0.000167436 -2.8003E-05 4.11192E-06 -5.14942E-05 -2.71273E-05 1.35009E-05 8.72429E-05 8.10154E-05 -4.81095E-05 -5.04514E-05 -0.000144051 -9.96896E-05 -5.29557E-05 -7.32717E-05 -2.48833E-05 5.73417E-05 3.49146E-05 -5.03728E-05 -5.40747E-06 -5.41722E-06 6.14412E-05 -5.40085E-06 -5.41639E-06 6.0733E-05 -5.37328E-06 -2.11225E-05 5.05742E-05 -0.000180432 9.68824E-05 9.17908E-06 -7.29818E-05 -3.10631E-05 7.79173E-05 -0.000128244 -5.52802E-06 3.92357E-05 0.000107339 9.61056E-05 4.72379E-05 1.28046E-05 -2.56182E-06 6.33817E-07 -8.57976E-05

RI PT

ACCEPTED MANUSCRIPT 4.26414E-05

EP

0.000692145 0.000136087 2.65649E-05 0.000648906 0.000101178 0.000334206 0.000528026 0.000662428 0.00026608 0.00023432 3.33164E-05 0.000758944 0.000193689 0.000578965 7.36912E-06 6.42438E-05 0.000640742 6.68468E-05 0.000245642 0.000175641 0.000115922 1.74082E-05 5.93609E-06 0.00044397 0.000491495 0.000185413 0.000859114 0.00010383 0.000200617 0.000224283 0.000782316 0.000294617 8.3161E-05 0.000259396 7.03408E-05 8.43722E-05 0.000769623 0.001122608 0.000517183 0.000442294 0.000131606 0.00021684 2.31254E-05 0.000318877 0.000206481 0.000206347 0.000596121 0.000206363 0.000206347 5.58699E-05 0.000206332 7.91025E-05 0.000121297 0.000600616 7.27699E-05 1.63074E-06 0.000439237 0.000108151 6.85529E-05 0.000554743 0.000206869 3.46345E-05 0.000118247 7.9782E-05 1.16597E-05 4.82036E-06 0.000203522 0.000479041 0.000648252

AC C

K07335 K03543 K07316 K00175 K07448 K01155 K02217 K04041 K06113 K06167 K01916 K01442 K00666 K03704 K01905 K06138 K00031 K11202 K03773 K01858 K03503 K06906 K08724 K07124 K03453 K01197 K07636 K11031 K01585 K03931 K05970 K00657 K04653 K02437 K00171 K09769 K05833 K02469 K01815 K05936 K09939 K07150 K07048 K11927 K00342 K00340 K00174 K00330 K00339 K00547 K00341 K10012 K01463 K09691 K02053 K02059 K05934 K01497 K00358 K13747 K00337 K01226 K00574 K02843 K13920 K08965 K00343 K06958 K09825

0.000196304 0.000196616 0.000198847 0.000200256 0.000201023 0.000204012 0.000204132 0.000204132 0.000205384 0.000205384 0.000205736 0.000210443 0.000213793 0.000214038 0.000217283 0.000218127 0.000221286 0.000225042 0.00022884 0.000230448 0.000232881 0.000233753 0.000236558 0.0002386 0.000241441 0.000241441 0.000242236 0.000243956 0.000243956 0.000245701 0.000249509 0.000249886 0.000249886 0.000250343 0.000250843 0.000254443 0.000254443 0.000254443 0.000254947 0.000256959 0.000256959 0.000264495 0.000264747 0.000266957 0.000267018 0.000267303 0.000267303 0.000267303 0.000267303 0.000267724 0.00026855 0.000268662 0.000271524 0.000271524 0.000271524 0.000273546 0.000273613 0.000277135 0.000282547 0.000284761 0.000284942 0.000296789 0.000297553 0.000298312 0.000298565 0.000301834 0.000306003 0.000306168 0.000310187

TE D

-4.09578E-08 0.000133161 0.000257285 -0.000102258 3.49399E-06 3.7347E-05 0.000136346 0.000131524 0.000153912 0.000121934 -2.7998E-05 -0.000210666 7.50293E-05 0.000117267 0.000102953 -8.78188E-07 -8.56072E-05 0.000211278 6.67993E-07 -4.0091E-05 -9.31692E-05 2.97771E-05 2.49914E-05 2.49914E-05 -6.117E-05 0.000204299 -9.22392E-05 0.000116067 -1.68311E-06 0.000115946 -0.000120324 -9.87701E-06 2.33369E-05 -5.36866E-05 3.577E-05 -0.000188784 7.83901E-05 1.12627E-06 0.000122354 -0.000135961 -7.61908E-05 -7.4481E-05 0.000178289 0.000107628 5.55663E-05 -9.81152E-06 0.000131399 -4.21026E-06 5.43398E-05 7.36294E-06 0.00020012 -0.000275776 -0.000128403 -7.61884E-05 -0.000914316 1.5388E-06 0.00010909 -9.2732E-06 1.63432E-05 -0.000147332 0.000199781 -3.0728E-05 -0.000178699 -7.68199E-06 5.96023E-05 1.63749E-05 -0.000190073 9.98141E-05 -0.00019763

SC

M AN U

-2.18433E-05 -0.000173813 7.31758E-05 4.71902E-05 2.24372E-05 -1.22159E-05 -5.2792E-05 -0.000204593 -0.000102126 3.4178E-06 -8.34833E-07 -9.97254E-05 -2.3883E-05 -4.09764E-05 -6.97559E-05 7.09982E-05 0.000143829 8.79231E-06 8.93907E-05 6.42102E-05 7.48559E-05 3.33746E-05 3.33746E-05 4.49844E-05 7.08894E-05 -2.88089E-05 1.87481E-05 -6.92184E-05 -6.60599E-05 -0.000133385 8.03994E-05 -0.000101989 8.36077E-05 5.78193E-05 -7.77422E-05 8.8876E-06 1.16886E-05 -3.43885E-05 1.01736E-05 8.61829E-05 7.71793E-05 -4.92026E-05 5.55099E-05 -9.88425E-05 5.23959E-05 6.41728E-06 3.22827E-05 0.000106138 -4.27395E-05 7.718E-07 5.64907E-05 -9.3845E-05 7.57673E-05 3.46314E-05 -4.56363E-05 9.20416E-05 0.000110611 6.01582E-06 4.31351E-05 -9.32606E-05 9.78896E-05 -3.74864E-06 7.29588E-05 6.31747E-05 4.96163E-05 0.000147617 3.43966E-06 -3.81113E-05

RI PT

ACCEPTED MANUSCRIPT 3.42119E-07

EP

1.01623E-07 0.000498056 0.001767697 0.000784927 1.18073E-05 2.27205E-05 0.000286744 0.000324346 0.000616843 0.000520367 1.83627E-05 0.000340669 0.000851416 0.000157267 0.000355435 0.000115075 0.000452436 0.00057181 2.24616E-06 8.0737E-05 0.000241803 8.88075E-05 1.5591E-05 1.5591E-05 9.66403E-05 0.000569476 0.000108719 0.000212 0.000112941 0.000445803 0.001680803 6.55248E-05 0.000281556 0.00042768 0.000671818 0.000556422 0.00016692 4.46509E-06 0.000496248 0.00029076 0.00028699 0.000317871 0.000459945 0.000135879 0.000652303 4.35227E-05 0.000459742 1.05729E-05 0.00015891 6.01797E-05 0.000624454 0.000712982 0.000456662 0.000196015 0.005224979 6.37791E-05 0.000144484 0.000449887 4.68363E-06 0.000250791 0.00086139 0.00020527 0.000747758 4.96784E-05 6.74279E-05 3.15114E-05 0.000342829 0.000191092 0.000241889

AC C

K08256 K06024 K02030 K04096 K13919 K10979 K06940 K01786 K07284 K00965 K08717 K01623 K03524 K03480 K07012 K00172 K05592 K02435 K12995 K03295 K07106 K02499 K10537 K10539 K09793 K02304 K02858 K02765 K00169 K01678 K01915 K01878 K06411 K00796 K00287 K05946 K02443 K06446 K09762 K11105 K03321 K04751 K01626 K10041 K01754 K07062 K12574 K11102 K00997 K07717 K01997 K01686 K03786 K03594 K02004 K06714 K01239 K03340 K07650 K01787 K03574 K00833 K00661 K02067 K03481 K06904 K09704 K02007 K07221

0.000310314 0.000310314 0.000314602 0.000320803 0.000325904 0.000326466 0.000331709 0.000332068 0.000334164 0.00033425 0.000335863 0.000337203 0.000338699 0.000338699 0.000346689 0.000364495 0.000377151 0.00038272 0.000383171 0.000388816 0.00038951 0.000393352 0.000393352 0.000393352 0.000395581 0.000396138 0.000401189 0.000405724 0.000405724 0.000407353 0.000411783 0.000416119 0.00041621 0.000416731 0.000416879 0.000417264 0.000417737 0.000419369 0.000420187 0.000435823 0.000441194 0.00044575 0.000449436 0.000455483 0.000459359 0.000466845 0.000466845 0.000469829 0.000471433 0.000474472 0.000475114 0.000475452 0.000477197 0.000477398 0.000477903 0.00047914 0.00047977 0.000487163 0.000498546 0.000506505 0.000516642 0.000520295 0.000520951 0.000522578 0.000524456 0.000524752 0.000533421 0.00053474 0.000538267

TE D

-2.46013E-05 -0.000104557 -9.23378E-05 3.78775E-05 6.51738E-06 0.000193059 2.45684E-05 4.35099E-05 7.02441E-05 0.000114984 2.27712E-05 0.000118684 -0.000148757 -5.51989E-05 5.93686E-05 0.000148325 5.88685E-05 0.000182019 -3.33667E-05 3.63367E-05 0.000133873 3.59628E-05 -4.19111E-05 0.000137918 -4.90228E-05 1.9269E-05 -2.58135E-05 -9.9095E-05 2.74766E-05 3.14086E-05 -2.42068E-05 5.20958E-05 0.000173748 -0.000107205 0.0002149 0.000131422 -7.52827E-05 -0.000209417 -5.96483E-06 7.40023E-05 3.98013E-05 0.000115056 2.09791E-06 1.68833E-05 4.63894E-05 0.00027926 0.000121092 -9.33764E-05 -2.45522E-05 8.56649E-05 5.64217E-06 0.000202767 0.000107883 -0.000109126 -9.86275E-05 3.13129E-05 6.25937E-05 2.26178E-05 -6.32234E-05 4.87094E-05 -9.10735E-05 3.06056E-05 -1.86201E-05 -4.59512E-05 8.0578E-05 2.49598E-05 -0.000131537 0.000204577 -3.93729E-05

SC

M AN U

-2.41683E-05 -5.56925E-05 -8.61521E-05 4.68015E-05 -4.17013E-05 3.46448E-05 0.000128915 -9.71767E-05 -5.39894E-05 -9.02295E-05 -4.61287E-05 3.2122E-05 -7.04627E-05 6.29254E-05 -5.37754E-05 -5.50547E-05 -0.000164643 -0.000140886 -8.60793E-05 -1.79131E-05 -6.30793E-05 -9.95505E-05 7.06745E-06 -0.000111997 8.43377E-05 0.000113312 -1.8371E-05 3.07016E-05 7.85109E-05 6.02039E-06 5.13909E-05 -4.93349E-05 -1.80067E-06 -2.77614E-05 2.48325E-06 0.000127082 -0.000114362 -0.000104908 2.98793E-05 -9.83117E-05 2.54353E-05 7.11348E-07 -5.21753E-07 -9.06952E-05 -0.000103546 -9.98278E-05 -0.000136151 7.09482E-05 -4.31672E-06 -0.000177275 -7.01442E-05 -0.000110151 -4.08465E-06 -1.17671E-05 3.18749E-05 -7.17851E-05 -0.00012269 3.94918E-05 -9.36599E-05 -3.74387E-05 -8.66291E-05 0.000123966 4.29184E-05 8.06752E-05 7.73129E-05 -2.73128E-05 1.01426E-05 5.75824E-05

RI PT

ACCEPTED MANUSCRIPT -0.000122439

EP

0.000837939 0.000115661 0.000813979 0.000164369 1.24719E-05 0.000401428 2.3322E-05 7.63145E-05 0.000357967 0.000326798 0.000761348 0.000440844 0.000904176 0.000678743 6.2493E-05 0.000347508 0.000246229 0.001386447 0.000842085 0.000160683 0.00042791 0.000154973 0.000602754 0.000434074 0.000529808 7.22297E-05 0.000119482 0.000108739 1.83578E-05 7.74739E-05 1.69171E-05 5.22418E-05 0.000347234 0.000146262 0.000699897 0.000332126 0.000114451 0.000876449 0.000648383 8.64011E-05 0.000232078 0.000137437 9.79206E-07 1.08494E-05 0.00025999 0.000635819 0.00040002 0.000960393 0.000563055 0.000152802 0.000926006 0.000701866 0.001459625 0.000133756 0.00011564 3.19958E-05 0.000188422 0.000950686 8.68462E-05 0.000260893 9.8963E-05 0.000160008 0.000141492 7.13758E-05 6.4407E-05 7.34806E-05 0.000257892 0.001487529 9.47051E-05

AC C

K01939 K03444 K00761 K02048 K09778 K02058 K06384 K03326 K09777 K03706 K03737 K01571 K00951 K07082 K00880 K10190 K06283 K03686 K01885 K02046 K01839 K05337 K00759 K02237 K08978 K01304 K07791 K13002 K01247 K03429 K13019 K09963 K13940 K01433 K06148 K07023 K13652 K06926 K01854 K02598 K06284 K02431 K06386 K09703 K10200 K01182 K07216 K01262 K00560 K01726 K01734 K07402 K03498 K01492 K09132 K02819 K03407 K02112 K00275 K10542 K01514 K02045 K01138 K01667 K06016 K03830 K06001 K04069 K09181

0.00054665 0.000552277 0.00055632 0.000561568 0.000567126 0.000580173 0.000581277 0.000582079 0.000583249 0.000585107 0.000585107 0.000591824 0.000591824 0.000592034 0.000607065 0.000615831 0.000620384 0.000626678 0.000631939 0.000639093 0.00065607 0.000668776 0.000672791 0.000672791 0.000672791 0.000685926 0.000696554 0.000711011 0.000711478 0.000713081 0.000716723 0.000716723 0.000723815 0.000739775 0.000744527 0.000748514 0.000749703 0.000750419 0.000756327 0.000758944 0.000765057 0.000785628 0.000786718 0.000798191 0.000798551 0.000801582 0.000804975 0.000810586 0.000810586 0.000827338 0.000827338 0.000831087 0.000832246 0.000837298 0.000841416 0.000849536 0.000850223 0.000852873 0.00085715 0.00085715 0.000869547 0.000870106 0.000870106 0.000872099 0.000873809 0.000875822 0.000883829 0.000899006 0.000904463

TE D

2.17764E-05 3.24852E-05 -1.05347E-09 -1.05347E-09 2.30736E-05 1.00357E-05 -8.39312E-05 4.41471E-05 1.39327E-05 -0.000107412 -8.08874E-06 9.99744E-05 -0.000171117 2.00148E-05 8.72495E-05 2.25575E-05 2.25547E-05 -0.000183117 -0.000180935 -0.000134734 -6.13897E-05 9.98953E-05 3.00401E-05 4.8887E-05 -6.97079E-05 0.000167321 0.000124102 -3.60008E-05 -2.03322E-06 2.12327E-05 -0.000144491 0.000113167 -0.000243664 0.000201567 0.000139307 -0.000114826 5.3975E-05 3.57694E-05 -5.29019E-06 3.43047E-06 6.66399E-05 7.00511E-05 -0.000145624 0.000185391 5.41432E-05 -1.71604E-05 3.74678E-05 7.6106E-05 2.6064E-05 1.90659E-05 4.79399E-05 7.10212E-05 2.8114E-05 -0.000149376 5.21864E-05 0.000158994 -8.67123E-05 5.56525E-05 -0.000102891 2.97516E-05 1.30932E-05 6.88943E-05 1.71489E-05 -0.000214362 -1.32304E-09 -0.000135804 9.73029E-05 -5.24435E-05 9.19441E-05

SC

M AN U

3.24419E-05 2.78369E-08 2.78369E-08 2.43153E-05 4.38327E-05 -3.86033E-05 4.10732E-05 -3.10937E-06 4.11747E-05 9.57689E-05 7.74249E-05 6.26948E-05 4.7469E-05 5.79034E-05 -0.000120484 -0.000120474 -0.000138035 -5.0004E-05 6.38483E-05 0.000127929 1.72575E-05 5.92719E-05 -1.84561E-05 -0.00014978 4.13018E-05 5.22559E-05 2.74018E-05 6.83703E-05 3.38349E-05 -2.19678E-05 7.27657E-06 6.13062E-05 -8.46749E-05 6.87449E-05 7.01987E-06 -7.00378E-05 0.000175401 -4.36555E-05 -4.24382E-05 -5.88103E-07 -9.23226E-05 -1.72665E-05 1.47431E-06 -9.80818E-05 -7.07573E-05 4.77192E-05 6.06961E-05 8.89171E-05 3.77369E-05 -9.37795E-05 -0.000121474 8.88321E-05 4.14646E-05 -1.54736E-05 -6.05645E-05 2.19727E-05 -7.91871E-05 -4.09681E-05 3.40512E-05 3.20489E-05 -1.58989E-05 -0.00010017 -2.35677E-05 2.85338E-08 -1.05855E-05 -0.000296435 3.81673E-05 -3.33559E-05

RI PT

ACCEPTED MANUSCRIPT 3.14113E-05

EP

1.65715E-05 2.72326E-05 4.4211E-09 4.4211E-09 1.57E-05 2.66845E-05 0.000102565 4.35071E-05 7.85313E-06 0.000332357 0.00051063 0.000265743 0.000573611 2.99375E-05 0.00069219 0.000950766 0.000950756 0.001121414 0.000236947 0.000148438 0.000437495 0.000167357 6.42063E-05 6.33447E-05 0.001431127 0.0002716 0.000274855 4.50161E-05 3.75709E-05 2.40314E-05 0.000316399 0.00042987 0.001226262 0.000806105 0.000482918 0.000203295 0.000173388 0.000292941 5.62156E-05 6.50113E-05 0.00011386 0.000428446 0.000274213 0.001652354 0.000248579 0.000722225 2.93643E-05 0.000255217 5.42547E-05 2.08234E-05 0.000222524 0.000719909 5.34776E-05 0.000344232 6.1393E-05 0.001175365 0.000133904 0.000182775 0.00015866 2.00836E-05 2.11478E-05 8.36063E-05 0.00014018 0.000879143 4.53179E-09 0.001029943 0.000518074 6.28988E-05 0.000282086

AC C

K10213 K04030 K10552 K10553 K03471 K00996 K01730 K07343 K04784 K02614 K01657 K01749 K00525 K07741 K02346 K02115 K02114 K14652 K13821 K08961 K06199 K12992 K10026 K05297 K01740 K07467 K05813 K00691 K02446 K00002 K09760 K03060 K06871 K01989 K02071 K01081 K02652 K04042 K11711 K09989 K04023 K06209 K01895 K01703 K05795 K02990 K03300 K01273 K02054 K12507 K00575 K00864 K02052 K01212 K00197 K01652 K03286 K03563 K07304 K09788 K00034 K13954 K06295 K01572 K10554 K03701 K07813 K11381 K07130

0.000904463 0.00090678 0.00090678 0.00090678 0.000910096 0.000916794 0.000918651 0.000919542 0.000956356 0.000960697 0.000965982 0.000971381 0.000984667 0.001029341 0.001032928 0.00103834 0.001038755 0.001060188 0.001065948 0.001066223 0.001077348 0.00108023 0.001088954 0.001090104 0.001104068 0.001109082 0.001109082 0.00111096 0.001127952 0.001130872 0.001141845 0.001171815 0.001176811 0.001188573 0.001188573 0.001190831 0.001208999 0.001213113 0.001213426 0.001221989 0.001225316 0.001232351 0.001236733 0.00124381 0.001260077 0.001260881 0.001274397 0.001296961 0.001325614 0.001328148 0.001333182 0.00133585 0.001338364 0.001339279 0.001340235 0.001341198 0.001341198 0.001345127 0.001345389 0.001354468 0.001380457 0.00138067 0.001383154 0.001404133 0.001409996 0.001424206 0.001451577 0.001467638 0.001478174

TE D

3.08757E-05 1.90459E-05 -0.000110152 -1.57937E-05 3.56534E-06 5.16589E-05 -7.99798E-06 5.16829E-05 9.11493E-05 -0.000108544 1.44911E-05 -1.44768E-05 6.6573E-05 7.69454E-05 4.52606E-05 -0.000116257 2.1321E-05 0.000124597 9.27272E-06 0.000221752 0.000100305 0.000232812 -6.34291E-05 0.000116555 6.41132E-05 -2.89325E-10 -2.89325E-10 -0.000202867 1.17193E-05 2.32892E-09 0.000114105 0.000101539 1.70526E-05 9.23053E-05 -0.000447472 5.2E-05 7.03611E-05 -0.000135518 0.000133714 3.95457E-05 0.000108586 -0.000129185 0.000534623 1.29157E-05 2.84966E-05 7.62838E-05 -4.15009E-05 7.9218E-05 2.40251E-05 9.33207E-05 -3.0938E-05 2.01348E-06 0.000108858 -1.80798E-10 -1.80798E-10 7.96763E-05 3.59919E-05 0.000254925 2.77433E-05 -7.47969E-05 4.30335E-05 2.97226E-05 0.000133366 -2.04942E-05 9.8852E-05 0.000183486 2.21328E-06 0.000167705 3.31832E-05

SC

M AN U

-0.000136701 3.9437E-05 -5.255E-05 1.97258E-05 -1.54136E-05 -5.78587E-05 3.66222E-05 5.75106E-05 6.20064E-05 1.01691E-05 8.94722E-05 -1.13434E-05 -3.53653E-06 -9.40707E-05 -1.60776E-05 4.39479E-05 -4.74319E-06 3.53574E-08 -6.24677E-05 -1.61605E-06 8.15116E-05 0.000108115 -2.43802E-05 -1.47271E-05 2.31229E-08 2.31229E-08 2.68511E-05 -5.97679E-05 1.92334E-08 -2.16503E-05 1.44204E-05 4.20804E-05 -4.10501E-05 -0.000123159 2.98856E-05 -5.37992E-06 -6.55653E-05 1.32898E-05 2.90971E-05 2.23576E-05 -3.31127E-05 5.57247E-05 2.88523E-05 -0.00011506 6.38744E-05 9.95102E-05 3.84753E-05 2.79384E-05 -9.13623E-05 5.85996E-05 3.97486E-07 -1.75797E-05 2.17315E-08 2.17315E-08 5.17249E-06 4.56693E-05 -0.001053699 -8.26768E-05 5.60618E-05 8.81059E-05 2.00296E-05 -3.34819E-05 -6.97015E-05 2.5924E-05 -6.71493E-05 1.10915E-06 -4.27804E-05 3.68894E-05

RI PT

ACCEPTED MANUSCRIPT 2.00259E-05

EP

2.16057E-05 0.000209243 0.000249285 6.54326E-05 9.12331E-06 6.0959E-05 9.09288E-05 5.60681E-05 0.000167586 0.000343387 4.21709E-06 0.000534403 0.000128655 0.000117252 0.000265068 0.000431856 2.26565E-05 0.000469216 -1.84779E-09 0.000297979 0.000376505 0.000700018 0.001186568 0.000255108 9.5673E-05 4.32664E-09 4.32664E-09 0.000272039 0.000683172 1.54582E-09 0.000251406 0.000171115 2.05678E-05 0.000214416 0.000882096 1.84622E-05 0.000114529 0.000938416 0.000353998 4.1841E-05 0.000196927 0.000283839 0.003311448 1.24189E-05 0.000942089 5.6534E-05 0.000132703 0.000107874 1.35153E-05 0.001703441 6.20478E-05 1.49589E-06 0.000462637 4.32399E-09 4.32399E-09 0.000128034 3.06875E-05 0.002184843 0.000156511 0.000219556 0.000194633 2.35765E-05 0.000430874 0.000716 0.000202474 0.000595502 1.54228E-06 0.001727517 3.57543E-05

AC C

K09123 K11104 K00605 K01659 K08986 K00194 K07775 K01042 K00087 K07507 K10984 K00766 K07406 K02278 K10541 K01579 K12111 K07040 K01199 K14138 K06042 K02434 K03711 K06404 K12941 K11357 K13582 K07075 K07560 K00596 K06403 K02547 K00094 K09759 K09955 K07486 K09692 K01662 K08316 K06998 K06298 K00812 K02529 K02538 K02110 K10710 K04761 K02444 K04844 K11754 K07118 K03680 K03789 K00808 K10564 K06391 K01002 K03406 K02047 K00633 K04652 K09128 K00335 K03550 K04028 K02283 K06995 K01534 K02526

0.001478983 0.001478983 0.001487348 0.001507397 0.001515948 0.001532021 0.001533473 0.00153656 0.00154588 0.001559744 0.001583435 0.00158367 0.00159228 0.001636496 0.001649479 0.001665136 0.001699007 0.001699007 0.001699007 0.001699007 0.001699761 0.001700204 0.001710963 0.001727558 0.001747018 0.001748485 0.001748485 0.001748485 0.001764228 0.001774856 0.001784025 0.001805659 0.001811215 0.00181346 0.001820831 0.001853398 0.001854935 0.001874184 0.001874184 0.001908303 0.001908303 0.001925472 0.001925472 0.001925472 0.001937288 0.001937288 0.001954386 0.001958927 0.001982774 0.001985617 0.001991742 0.002061861 0.002061861 0.002061861 0.002061861 0.002067505 0.002069768 0.002089993 0.002094856 0.002095958 0.002095958 0.002102555 0.002121036 0.002138419 0.00214554 0.002152525 0.002215661 0.002258375 0.002282015

TE D

0.000129579 2.96797E-06 7.62876E-05 -8.29921E-06 -1.05216E-05 2.35097E-06 0.000116461 2.64343E-05 -3.21772E-09 -3.92719E-05 -4.09536E-06 2.57443E-05 -0.000157261 9.48089E-05 5.89327E-05 5.524E-05 1.49481E-05 2.28232E-05 2.28869E-05 -4.64428E-05 -0.000112626 -0.000295539 -0.000103396 2.77277E-05 3.54903E-05 5.12662E-08 -0.000178498 2.07907E-05 -3.59417E-05 0.000136784 0.000168103 -0.000112912 6.32049E-05 0.000183322 -2.52098E-09 0.000105855 2.47818E-06 -1.58924E-05 9.52426E-05 -0.000105354 6.87163E-05 -8.2404E-05 0.000118461 0.000167939 1.67409E-05 2.90367E-05 4.01334E-05 -0.000208708 0.000106062 -7.56789E-08 6.76952E-05 9.34824E-05 -0.000168447 6.29822E-05 2.75258E-05 -4.11505E-05 3.80154E-05 4.46153E-05 0.000103603 7.21495E-05 6.6103E-10 -7.63215E-05 -9.67002E-05 1.09442E-05 -0.000154381 9.10775E-05 4.27218E-05 -2.66802E-05 -3.55619E-05

SC

M AN U

1.11623E-06 5.49318E-05 7.46966E-05 -0.000118287 9.00461E-06 5.82489E-06 6.92394E-05 1.66773E-08 -8.71517E-05 6.64595E-05 -1.42807E-05 -6.5938E-05 -6.1777E-05 7.34282E-08 5.62353E-05 3.80135E-06 2.49417E-05 9.48455E-06 6.89079E-05 -1.88835E-06 -3.63082E-05 -1.04697E-05 2.08664E-05 2.05917E-05 5.76968E-07 -6.03307E-05 3.35826E-05 0.000108631 -5.88323E-05 3.53662E-06 -0.000212006 2.23882E-05 3.91E-05 3.41225E-08 -1.36102E-05 0.000124575 -7.17465E-05 -5.6947E-05 -6.91705E-06 -6.87496E-05 -7.75486E-05 -4.46104E-06 4.60577E-06 -6.14016E-05 2.85665E-05 -4.11038E-05 5.93059E-05 -6.62216E-05 5.35748E-07 5.90752E-05 5.62667E-05 -0.000119583 -0.000122404 -9.82775E-05 -0.000116916 4.18499E-05 3.16168E-05 -5.30974E-05 0.000113025 1.80721E-08 -0.00011065 7.97644E-06 -7.76468E-05 -9.54526E-05 5.90254E-05 -0.000114192 -9.56243E-05 8.18158E-05

RI PT

ACCEPTED MANUSCRIPT 0.000110409

EP

0.000202884 9.86278E-07 6.85179E-05 3.86463E-05 0.001432855 6.50935E-06 0.000444142 0.000113139 3.47922E-09 0.00060483 3.9464E-05 2.50073E-05 0.00027633 0.00033846 8.79497E-05 6.60503E-05 9.44473E-06 1.24013E-05 1.45085E-05 0.000600506 0.00028811 0.000852874 0.000148934 1.74901E-05 2.8648E-05 3.19777E-08 0.00065491 3.9916E-05 0.000270659 0.000353483 0.00057519 0.001087495 7.63113E-05 0.001275326 6.79337E-09 0.000260394 0.000189212 0.000138085 0.000428226 0.000190954 0.000202076 0.000553442 0.00049202 0.000572786 0.000705804 2.42467E-05 9.26215E-05 0.000761267 0.000480001 8.89623E-08 5.14512E-05 0.000207481 0.001127893 0.000292974 0.000167355 0.000435388 6.67148E-05 3.40714E-05 0.00041554 0.000242827 2.97353E-09 0.001017759 0.000146704 0.000859199 0.000926114 0.000233499 0.000293719 0.000697267 0.000599804

AC C

K02010 K11694 K01232 K01156 K00145 K09004 K06346 K04655 K00570 K01914 K09949 K02566 K07248 K07033 K02777 K03769 K01777 K01423 K02771 K07043 K01144 K01811 K01966 K10555 K06015 K03329 K00638 K07749 K00526 K03700 K01995 K07052 K05305 K02495 K00220 K11184 K01531 K00563 K11928 K08641 K06987 K11069 K07166 K01996 K03978 K06888 K09706 K01424 K03856 K06216 K01295 K09121 K11752 K02422 K14059 K03312 K10797 K02510 K00284 K03311 K10235 K01738 K01235 K02109 K00067 K06864 K02334 K03152 K03075

0.002283575 0.00229208 0.002295359 0.002333996 0.002333996 0.002337403 0.002337403 0.002338691 0.002415722 0.002417632 0.002417632 0.002419085 0.002444175 0.002444175 0.00244956 0.002496579 0.002523429 0.002532939 0.002534721 0.002537798 0.002545008 0.002553171 0.002637208 0.002679999 0.002686387 0.002704306 0.002709138 0.002715535 0.002715871 0.002715871 0.002732322 0.002733524 0.002734113 0.002734721 0.002749814 0.00276658 0.002796432 0.002797864 0.002808879 0.002812153 0.002812255 0.002836459 0.002850227 0.002850227 0.002908971 0.002994407 0.003013934 0.003035244 0.003036146 0.003043917 0.003076745 0.003092212 0.003093561 0.003118561 0.003142566 0.003148945 0.003148945 0.003148945 0.003203624 0.003212057 0.003216505 0.003218815 0.00323781 0.003246705 0.003296372 0.003364441 0.003373051 0.003403385 0.003414056

TE D

-0.000215667 0.000123921 0.000140602 7.33782E-06 -5.34843E-10 -5.34843E-10 7.69906E-06 3.35565E-05 -1.11079E-05 0.000154516 0.000104685 8.50847E-05 4.60966E-05 -9.5608E-05 4.13494E-05 9.47617E-05 -3.23094E-05 1.39279E-05 -0.000136139 2.23694E-05 -0.000231003 2.21417E-05 0.000115217 9.8161E-05 7.98831E-05 -0.000159393 1.69209E-10 -2.90497E-05 -0.000173818 4.96622E-05 -1.93188E-05 1.58059E-05 -0.00012657 2.98658E-05 7.82463E-07 -9.11051E-06 7.97756E-05 7.90055E-06 2.17326E-05 -9.23492E-05 -3.61302E-06 -0.000141848 3.96058E-05 -3.84763E-05 -2.69124E-09 5.07581E-05 2.76374E-05 0.000109978 0.000223407 0.000103439 -9.28338E-06 2.28864E-05 3.78654E-05 3.06108E-05 2.49297E-05 7.80842E-05 -4.70534E-09 -9.91705E-05 1.33261E-05 4.43606E-05 -5.98949E-05 -6.61223E-08 3.89376E-09 8.4607E-05 -8.21342E-05 3.09269E-05 0.000114882 4.18495E-05 9.61622E-05

SC

M AN U

-3.25748E-05 -8.56184E-05 6.53197E-05 2.45805E-08 2.45805E-08 -5.9707E-05 2.35089E-05 -0.000135649 -5.23464E-05 -5.4563E-05 -5.85912E-05 6.1313E-05 -2.36362E-05 1.2487E-05 2.2345E-05 -9.97571E-05 4.19649E-05 -8.42098E-05 2.6346E-05 -0.000112921 2.40691E-05 3.87528E-05 -4.57194E-05 3.6393E-07 -5.93774E-05 1.79259E-08 5.71675E-05 4.64861E-05 3.81709E-05 -8.01041E-05 2.57491E-07 -8.30855E-07 4.27676E-05 9.33459E-06 -0.000112978 -9.21509E-05 -0.000115438 2.38793E-05 -3.31079E-05 2.56342E-05 -0.000119219 2.6103E-05 -9.87464E-05 1.78611E-08 4.8638E-05 2.13391E-05 -7.62872E-06 7.15089E-05 2.18203E-05 8.44112E-05 -9.40565E-05 8.61301E-05 8.00995E-05 5.4315E-05 -6.29575E-05 1.60215E-08 -5.96946E-05 3.87837E-05 -5.45419E-05 3.49419E-05 2.83994E-07 7.08059E-08 -5.09199E-06 4.66086E-05 -6.30837E-05 -2.75029E-05 -9.426E-05 -2.38894E-05

RI PT

ACCEPTED MANUSCRIPT 4.19387E-05

EP

0.000222018 0.000515448 0.001795985 7.50576E-05 4.43654E-09 4.43654E-09 7.79458E-05 4.20849E-05 0.000917179 0.000981916 0.000563336 0.000439353 5.3416E-05 0.000235226 2.8216E-05 0.000293927 0.000800729 3.00017E-05 0.000868665 1.21812E-05 0.002395751 1.29962E-05 0.00047334 0.000293272 0.000962463 0.001469086 4.31747E-09 5.04078E-05 0.000838452 3.57013E-05 0.00061835 1.12163E-05 0.000232898 2.93108E-05 3.99491E-06 0.00143955 0.000248536 0.000202199 1.31608E-05 0.000402911 1.17128E-05 0.000308027 2.59958E-05 0.000718821 4.49656E-09 5.2297E-05 3.19972E-05 0.000378168 0.000719548 0.000293136 7.80122E-05 0.000793124 0.000133045 5.17354E-05 5.91822E-05 0.000986308 6.05508E-09 0.000307156 2.87387E-05 8.09367E-05 0.000562173 1.06807E-07 1.54164E-08 0.000273261 0.000590557 0.000120903 0.000635586 0.000440191 0.000382295

AC C

K01205 K03502 K01091 K03072 K13589 K13592 K09974 K03451 K00788 K00891 K03431 K02189 K01426 K03430 K00803 K03637 K03525 K03476 K00973 K01668 K01834 K01003 K02072 K06182 K00948 K06950 K13503 K06996 K00648 K13927 K07444 K02312 K03770 K03973 K13921 K00930 K03826 K14534 K00132 K03778 K12554 K01666 K02083 K04079 K13623 K00359 K03338 K06972 K02433 K01788 K06859 K02238 K00872 K02055 K02445 K03544 K13772 K03719 K09384 K02662 K03575 K12503 K01707 K06206 K02371 K03666 K00763 K09690 K03639

0.00343139 0.003436052 0.003452098 0.003534003 0.003534003 0.003534003 0.003552719 0.003572791 0.003607698 0.003617857 0.00362547 0.003627098 0.003631589 0.003637708 0.003670818 0.003691889 0.003703401 0.003715485 0.003751295 0.003770567 0.003770567 0.003815244 0.003815244 0.003887978 0.003887978 0.003900442 0.003900442 0.003910274 0.004000748 0.004088379 0.004088379 0.004089707 0.00410714 0.004107159 0.004123976 0.004132041 0.004176148 0.00418523 0.004239639 0.004298551 0.004306252 0.004335539 0.004344615 0.004391284 0.004435293 0.004486881 0.004486881 0.00461139 0.00466893 0.00466893 0.004730567 0.004794264 0.004809897 0.004885296 0.004896844 0.004933676 0.004959469 0.005008131 0.005009848 0.005009848 0.005028969 0.005140268 0.005142977 0.005176908 0.005191676 0.005217315 0.005234958 0.005243507 0.005258456

TE D

-0.000103286 -0.000182535 -2.38991E-05 0.000161289 1.06593E-05 9.61958E-05 -0.000113266 1.01268E-05 3.3562E-05 3.2032E-05 -2.57233E-09 4.14235E-05 -0.000222363 1.24461E-05 -7.79893E-05 0.000141286 9.34896E-05 0.000110415 1.69469E-07 8.09202E-05 0.000137022 1.28103E-05 6.77077E-11 1.48746E-05 0.000136805 2.81619E-05 1.29832E-05 7.88211E-05 7.66062E-05 1.39307E-05 4.64296E-05 2.73926E-05 1.08353E-06 3.42668E-05 8.71463E-05 9.75598E-05 6.95246E-05 7.29712E-06 -6.17685E-05 -2.12613E-11 -2.45184E-05 3.75922E-05 2.44045E-05 5.13553E-08 -9.94927E-06 6.07428E-05 -3.04389E-09 1.25711E-05 -4.87962E-08 2.41562E-05 2.13103E-05 0.000137448 5.90821E-05 7.53547E-05 -0.000110049 0.000150787 -5.09155E-06 2.24156E-05 1.02159E-05 8.62711E-05 -6.68989E-05 0.000101544 -8.92188E-05 -3.4276E-06 2.17434E-05 1.36341E-05 0.000100841 2.6641E-05 3.31308E-05

SC

M AN U

-3.21615E-05 -8.93562E-05 -2.24927E-05 4.78248E-06 -8.25623E-05 5.15404E-06 7.95327E-05 4.6891E-05 3.86988E-05 1.43872E-08 -0.00014204 -1.22852E-05 2.81054E-05 3.04326E-05 8.94769E-05 -5.79962E-05 -3.06758E-05 -5.68941E-05 -3.45004E-05 3.39744E-05 1.5944E-06 1.494E-08 7.40201E-05 -6.8194E-05 2.44936E-05 -8.8904E-05 -9.32206E-05 -0.000268241 5.40588E-05 4.34517E-05 -4.96435E-05 3.08322E-05 6.53662E-05 6.86985E-05 2.15289E-05 6.75644E-05 -3.97007E-05 8.02973E-05 2.02402E-08 4.47156E-05 4.55522E-05 6.71847E-05 3.65175E-07 -0.000105352 -0.000116583 1.39281E-08 1.65739E-06 9.1555E-07 2.09654E-05 -8.77981E-05 1.69961E-05 1.84515E-05 8.11011E-05 -0.000181177 -1.12931E-05 0.000100464 1.76502E-05 9.86023E-05 -6.64923E-05 4.42936E-05 3.49044E-05 2.24525E-05 -5.57549E-05 2.49555E-05 1.8866E-06 1.24342E-05 2.24174E-05 2.61951E-05

RI PT

ACCEPTED MANUSCRIPT 4.39357E-05

EP

0.000862224 0.00118773 0.000946073 0.000498372 4.15446E-06 0.00085397 0.000360015 7.39842E-05 0.00076891 3.65662E-05 4.43455E-09 0.000456218 0.000790104 1.48569E-05 0.000125168 0.000290093 0.000217876 0.001010942 0.000723385 0.000193256 0.000269608 7.89011E-06 2.76436E-09 0.000101673 0.000412496 2.16219E-05 0.000139808 0.000406223 0.000536293 6.55027E-05 0.000107623 0.000817825 1.21776E-05 4.46714E-05 0.000172864 0.000126195 0.000286016 7.52669E-05 8.30427E-05 5.46279E-09 3.61609E-05 3.47805E-05 8.84708E-05 4.63749E-08 0.000137653 0.000905847 3.47088E-09 7.78933E-06 2.04916E-07 2.83294E-05 0.00071599 0.000321598 0.000101388 0.000186468 0.00183758 0.000600365 0.000121638 2.21758E-05 0.00052835 0.000224663 0.000631469 0.000146155 0.000455451 0.000718037 2.19127E-05 8.34028E-06 0.000149943 2.00262E-05 3.84045E-05

AC C

K02314 K01955 K01586 K03484 K07446 K01953 K00097 K01133 K00215 K02779 K12989 K05919 K01912 K07795 K10852 K02011 K10189 K01687 K07462 K07502 K04031 K10793 K00875 K09002 K12510 K07705 K03697 K00571 K02406 K03389 K06196 K01921 K07272 K12940 K07484 K10039 K07149 K00170 K07239 K01789 K02074 K10545 K07339 K02802 K02302 K00014 K10239 K10795 K02803 K03337 K11072 K01552 K01560 K07047 K00599 K01998 K01251 K05777 K01817 K10188 K02961 K07009 K01812 K00645 K09134 K10796 K10546 K01753 K00385

0.005334845 0.005383185 0.005447387 0.005461652 0.005496891 0.005498602 0.005539227 0.005539227 0.005546947 0.005570342 0.005643238 0.005727414 0.005727414 0.005733799 0.005776239 0.005790343 0.005822161 0.005852203 0.005852203 0.005852203 0.005852203 0.005852203 0.005968328 0.005993684 0.006078282 0.006103725 0.006151803 0.006155912 0.0061719 0.006185804 0.006195433 0.006197187 0.00623287 0.006319716 0.006359331 0.006366021 0.006386698 0.006392268 0.006425823 0.006440479 0.006500172 0.006602296 0.006659443 0.006677828 0.0067936 0.007010315 0.007012968 0.007016015 0.007063975 0.007126135 0.007155363 0.007285451 0.007343239 0.007409302 0.007556034 0.007564782 0.0075828 0.007602037 0.007602037 0.007602037 0.00763521 0.00763521 0.00763521 0.007681367 0.007716015 0.007799569 0.007828176 0.007886361 0.007886361

TE D

-6.48574E-05 3.70354E-05 9.52382E-06 -1.23569E-05 6.80249E-10 4.808E-08 -0.000159078 3.22465E-05 1.56465E-05 -2.19381E-06 1.60697E-05 -7.75974E-05 1.21119E-05 3.37844E-05 1.6508E-05 2.30494E-05 0.000104411 -0.000123832 -4.84481E-05 8.50628E-05 -1.35745E-05 2.71743E-05 4.16443E-05 -3.45847E-05 -9.75506E-05 0.000132703 -5.2524E-05 -9.23691E-06 0.000118472 1.85143E-05 8.51385E-05 -1.41198E-05 3.7587E-09 0.000165207 5.38313E-08 1.01938E-07 -7.92231E-05 -3.53576E-09 -3.53576E-09 -3.53576E-09 -7.35691E-05 8.45671E-05 0.000154103 3.37731E-05 -9.72587E-06 -2.37062E-06 -1.03049E-05 5.99092E-05 2.73822E-06 3.90185E-06 5.72511E-08 -9.81094E-05 0.00010713 -1.47647E-05 3.26314E-05 3.06897E-06 0.000164755 -7.76534E-05 -1.23258E-05 8.1135E-05 -4.0081E-05 -0.000121135 2.22994E-05 1.7156E-11 -5.29285E-05 2.49002E-05 3.56165E-05 1.1212E-05 -3.28235E-05

SC

M AN U

-4.63246E-05 2.85298E-05 -7.80848E-05 1.71185E-08 5.05731E-07 -6.68025E-05 2.75331E-05 1.02872E-05 -5.33803E-05 1.7016E-05 -2.34044E-05 1.3543E-05 -0.000166931 -9.40475E-05 5.57724E-06 -9.23198E-06 -6.03736E-06 -6.06552E-05 4.37725E-06 -6.20745E-05 2.26847E-05 -7.6886E-05 -0.000171617 -6.45663E-05 5.91134E-05 -0.000115642 -7.15696E-05 4.56849E-05 6.2714E-05 -4.93777E-05 -7.70444E-05 1.43356E-08 -2.41374E-05 -5.4757E-05 2.62181E-07 2.26133E-05 1.31527E-08 1.31527E-08 1.31527E-08 3.36039E-05 7.49965E-05 -0.000347054 -5.32656E-05 -7.09932E-05 6.39291E-05 -7.10374E-05 9.38181E-05 -5.56139E-05 2.612E-05 2.89606E-07 5.58165E-06 3.00626E-05 -7.2659E-05 -8.40841E-05 3.38218E-06 -2.82129E-05 -7.32926E-05 -3.62367E-05 -6.2378E-05 -0.000119294 4.83358E-06 2.9347E-06 2.7697E-08 3.06779E-05 5.04577E-05 3.92491E-05 -4.67844E-05 6.91567E-05

RI PT

ACCEPTED MANUSCRIPT 2.18379E-05

EP

0.00066938 9.39961E-05 1.73962E-05 9.23203E-05 3.73131E-09 2.89183E-08 0.001107102 3.74302E-05 1.36268E-05 0.000727839 1.50523E-05 0.000110841 5.0588E-06 0.001639233 0.000110762 6.58692E-06 0.000300822 0.000909926 0.000710651 0.000108951 0.000697109 1.90971E-05 0.000154633 0.002059955 0.00025306 0.00104387 0.000306376 8.8064E-05 0.000339788 3.39008E-05 0.000301006 0.000730911 2.89996E-09 0.000821485 0.000691854 1.41045E-10 0.000397609 4.25008E-09 4.25008E-09 4.25008E-09 0.000183653 0.000294803 0.001178462 0.000837929 8.84971E-05 3.4382E-05 8.85992E-05 0.000235181 0.000734072 6.23818E-06 3.18361E-08 0.00036022 0.000961525 8.40756E-05 0.000194441 1.99823E-06 0.00043119 0.000544263 7.31099E-05 0.000450624 0.000672786 0.000410804 1.7855E-05 5.22347E-09 7.54543E-05 4.65274E-05 5.15818E-05 0.000705945 8.89788E-05

AC C

K02968 K02439 K13252 K00972 K01249 K03279 K00847 K07307 K06608 K06925 K03519 K01023 K03489 K03671 K00702 K06893 K05364 K06158 K01923 K09163 K02038 K01865 K09749 K13789 K01181 K01752 K05995 K09766 K02919 K02549 K11690 K06881 K04940 K07053 K02687 K13243 K03149 K10238 K10237 K10236 K03077 K01436 K07483 K02108 K02404 K00231 K04562 K08974 K09458 K13525 K01908 K00857 K06173 K07777 K06310 K02763 K02438 K03783 K07668 K00111 K07282 K01159 K13892 K00315 K00658 K06910 K10231 K01735 K11741

0.007965535 0.007973097 0.008014409 0.008014409 0.00821322 0.008303534 0.008312453 0.008369531 0.008426626 0.008519574 0.008585326 0.008635195 0.008641567 0.00867572 0.008761249 0.008889525 0.008960428 0.008960428 0.009012379 0.009044559 0.009084844 0.00921778 0.009243185 0.009251601 0.00928348 0.009380402 0.009451164 0.00947957 0.009493637 0.009640606 0.009658083 0.009676141 0.009760078 0.009768053 0.009840486 0.009861022 0.009862851 0.00993727 0.00993727 0.00993727 0.00993727 0.010083759 0.01012385 0.010206092 0.010206092 0.010209742 0.010209742 0.010244998 0.010319982 0.010319982 0.010330163 0.010377896 0.010589781 0.010660277 0.010704892 0.010846873 0.010880177 0.010918012 0.010979407 0.011053766 0.011134757 0.011271622 0.01162765 0.011921595 0.012022752 0.012053202 0.012053202 0.012103063 0.01212965

TE D

-1.19136E-05 -0.000104491 -3.71002E-05 -9.77903E-05 9.21689E-05 -9.94731E-05 -0.00011426 -0.000145124 2.85716E-06 1.5712E-05 4.62868E-05 -7.46363E-05 0.000254772 3.13153E-05 1.35018E-05 7.66556E-05 -5.92702E-05 -2.82607E-05 4.13615E-09 8.57691E-05 -8.54091E-05 4.02444E-05 6.28995E-06 -1.51543E-09 9.61633E-06 -3.24886E-05 0.000109898 0.000263706 6.0185E-05 7.64656E-06 7.11289E-05 -0.00021955 -0.000105455 4.3652E-06 -9.20147E-05 -2.90264E-05 1.89338E-05 1.94882E-06 6.42766E-05 9.58537E-06 9.58247E-06 0.000101565 -1.62651E-05 -3.06357E-05 9.56312E-06 4.62351E-05 0.00010362 5.23078E-06 5.42718E-05 3.9174E-05 1.86759E-05 -1.35355E-09 -6.8654E-05 -2.00642E-05 1.07627E-05 5.95083E-05 -0.000130127 1.07616E-05 -2.1143E-07 9.65319E-05 5.66104E-05 -4.08389E-05 4.35388E-09 6.66087E-05 2.12237E-05 9.18199E-05 5.10043E-05 0.000115038 -8.40222E-08

SC

M AN U

-8.01443E-05 -7.95323E-05 -7.24097E-05 9.96047E-06 -2.03943E-05 -2.26619E-05 -4.07225E-05 -5.7174E-05 -8.67961E-05 2.33702E-05 1.4024E-05 5.04344E-05 -5.82755E-05 2.57508E-05 5.41673E-05 -5.03447E-05 -8.75955E-05 2.68113E-08 7.5595E-05 -1.74121E-05 4.88662E-05 -5.30148E-05 1.51751E-08 3.48332E-06 -7.06978E-05 5.3624E-05 6.01459E-05 -8.45831E-05 -5.23782E-05 -4.63958E-05 9.71208E-06 7.7614E-06 -3.31865E-05 4.03805E-05 7.24361E-05 4.17702E-05 -5.10334E-05 -2.43572E-05 3.6164E-06 3.61482E-06 6.53662E-05 -5.82381E-05 3.63018E-05 3.57896E-06 -2.89135E-05 3.70774E-05 -6.43927E-05 -5.28175E-05 3.02088E-05 -4.16751E-05 1.40941E-08 -4.86496E-05 -9.44138E-05 8.82851E-06 -2.56414E-05 1.47682E-05 8.78192E-06 9.55925E-07 1.85722E-05 -6.49281E-05 4.01836E-05 2.83802E-08 5.56552E-05 -0.000137486 6.22514E-06 -5.26793E-05 4.84393E-05 3.65506E-07

RI PT

ACCEPTED MANUSCRIPT -3.60222E-05

EP

7.27641E-05 0.000457138 0.000628039 0.000560551 0.000361933 0.000446091 0.000596934 0.000226758 0.000702654 0.00055307 8.31521E-05 0.000145638 0.001030046 0.00015694 1.87011E-05 0.000201053 0.000697943 0.000694316 5.07383E-09 0.000121839 0.000333221 6.26326E-05 0.000714475 3.11921E-09 3.95638E-06 0.000626145 0.000547689 0.000602673 0.000823598 0.000714502 0.000375154 0.001294834 0.000347209 6.44724E-05 0.000297333 5.82334E-05 7.66366E-05 0.000705404 7.28197E-05 3.81975E-06 3.81911E-06 0.00040677 0.000687855 5.24767E-05 3.85717E-06 0.000140183 0.000269905 8.79154E-05 0.000144712 3.65939E-05 8.40129E-05 3.14966E-09 0.000109671 0.000310345 3.26282E-06 0.000101012 0.000247744 3.26182E-06 3.50518E-07 0.000279 0.000241882 7.87813E-05 4.66263E-09 0.000189939 0.00028495 0.000246934 0.000136702 0.000217887 1.50004E-07

AC C

K07652 K01362 K11070 K06872 K07461 K01918 K00297 K00647 K02970 K07173 K08302 K09797 K02029 K06934 K10549 K01845 K03687 K06213 K13588 K05350 K01629 K08177 K03650 K10565 K01994 K01770 K02911 K07491 K01808 K03495 K06200 K06889 K01200 K07719 K02775 K00428 K00917 K01493 K07694 K06426 K06418 K01486 K02037 K00844 K06328 K01026 K06898 K09967 K02417 K07704 K00681 K00607 K09474 K07126 K10986 K13626 K07263 K10985 K01541 K02669 K03608 K05367 K06602 K02492 K02396 K07404 K02389 K05878 K12293

0.01212965 0.012275355 0.012276487 0.012319262 0.012444966 0.012467156 0.01258443 0.012601159 0.012821781 0.012839057 0.012891277 0.013029624 0.013058666 0.013082417 0.013137189 0.013196824 0.013255586 0.013282751 0.013282751 0.013302692 0.013308429 0.013476064 0.013481492 0.013481492 0.013511 0.013616071 0.013664566 0.0137361 0.013796184 0.013928259 0.013968036 0.013976093 0.014009579 0.014019232 0.014062343 0.014076669 0.014078809 0.014100741 0.014112152 0.014248794 0.014275242 0.014282077 0.014320321 0.01434118 0.014482983 0.014497449 0.014579252 0.014579252 0.014636695 0.014644492 0.014644492 0.014675901 0.014723514 0.014999579 0.015142242 0.015307789 0.015307789 0.015530646 0.015684295 0.015759696 0.015812967 0.015814824 0.015862552 0.015904234 0.016038897 0.016046524 0.016139401 0.016190746 0.016244721

TE D

-2.35799E-05 5.56758E-05 4.71856E-05 2.77694E-05 4.5516E-05 4.8187E-05 1.14529E-05 -3.15454E-05 5.06586E-05 -5.13863E-05 -0.000165149 3.39217E-07 5.06014E-05 5.0594E-05 5.04087E-05 5.0604E-05 5.06049E-05 4.14883E-09 5.05921E-05 7.8319E-05 4.41653E-06 -4.51816E-05 5.25805E-05 8.17783E-06 -7.98736E-05 7.64518E-05 0.000103957 -5.64785E-06 1.12556E-06 -5.44982E-05 3.69506E-05 1.14342E-06 1.17326E-06 0.000122838 -7.11237E-05 6.39734E-06 4.92257E-08 -2.85676E-05 -5.06047E-06 2.15636E-05 8.75189E-05 8.17949E-05 -8.23258E-05 2.69672E-05 3.7369E-05 6.90907E-05 6.04695E-07 5.71593E-05 5.7136E-05 4.62462E-05 3.93979E-08 6.62434E-05 6.0153E-05 6.30317E-10 5.06692E-07 5.8565E-05 3.95538E-10 1.93591E-06 1.30104E-07 -8.76604E-05 -1.07308E-08 3.43558E-07 6.99323E-05 4.72322E-05 -3.06821E-05 -5.52962E-06 6.40379E-09 -2.75582E-05 -7.11562E-05

SC

M AN U

8.84364E-06 -3.53188E-05 -6.87662E-05 3.69324E-05 -1.88185E-05 9.18569E-06 4.67162E-05 -5.25159E-05 -5.84655E-05 -0.000231936 2.66749E-05 -5.36723E-05 -5.36848E-05 -5.15488E-05 -5.36712E-05 -5.36699E-05 2.9659E-08 -5.36812E-05 1.04803E-05 1.32487E-05 6.59629E-05 -5.46633E-05 2.3342E-05 -4.85455E-05 -5.97922E-05 4.28946E-05 5.72121E-05 2.21404E-05 -0.000121402 -6.95878E-05 2.21127E-05 2.85073E-05 -5.88814E-05 -0.00012508 -5.12989E-05 3.41031E-07 -6.7023E-05 -6.40125E-05 5.96452E-06 -5.15638E-05 2.14151E-05 6.58418E-05 -6.63415E-05 -6.77984E-05 -4.28191E-06 -6.90506E-05 -2.73481E-05 -2.73732E-05 -2.54524E-05 4.09866E-08 0.00010156 -1.74583E-05 2.48161E-08 4.22554E-05 -4.52842E-05 1.32865E-08 2.8715E-05 -1.0435E-08 3.45608E-06 3.01656E-08 1.49439E-05 -9.13965E-07 -1.77793E-05 0.000113987 -5.67886E-05 9.39615E-08 4.94101E-05 1.38139E-05

RI PT

ACCEPTED MANUSCRIPT -0.000155835

EP

0.000185614 8.55843E-05 0.000730304 0.000244152 0.000770672 0.000100172 6.54766E-06 7.31886E-05 0.000141576 0.000660445 0.000866068 8.01179E-06 0.000140559 0.000140554 0.000139626 0.000140558 0.000140557 5.08306E-09 0.000140547 0.000225597 7.63813E-06 0.000500867 0.000137643 1.52702E-05 0.000594862 0.000418278 0.000226706 5.1168E-05 5.60487E-06 0.000748611 0.000115949 5.53874E-06 1.15507E-05 0.00101823 0.000672759 0.000712323 2.90051E-08 0.000702751 7.75856E-05 1.93168E-05 0.000413248 0.000155606 0.000131869 0.00015939 0.000120015 0.000184364 0.00077816 0.000104567 0.000104598 8.76879E-05 7.19976E-09 0.000391054 7.27226E-05 7.49544E-09 4.55641E-05 0.00021487 3.38294E-09 1.49752E-05 1.55663E-08 0.0008569 7.23082E-09 6.39616E-06 0.000139535 0.000100858 0.000436228 0.000692659 4.05189E-08 0.000592158 0.000870614

AC C

K06320 K00986 K00820 K08602 K01520 K07816 K05020 K06894 K02388 K01886 K01209 K01227 K02419 K02410 K02390 K02408 K02387 K13587 K02416 K00040 K03810 K09815 K03410 K01529 K00794 K00626 K13653 K06915 K08139 K02372 K04061 K13059 K07457 K10947 K07079 K03572 K14347 K02036 K09022 K03335 K03785 K02804 K02474 K00394 K02409 K04029 K03553 K02421 K02401 K02805 K01458 K00537 K07313 K09826 K01066 K01582 K00044 K07230 K01618 K03284 K02571 K05966 K13280 K00282 K03294 K14441 K10230 K03147 K04068

0.016391089 0.016530881 0.016709785 0.016747609 0.016914131 0.016963231 0.017041606 0.017102105 0.017395688 0.017555277 0.017555277 0.017555277 0.017577086 0.017577086 0.017577086 0.017577086 0.017577086 0.017577086 0.017577268 0.017584547 0.017644892 0.017795551 0.017795551 0.017795551 0.017865141 0.017885355 0.017885355 0.017905777 0.018098102 0.01813812 0.018184413 0.018304962 0.018392187 0.018461802 0.018502814 0.018540772 0.018559634 0.018568908 0.018649709 0.0186547 0.018846506 0.018991174 0.019020407 0.019020407 0.019020407 0.019020407 0.019045192 0.019597729 0.019626236 0.019737641 0.020058411 0.020116739 0.020116739 0.020226865 0.020449182 0.020506706 0.020592473 0.020643822 0.020643822 0.020679686 0.020783803 0.020884284 0.020884284 0.020915953 0.020917943 0.021442126 0.022318448 0.022353418 0.022520726

TE D

-0.000100479 4.32501E-06 -6.52476E-06 5.32992E-05 -5.15969E-05 -3.34373E-05 4.39669E-06 4.28462E-05 2.50915E-07 4.45331E-05 9.70104E-06 9.66378E-06 3.27885E-05 3.61475E-05 -9.46899E-05 0.000153781 5.07745E-06 2.95398E-09 2.37229E-05 -7.85504E-08 6.2004E-05 7.9122E-07 8.67E-05 -7.67719E-05 5.16634E-08 -1.52688E-06 2.20373E-05 -3.72024E-06 7.66504E-06 -0.000172291 -4.3092E-05 2.53841E-05 9.01321E-05 3.2195E-05 -4.29185E-05 1.08259E-08 0.000205426 1.06827E-05 5.88844E-09 -7.03792E-05 -1.97278E-05 3.75088E-09 4.9839E-09 5.11007E-05 -2.99173E-05 -5.77321E-05 -0.00017066 2.40393E-11 1.63118E-09 -0.000105685 0.000100701 3.65178E-09 1.1574E-05 3.76355E-08 0.000123312 -0.000105796 8.84039E-05 4.84401E-08 4.40171E-08 -2.09627E-09 4.11964E-09 6.6804E-05 4.19456E-06 1.57132E-06 3.88992E-08 -8.10129E-09 -5.64664E-05 5.31173E-09 1.35058E-07

SC

M AN U

-5.63347E-05 3.40197E-05 1.71641E-05 4.70316E-05 -0.00010552 1.49181E-05 6.71996E-05 2.78507E-07 3.55935E-05 -3.37797E-05 -3.37813E-05 -1.8834E-05 -6.50529E-05 1.0476E-05 2.72052E-05 4.87195E-05 1.65672E-08 -9.60242E-05 3.87106E-07 -1.96929E-05 2.31591E-05 -5.21009E-05 -5.08725E-05 3.21354E-07 -8.62163E-05 6.13523E-05 2.43905E-05 -3.47797E-05 -6.72053E-05 -5.26256E-05 -3.21462E-05 2.49517E-05 3.62048E-05 3.98189E-05 2.46574E-07 -1.64464E-06 4.56376E-05 3.198E-07 -6.65519E-06 4.57005E-05 1.96008E-08 3.18773E-07 -5.15185E-05 6.41218E-05 2.41597E-05 -8.70672E-05 1.63201E-08 1.28506E-08 7.22024E-05 -0.000128944 1.38891E-08 -2.74892E-07 1.08359E-07 9.07016E-05 2.31065E-05 -8.27855E-05 3.27179E-07 3.17757E-07 1.21421E-08 2.84707E-08 -2.0412E-05 3.04943E-05 5.835E-07 1.07836E-07 9.94836E-08 2.90408E-05 5.02492E-08 4.247E-07

RI PT

ACCEPTED MANUSCRIPT -3.29562E-05

EP

0.000418632 0.000764606 1.94827E-05 7.25355E-05 0.000656201 0.000818964 9.2903E-06 0.000164379 1.3428E-07 2.72477E-05 6.35661E-05 6.3576E-05 6.36847E-05 0.000106029 0.000223532 0.001633666 1.9351E-05 5.38872E-09 0.001399529 1.92175E-07 0.000164665 7.18288E-06 0.000556042 0.001091112 2.73897E-08 0.000681037 0.000162961 1.35374E-05 7.99619E-05 0.001643064 0.000703805 0.000101122 0.000413994 4.51228E-05 8.41538E-05 1.76624E-08 0.001157116 3.70493E-05 1.16936E-07 0.00013114 5.32904E-05 5.25088E-10 1.16838E-07 0.000937398 0.000560678 0.000627646 0.000712959 4.73453E-09 3.75719E-09 0.000855467 0.000956797 3.05221E-09 6.57941E-06 3.504E-08 0.000499348 0.00049325 0.000781823 2.63742E-08 2.99093E-08 2.85933E-09 5.9766E-09 0.000175407 1.81027E-05 2.74521E-07 3.67531E-08 5.31419E-08 6.07444E-05 1.12291E-08 3.34547E-07

AC C

K01192 K00609 K07177 K10543 K02913 K03630 K09133 K04651 K07488 K04750 K03735 K03736 K11214 K03415 K00634 K01704 K01792 K00493 K08303 K10682 K01048 K12112 K00334 K01265 K02749 K11071 K08963 K08969 K01118 K03655 K03703 K03753 K02020 K05396 K01095 K07710 K02028 K07172 K10125 K01551 K07787 K01578 K10126 K00762 K03546 K00760 K07271 K10533 K00217 K01443 K00558 K01454 K06019 K00305 K12960 K03315 K04720 K04786 K08087 K04747 K06601 K02279 K01713 K09716 K00304 K00119 K07783 K05973 K02487

0.02260405 0.022879508 0.023014431 0.023055516 0.023401781 0.023413567 0.023486747 0.023640142 0.023817197 0.023921576 0.023966387 0.023971011 0.0240077 0.024570393 0.024588104 0.024725373 0.024749452 0.025339949 0.025526263 0.025781947 0.025951801 0.025951801 0.026164382 0.026579971 0.026686982 0.026686982 0.026940133 0.027178162 0.027238752 0.027327918 0.028047843 0.028047843 0.028364801 0.028367833 0.028367833 0.028367833 0.028613042 0.028640432 0.028699941 0.02886323 0.028912357 0.028931106 0.028951118 0.028987698 0.029243271 0.029243271 0.029512847 0.029539173 0.029571127 0.029571127 0.029571127 0.029831893 0.030125201 0.030174221 0.030309864 0.030791213 0.030932097 0.031010749 0.031044401 0.031296337 0.031856255 0.03194907 0.031978248 0.032129537 0.032429095 0.032429095 0.032429095 0.033028285 0.033333224

TE D

2.47543E-06 -1.26328E-07 -8.07061E-08 1.39542E-05 -7.11229E-05 -0.000534872 9.13965E-09 2.50408E-05 7.94046E-05 7.67377E-06 5.64045E-09 2.41933E-06 2.43435E-06 4.5807E-05 4.82602E-08 5.04026E-06 2.39517E-06 2.43412E-06 1.46265E-06 3.07303E-05 2.39881E-06 2.46729E-06 2.02851E-06 2.4116E-06 2.4116E-06 2.41166E-06 -5.3421E-05 0.000107862 1.00291E-05 3.05026E-05 2.37467E-06 2.97243E-05 0.000107082 -3.30306E-05 -3.61892E-05 9.55873E-06 -0.000130225 5.69924E-05 -1.15335E-05 -2.66617E-08 -1.19657E-05 4.67374E-05 -1.76597E-10 -1.32728E-05 0.00012367 7.28348E-05 -6.30104E-05 -8.08614E-05 -3.13399E-05 -3.13375E-05 -0.000217892 -5.99551E-06 4.26915E-05 4.34915E-06 -1.58746E-07 6.71817E-05 3.96052E-05 0.000191215 -5.25774E-07 -6.99306E-05 3.96068E-05 3.96062E-05 2.63078E-05 -8.6075E-06 2.34855E-05 3.99194E-05 1.63054E-05 1.35026E-06 -3.15201E-05

SC

M AN U

2.51232E-07 3.948E-07 1.97525E-05 4.10458E-05 0.0001493 3.90259E-08 2.22665E-05 1.26515E-06 -5.63635E-05 1.5934E-08 2.5422E-05 2.53075E-05 2.78348E-05 3.20934E-07 5.07341E-05 2.55418E-05 2.53891E-05 -4.26795E-05 8.72747E-06 2.55494E-05 2.53309E-05 2.54199E-05 2.55213E-05 2.55213E-05 2.55215E-05 4.48108E-05 4.17223E-05 6.07399E-05 -6.80396E-07 2.57795E-05 6.61471E-05 6.93475E-06 3.32451E-05 2.15024E-05 -5.42326E-05 1.22493E-05 4.86765E-05 4.40233E-05 1.43789E-07 -5.41687E-05 -0.00017913 1.46274E-08 8.37129E-05 -2.58139E-07 -2.4128E-05 -0.000207596 -7.18974E-05 1.8213E-05 1.82079E-05 -3.23589E-05 4.11037E-05 -2.39683E-05 3.45836E-05 3.13069E-06 -2.84246E-05 -7.232E-07 -7.21445E-05 5.6636E-07 -1.28674E-05 -7.22189E-07 -7.23634E-07 7.53347E-05 -5.96558E-05 2.76896E-05 2.28953E-05 4.31114E-05 2.51157E-05 6.60928E-05

RI PT

ACCEPTED MANUSCRIPT 2.56587E-05

EP

1.01608E-05 1.77112E-07 2.259E-07 1.1068E-05 0.000962819 0.002517724 2.49654E-09 1.73635E-05 0.00063902 9.09553E-05 4.88616E-09 1.01061E-05 1.00635E-05 9.35631E-05 2.65118E-08 2.00498E-05 1.02494E-05 1.00671E-05 0.00070195 4.06785E-05 1.01343E-05 1.00858E-05 1.08631E-05 1.01049E-05 1.01049E-05 1.01047E-05 9.58168E-05 0.000226379 5.99602E-05 1.95092E-05 1.02883E-05 0.000769335 0.000579417 4.20637E-05 4.61253E-05 7.7851E-05 0.000375518 0.000848938 3.63068E-05 6.05694E-08 0.000699419 0.001196235 4.79535E-09 0.000622037 0.00022282 0.000369531 0.001300744 0.000388974 5.33058E-05 5.33009E-05 0.001568538 2.60556E-05 0.000128262 2.29402E-05 2.91743E-07 0.000220718 5.54881E-05 0.000616037 6.33898E-07 0.000740277 5.54884E-05 5.54885E-05 6.09837E-05 0.000777681 3.80428E-05 6.09724E-05 3.22541E-05 1.1426E-05 0.000944351

AC C

K04092 K00561 K10681 K07311 K00764 K05349 K13018 K09972 K02916 K02397 K01431 K03727 K07768 K01838 K02752 K13829 K09009 K11533 K03570 K03833 K07503 K01632 K07442 K13571 K13570 K13527 K03385 K05879 K12452 K02456 K00886 K01972 K00757 K12344 K06970 K02414 K05521 K01358 K02075 K01434 K01940 K03292 K01569 K00768 K07321 K01008 K07737 K12251 K03568 K03592 K03111 K03316 K04024 K13288 K10530 K07099 K10120 K01421 K00517 K05837 K10121 K10122 K01523 K01881 K12511 K10201 K01494 K09118 K00928

0.033429757 0.033448601 0.033507139 0.03366342 0.033681941 0.033905738 0.03393954 0.03393954 0.034099208 0.034142003 0.034250122 0.034259999 0.034278868 0.034278868 0.034298654 0.034324423 0.034412502 0.034412502 0.034412502 0.034482752 0.034514183 0.034514183 0.034548632 0.034752663 0.034752663 0.034752663 0.034806596 0.035162123 0.035162123 0.03521637 0.03521637 0.035300872 0.03531876 0.03531876 0.035435288 0.035492539 0.035492539 0.035492539 0.035492539 0.035492539 0.035506841 0.035684834 0.035966988 0.036012576 0.036322939 0.03645167 0.036551446 0.036607951 0.036910279 0.036938905 0.037315711 0.03767288 0.03767288 0.037723015 0.037833044 0.037936035 0.03801194 0.03801194 0.03801194 0.03801194 0.03801194 0.03801194 0.038235774 0.038350691 0.038730726 0.03914377 0.039320233 0.039323057 0.039597876

TE D

5.42908E-05 4.04072E-05 -0.000126087 -7.51075E-06 -4.76923E-05 -7.52133E-05 2.90929E-05 1.21566E-05 -5.26643E-05 7.99485E-09 1.09261E-06 4.05637E-05 -6.74451E-06 2.58073E-05 8.35838E-05 -4.17162E-05 6.029E-05 9.79653E-05 0.00011304 1.35455E-05 -6.91086E-06 -8.55517E-05 4.31139E-05 2.55675E-07 1.34251E-05 -3.83628E-05 1.93625E-06 3.20197E-05 6.10914E-05 1.19443E-09 -7.54202E-05 6.02897E-05 1.28644E-05 -2.67044E-05 3.51019E-06 2.0712E-05 3.5116E-09 -1.44381E-05 -0.000159617 -2.18875E-06 2.33445E-09 1.01222E-05 4.6973E-05 4.69726E-05 1.63785E-05 1.48521E-06 2.3226E-05 2.39872E-05 2.24071E-08 2.82571E-05 -8.05361E-07 -7.17522E-05 2.00909E-06 1.41078E-05 -2.69996E-05 2.04031E-05 -5.91181E-05 8.47606E-09 -1.29869E-07 -2.30442E-05 9.37178E-06 6.69723E-06 -2.24051E-05 -2.83485E-06 -2.83651E-09 3.424E-06 -1.78356E-06 -8.23257E-06 -7.94386E-06

SC

M AN U

3.71289E-05 4.385E-05 -2.92001E-05 -7.07539E-05 -7.01226E-05 4.31672E-05 4.23958E-05 -4.02683E-05 5.61455E-08 5.74768E-06 -7.26756E-06 3.49401E-05 3.22158E-05 0.000123633 4.21743E-05 4.61629E-05 -2.10045E-05 -1.34683E-05 -5.82401E-06 -3.46398E-05 1.76967E-06 -2.38664E-06 2.46372E-05 1.97325E-05 -1.70118E-06 3.54794E-05 -1.40247E-05 -6.00125E-05 1.15503E-08 -1.16907E-05 -6.08099E-05 2.42469E-06 -2.63312E-06 3.12311E-05 -2.61246E-05 3.77117E-08 -3.92652E-05 0.000175185 -2.86573E-05 2.32492E-08 -4.2664E-06 2.7204E-05 2.7204E-05 1.86068E-05 2.24619E-05 -2.09001E-06 3.54862E-05 3.06678E-06 -3.15169E-05 8.3533E-07 4.8434E-05 -4.93344E-05 -3.87017E-05 4.09619E-05 2.02423E-05 1.55504E-05 2.53496E-07 5.95951E-07 5.46967E-05 1.37078E-05 -2.52973E-05 -0.000122778 4.09811E-06 1.12365E-07 3.38657E-07 4.48061E-06 1.40056E-05 2.55002E-05

RI PT

ACCEPTED MANUSCRIPT -1.11745E-05

EP

0.000109891 8.14838E-05 0.000599874 4.04254E-05 0.000544041 0.000991765 4.22497E-05 4.41063E-05 0.000681097 4.71222E-09 2.96603E-07 5.85294E-05 2.48156E-05 4.46394E-05 0.000798575 0.000115365 0.000140364 0.000899787 0.000881899 2.20913E-05 5.11099E-05 0.000185315 0.000164514 1.13324E-05 1.08328E-05 5.32713E-05 2.41885E-05 5.28687E-05 0.000199123 2.20744E-09 0.00027945 0.000200363 9.37935E-06 2.75951E-05 2.19755E-05 8.64357E-05 7.91905E-09 0.000715623 0.001612505 3.59285E-05 5.93682E-09 1.42358E-05 9.05163E-05 9.05162E-05 1.58721E-05 8.89859E-06 1.29798E-05 4.21819E-05 1.5426E-06 8.93857E-05 8.87969E-07 0.00084953 0.000824697 4.1931E-05 5.14589E-05 2.53463E-05 0.000324677 3.37466E-08 2.07311E-07 0.000547049 1.37418E-05 3.22093E-05 0.000538525 5.56736E-06 2.37145E-07 3.95936E-06 1.45824E-05 0.00016383 0.000171624

AC C

K06395 K02574 K05989 K01096 K00278 K11755 K01971 K05499 K12573 K00485 K06977 K07219 K06191 K01139 K01012 K09702 K01779 K03086 K01338 K00863 K03604 K01795 K06383 K10243 K01796 K09001 K03647 K06937 K08681 K08295 K00901 K06215 K07318 K13016 K00982 K03556 K09386 K01934 K01992 K01318 K14998 K06402 K10547 K10548 K10556 K09161 K14153 K00060 K08078 K01636 K13730 K00937 K02111 K07066 K07071 K03093 K02897 K07804 K00317 K09117 K09976 K01941 K06400 K01361 K05841 K05844 K05845 K05846 K05847

0.03994095 0.040002813 0.040064279 0.040091321 0.040451918 0.040591715 0.040641167 0.040917246 0.040917246 0.041212156 0.041294904 0.041488801 0.041805856 0.041829201 0.04191858 0.041984419 0.042043193 0.04247457 0.04247457 0.04247457 0.042495531 0.042690824 0.042690824 0.043013924 0.04308199 0.043618297 0.043644084 0.043644084 0.044091232 0.044215584 0.044381818 0.044434551 0.044502386 0.044944723 0.045419709 0.045419709 0.045451832 0.045477234 0.045599695 0.045920414 0.04608676 0.046819449 0.047159636 0.047159636 0.047414204 0.047414204 0.047414204 0.047414204 0.047464376 0.04760176 0.047609595 0.04787846 0.048389057 0.048453548 0.048453548 0.04856734 0.048708791 0.048708791 0.048818536 0.049340642 0.049653451 0.049892844 0.049892844 0.45698411 0.89871753 0.789349166 0.945928438 0.924722264 0.611051329

TE D

-8.11623E-07 7.82946E-09 -3.73485E-07 7.18344E-09 3.22466E-05 4.96587E-07 0.000129053 6.36806E-06 1.0608E-06 8.61118E-07 8.64881E-07 5.67669E-09 8.22838E-07 4.45922E-09 5.81419E-08 8.49801E-08 8.49803E-08 4.15965E-07 6.12016E-06 4.87822E-07 -8.88069E-08 4.33148E-07 4.33142E-07 9.02151E-07 2.34802E-07 6.64612E-08 -1.12679E-05 1.02677E-06 3.78022E-07 -2.2764E-09 -8.644E-07 6.93306E-07 1.06641E-07 3.44543E-08 3.79729E-06 1.00873E-06 1.06678E-06 -2.79112E-06 3.49588E-08 5.95813E-06 8.91412E-07 1.90508E-07 -3.03774E-07 1.05857E-06 1.06397E-06 1.07151E-06 2.82848E-06 -7.46481E-07 5.81419E-08 5.27495E-09 3.70915E-08 3.99079E-05 4.49326E-05 2.48482E-07 -3.49308E-09 4.60163E-07 -1.66123E-06 3.42562E-06 -1.46902E-05 -1.26041E-07 2.9396E-07 -3.58145E-05 -7.99103E-05 7.99466E-06 -4.39543E-07 -3.13993E-05 1.07E-06 1.07E-06 3.29693E-08

SC

M AN U

6.30372E-08 -1.18852E-06 1.5381E-08 4.08627E-06 6.54648E-08 8.71598E-05 -3.07525E-05 3.44084E-07 1.17484E-07 1.37424E-07 3.77275E-08 2.77725E-07 3.24579E-08 1.11373E-07 1.21237E-06 1.21099E-06 -2.21994E-07 -7.00582E-07 -2.13247E-07 -9.40155E-07 -2.49273E-07 -2.50766E-07 6.36469E-08 -2.48748E-09 4.27899E-08 -1.0459E-05 2.19586E-07 -2.1991E-08 3.76065E-08 -1.41585E-06 -4.54919E-07 1.24894E-06 9.84543E-07 -3.40112E-05 9.01084E-07 3.74514E-07 -7.21195E-06 1.22497E-06 -2.19713E-06 1.77415E-06 -3.18686E-05 -1.01085E-06 3.28055E-07 3.406E-07 3.32377E-07 -4.31909E-05 -1.71924E-06 1.11373E-07 5.88279E-08 6.39681E-09 1.13203E-05 -7.42342E-05 1.13848E-07 -3.46169E-09 1.63296E-06 -1.50198E-06 4.06533E-07 -5.49568E-06 5.91734E-06 9.10412E-06 4.25699E-05 -8.28309E-07 3.09215E-05 3.0753E-06 1.77088E-05 -8.92405E-07 -8.92405E-07 1.04896E-06

RI PT

ACCEPTED MANUSCRIPT -7.31151E-07

EP

1.02887E-06 3.53088E-08 2.85741E-06 9.3144E-09 6.22669E-05 9.4685E-07 0.00147966 6.36765E-05 3.67747E-06 3.56336E-06 3.56532E-06 2.8581E-08 2.90242E-06 2.83773E-08 7.47168E-08 1.19015E-06 1.19015E-06 4.21181E-06 6.46689E-06 4.08708E-06 1.73638E-06 4.29139E-06 4.2914E-06 3.50763E-06 5.06835E-07 4.30752E-08 1.47141E-05 2.99882E-06 5.1549E-07 4.96291E-08 1.75037E-06 1.35469E-06 1.22899E-06 1.15356E-06 4.20481E-05 3.12716E-06 3.70985E-06 9.59759E-06 1.2845E-06 1.24083E-05 2.10401E-06 0.000732733 2.7846E-06 3.67668E-06 3.67799E-06 3.68345E-06 0.000725812 4.03303E-06 7.47168E-08 3.43823E-08 4.04509E-08 0.000167952 0.000325207 4.79805E-07 6.76343E-09 1.00048E-06 7.44081E-06 1.41665E-05 1.85714E-05 1.62007E-05 4.87907E-06 0.000507291 0.000848984 2.31153E-05 3.21956E-06 0.000462589 2.10817E-06 2.10817E-06 1.20026E-06

AC C

K00508 K00500 K00507 K00505 K01101 K01103 K01104 K05593 K05590 K05591 K05596 K05597 K05594 K05599 K11962 K12529 K12528 K02457 K02455 K02452 K02450 K02458 K02459 K08137 K03851 K03852 K13010 K13014 K13015 K13017 K08566 K13275 K03275 K03276 K12270 K09909 K09908 K12057 K12056 K06221 K09900 K09903 K09902 K09904 K09907 K09906 K00773 K06313 K05574 K07178 K00190 K10109 K10108 K10107 K01828 K01829 K01826 K01825 K01822 K01823 K01820 K00998 K00991 K00990 K00992 K03564 K13489 K13488 K13483

0.680110934 0.189835758 1 0.560781892 0.051800002 0.945356409 0.058464693 0.071681433 0.978225001 0.978225001 0.978225001 0.461270104 0.978225001 0.570717249 0.560781892 0.833931723 0.833983709 0.992788551 0.639719916 0.991355181 0.954464382 0.991945634 0.991945634 0.978225001 0.949761932 0.5474367 0.152331616 0.978225001 0.513422557 0.887682954 0.876986193 0.86885099 0.827192453 0.89871753 0.150079273 0.978225001 0.978225001 0.87307182 0.830560557 0.73033266 0.760139647 0.177980344 0.978225001 0.978225001 0.978225001 0.978225001 0.075530197 0.712367338 0.560781892 0.209759144 0.877356024 0.655819878 0.223915854 0.939196697 0.560781892 0.868064504 0.978225001 0.978225001 0.395763697 0.892408127 0.183092071 0.184025543 0.058943402 0.057294769 0.266478734 0.635216773 0.877991063 0.877991063 0.884617532

TE D

-2.74306E-08 -2.74306E-08 2.32513E-07 1.07E-06 1.07E-06 6.52295E-06 4.00511E-07 5.22126E-07 8.62593E-06 1.2906E-08 1.41388E-05 1.57527E-05 4.53018E-06 -4.10592E-06 -3.88173E-07 -9.29445E-06 5.19381E-07 -3.87036E-07 2.29345E-07 -2.48514E-06 4.13334E-07 1.13078E-05 8.97286E-07 6.67959E-07 7.80906E-07 7.85369E-07 4.96501E-08 1.15665E-05 -7.59013E-07 6.65067E-06 8.81928E-07 8.05017E-07 2.701E-05 1.0527E-06 -7.02864E-07 1.12625E-05 5.81419E-08 1.24299E-07 1.06808E-06 1.07E-06 1.06304E-06 2.68567E-06 -1.12102E-05 -5.99545E-06 1.79479E-06 6.00688E-06 -5.43011E-05 2.77352E-06 -4.4105E-09 -3.55576E-07 6.74004E-07 2.62971E-06 -3.85537E-06 2.6001E-06 1.43169E-06 -4.39847E-06 1.25408E-06 6.84603E-06 2.98648E-06 7.71397E-07 8.1033E-07 -1.29231E-06 1.06805E-06 8.68152E-07 -3.06545E-07 3.92291E-06 -7.2206E-07 7.93664E-07 -6.91506E-07

SC

M AN U

-2.87879E-08 1.2103E-06 -8.95124E-07 -8.92405E-07 5.2957E-07 -6.56911E-07 5.08205E-07 -1.38682E-05 3.65547E-08 5.57606E-05 -3.07346E-05 8.54395E-06 9.08122E-06 -4.1602E-07 6.99124E-06 3.05183E-07 -4.21543E-07 -5.82305E-07 -2.12888E-06 -2.63827E-05 6.39642E-06 2.75383E-07 -6.31139E-07 -4.84878E-07 -5.79894E-09 1.16646E-06 6.73388E-06 -1.19878E-07 4.3537E-07 3.6475E-07 -2.12991E-08 -1.42899E-05 3.69474E-07 -9.0036E-07 5.21521E-05 1.11373E-07 2.80603E-07 -9.07219E-07 -8.92405E-07 3.42179E-07 1.03083E-05 -1.19288E-05 -3.85235E-06 -4.82124E-06 6.4639E-06 4.66266E-05 -1.64161E-06 -4.69844E-09 -9.76464E-07 -5.85663E-07 -1.84704E-06 -6.37545E-06 -3.05824E-06 -1.05303E-06 4.18433E-06 3.53384E-07 6.8942E-07 -8.34827E-07 1.37337E-07 -2.83643E-10 1.42744E-06 3.67679E-07 1.00736E-07 -8.86502E-07 -3.58362E-05 -1.33516E-06 3.23764E-09 -1.24491E-06

RI PT

ACCEPTED MANUSCRIPT -2.87879E-08

EP

2.88223E-07 2.88223E-07 1.63167E-06 2.10817E-06 2.10817E-06 4.379E-06 1.26477E-06 2.60293E-06 0.000698077 4.04577E-08 0.000673027 0.000719937 8.16784E-06 8.73347E-06 6.78025E-07 9.28448E-06 1.06791E-05 6.76738E-07 8.1988E-06 1.39764E-05 4.45378E-05 1.19933E-05 3.53298E-06 4.47049E-06 3.30279E-06 3.36099E-06 1.16181E-06 1.2066E-05 8.50795E-07 4.84286E-06 2.96653E-06 3.44501E-06 5.10914E-05 3.58801E-06 1.86617E-06 6.22585E-05 7.47168E-08 2.00633E-07 2.09591E-06 2.10817E-06 3.67938E-06 2.02516E-05 5.59496E-05 2.2103E-05 4.35773E-05 1.11891E-05 0.000640182 1.22725E-05 8.60417E-09 5.46857E-06 4.46114E-06 1.85042E-05 6.88E-06 2.32206E-05 9.45846E-06 5.29021E-05 4.17898E-06 4.97481E-06 2.37739E-06 3.64491E-06 3.37756E-06 5.15865E-06 3.68439E-06 3.54616E-06 2.75976E-06 0.000642118 2.47798E-06 3.35141E-06 2.45674E-06

AC C

K13482 K13481 K13480 K13487 K13486 K14682 K08358 K08357 K03469 K03464 K03466 K01649 K01640 K01641 K02597 K02626 K02594 K02593 K02592 K02591 K02590 K02849 K14061 K14062 K14063 K14064 K14065 K02841 K02840 K02844 K02847 K02846 K02102 K06039 K06036 K01581 K02702 K02659 K13490 K13491 K03645 K03646 K03640 K03641 K03642 K03643 K03648 K03649 K12428 K07349 K07348 K07345 K07344 K07347 K07346 K07341 K07340 K06968 K08995 K08994 K08997 K08996 K08990 K08993 K08992 K08998 K08344 K08345 K08346

0.981674722 0.981674722 0.849602167 0.877991063 0.877991063 0.459923032 0.884617532 0.978225001 0.944340515 0.547945251 0.078569057 0.165321064 0.148029837 0.138753579 0.978225001 0.485337124 0.995115705 0.977908719 0.988938244 0.924722264 0.099129702 0.307930005 0.978225001 0.978225001 0.978225001 0.978225001 0.848912695 0.280800537 0.949310518 0.471256862 0.978225001 0.978225001 0.06821195 0.978225001 0.949449854 0.085997866 0.560781892 0.401801357 0.877991063 0.877991063 0.978225001 0.574928117 0.877739844 0.9181814 0.978225001 0.483857176 0.052141373 0.978225001 0.641382498 0.988352676 0.978225001 0.981918898 0.483857176 0.982872798 0.979384842 0.978225001 0.978225001 0.452344961 0.706863051 0.979339345 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.325031577 0.964778554 0.978225001 0.978225001

TE D

-5.13174E-08 5.88063E-08 7.87195E-07 6.1388E-07 2.18895E-08 2.1499E-08 -4.25405E-07 3.27189E-05 -9.41433E-06 1.5784E-05 -2.00841E-06 -2.06094E-06 2.44427E-06 -5.78789E-06 3.83313E-05 9.03263E-06 3.17683E-08 -3.93281E-07 8.24761E-07 1.0727E-06 -7.64419E-07 -5.93055E-05 -7.98584E-09 5.88063E-08 5.88063E-08 5.88063E-08 5.88063E-08 5.80873E-07 5.88063E-08 5.88063E-08 1.0883E-07 5.88063E-08 -6.51284E-07 6.51427E-06 -2.45843E-06 -1.22968E-05 9.10839E-06 7.95826E-07 8.1057E-07 1.09399E-06 -0.000148056 7.96653E-07 -4.96233E-06 1.36647E-06 8.10563E-07 1.32629E-05 6.77566E-07 6.79148E-07 -6.08079E-05 2.13305E-06 5.94637E-07 8.13023E-07 4.7799E-09 1.0607E-06 7.85125E-07 5.60082E-07 7.9722E-07 2.17143E-06 2.84901E-07 1.60305E-07 5.88063E-08 6.43112E-06 -2.20369E-05 -6.97319E-07 1.08059E-06 6.44099E-06 6.39677E-06 1.12524E-06 2.55643E-06

SC

M AN U

1.1135E-07 -4.65212E-09 -9.58798E-07 9.01674E-09 8.99938E-09 -2.60081E-06 -3.66254E-05 -7.28427E-06 -1.1665E-06 -1.50704E-06 5.9383E-06 8.76141E-07 -7.18334E-06 2.07756E-05 -2.63944E-06 1.02156E-07 -4.32728E-07 -1.16285E-07 -9.19226E-07 -3.39989E-07 -1.36358E-05 7.99927E-07 1.1135E-07 1.1135E-07 1.1135E-07 1.1135E-07 -3.98824E-07 1.1135E-07 1.1135E-07 2.12824E-07 1.1135E-07 -1.37247E-06 4.91748E-07 -8.24376E-06 -5.41933E-05 -2.37331E-05 6.25224E-08 2.31149E-07 -9.19809E-07 6.40914E-05 7.5564E-08 8.81129E-06 4.83278E-06 2.33949E-07 1.44236E-05 2.83645E-06 2.83334E-06 0.000113862 -8.19322E-07 -9.20035E-07 -6.98001E-08 3.15726E-08 3.50915E-07 -5.48574E-07 7.66499E-07 4.01031E-09 1.4369E-06 -1.82045E-07 3.14999E-07 1.1135E-07 3.87287E-07 1.14432E-05 -1.23414E-06 3.76826E-07 3.73096E-07 3.53988E-07 8.69065E-08 -3.56392E-06

RI PT

ACCEPTED MANUSCRIPT -1.1276E-07

EP

2.02191E-07 7.47491E-08 3.35984E-06 2.26154E-06 5.00241E-08 5.00792E-08 7.31119E-06 0.000125251 1.44844E-05 1.88455E-05 3.7339E-06 8.87224E-06 3.93457E-06 1.01802E-05 0.001125728 1.0658E-05 7.02053E-08 6.81417E-07 2.78185E-06 2.07501E-06 7.86324E-07 0.000550798 8.54325E-07 7.47491E-08 7.47491E-08 7.47491E-08 7.47491E-08 7.28062E-07 7.47491E-08 7.47491E-08 1.56093E-07 7.47491E-08 2.60732E-06 4.42404E-06 8.77735E-06 0.000664619 3.84215E-05 2.80165E-06 2.80645E-06 2.08178E-06 0.000814094 3.37123E-06 0.000703707 3.24561E-06 2.80645E-06 3.4264E-05 1.71136E-06 1.71127E-06 0.000306247 6.71752E-06 2.30798E-06 3.44634E-06 2.80561E-08 3.67824E-06 3.29463E-06 1.77317E-06 3.36705E-06 4.26479E-06 3.16858E-07 2.36753E-07 7.47491E-08 4.34695E-06 0.000643609 2.46991E-06 3.7345E-06 4.19088E-06 4.15434E-06 3.99516E-06 8.05623E-06

AC C

K14940 K02724 K08349 K05928 K05927 K05922 K05921 K00690 K00344 K09116 K02106 K05823 K05820 K02100 K00527 K00520 K00523 K02451 K00529 K00025 K05339 K00793 K01347 K02694 K02696 K02697 K02690 K02691 K02692 K02693 K02698 K02699 K00836 K00835 K00830 K00831 K00839 K04335 K04334 K01120 K01126 K04333 K01129 K01128 K04338 K02471 K02475 K02476 K02477 K02478 K02479 K09019 K11441 K14055 K14057 K14056 K02854 K02855 K08693 K08696 K08697 K11748 K11749 K11746 K11747 K11744 K11745 K11742 K11743

0.860952258 0.560781892 0.978225001 0.978225001 1 1 0.978225001 0.125343273 0.600145354 0.223493454 0.860952258 0.39763143 0.894068864 0.459923032 0.467173494 0.442905428 0.074735393 0.973984306 0.978225001 0.877739844 0.931862363 0.198291962 0.902660635 0.560781892 0.560781892 0.560781892 0.560781892 0.494708172 0.560781892 0.560781892 0.593994105 0.560781892 0.965434729 0.459923032 0.802420354 0.055875947 0.099087688 0.978225001 0.978225001 0.87347769 0.073214372 0.978329369 0.978225001 0.466995862 0.978225001 0.516730139 0.689750165 0.690660029 0.117736861 0.978225001 0.978225001 0.978225001 0.588069172 0.978225001 0.978225001 0.978225001 0.978225001 0.97399348 0.677222576 0.604870818 0.560781892 0.467279957 0.581211318 0.978225001 0.978225001 0.462805655 0.466995862 0.978225001 0.437323909

TE D

-5.19711E-08 -2.72593E-07 -1.98096E-06 -1.28591E-07 6.25559E-06 -6.85294E-07 -9.3457E-07 1.06811E-06 -6.22931E-05 -3.26926E-05 1.06516E-06 -2.66295E-08 1.49892E-07 -3.15139E-06 8.56126E-07 6.25351E-06 4.69759E-05 2.34858E-05 -4.00335E-08 -2.14736E-06 1.06938E-06 6.92891E-07 2.60588E-08 -0.000114716 -1.13011E-05 1.08424E-06 -3.68982E-07 -8.10934E-05 1.56568E-08 1.93523E-05 4.44539E-05 2.85334E-05 -6.95479E-06 3.07378E-06 1.08566E-09 -1.17875E-05 1.87949E-07 -2.01431E-05 -3.74891E-06 2.15043E-06 -5.65803E-05 1.08832E-07 -2.30705E-06 -5.43957E-07 8.0492E-07 -1.92327E-05 2.65768E-06 -1.49839E-08 8.59253E-07 7.86037E-07 6.01947E-06 3.05135E-06 -8.50694E-07 -5.60267E-08 2.48211E-07 3.17689E-05 -1.63271E-05 3.26356E-08 1.27546E-06 3.34402E-08 8.97856E-07 -3.54555E-07 -4.90817E-06 -6.93081E-06 2.47203E-07 -1.94051E-05 7.73171E-08 3.49726E-07 1.90873E-06

SC

M AN U

1.92394E-07 -1.87379E-06 5.37432E-07 1.54694E-06 -1.45839E-06 9.15626E-07 3.69905E-07 1.77712E-05 -1.20332E-05 3.72337E-07 1.34764E-05 3.4532E-07 -7.97923E-06 3.89824E-07 8.89333E-06 3.7194E-05 -2.44189E-05 6.01022E-08 -8.25334E-06 3.80639E-07 -5.62616E-07 8.42007E-08 -8.90991E-05 9.94725E-06 3.86038E-07 -3.98525E-07 3.3294E-05 8.2311E-08 3.79431E-05 -4.93235E-05 2.5699E-05 -8.80469E-06 -2.90472E-05 -8.96178E-10 -3.10536E-05 -3.18678E-05 3.24307E-05 2.82575E-06 7.59619E-07 -1.17167E-06 2.14582E-07 -1.63328E-06 -1.46583E-05 -1.80827E-08 -2.30386E-05 -2.91794E-05 6.93301E-08 8.7075E-08 -6.968E-08 6.45653E-06 -3.83244E-07 -8.87712E-07 4.26538E-08 3.18389E-08 6.42483E-05 -3.58415E-05 1.0578E-06 3.63891E-07 1.05871E-06 1.25251E-07 7.82148E-07 4.38919E-05 1.6286E-05 3.58019E-08 1.43678E-05 1.26931E-07 4.86636E-07 1.36125E-06

RI PT

ACCEPTED MANUSCRIPT 2.35767E-06

EP

2.52201E-06 2.45673E-06 2.63478E-06 2.14633E-07 2.50342E-06 2.47011E-06 2.60137E-06 3.70807E-06 0.000417039 0.000714776 3.71065E-06 9.08801E-06 2.4549E-07 1.03435E-05 3.62205E-06 1.05289E-05 0.000242382 0.000552498 1.95348E-07 8.69569E-06 3.71206E-06 4.51299E-06 4.99431E-08 0.001084124 1.7712E-05 3.7176E-06 8.05968E-07 0.000538361 5.07146E-08 0.000754239 0.000381241 2.85038E-05 1.68857E-05 0.000729904 2.07165E-09 0.000725427 0.000732733 0.000655892 6.88048E-06 7.43618E-06 0.000702096 1.56672E-07 8.66519E-06 3.2309E-05 3.44042E-06 0.000738535 0.00073204 5.23281E-08 3.43803E-06 3.35226E-06 1.12543E-05 2.50397E-06 1.18027E-06 1.59864E-07 4.73412E-07 0.001037293 0.000692982 1.20132E-06 4.30585E-06 1.20053E-06 3.55505E-06 5.78585E-07 3.70731E-05 2.36361E-05 4.74281E-07 2.87897E-05 1.06785E-07 2.84188E-06 7.4851E-06

AC C

K11740 K13923 K13924 K13925 K13926 K13928 K13929 K09923 K06201 K06207 K06205 K09924 K09929 K06208 K00758 K00752 K00756 K00754 K07151 K07152 K07153 K07156 K07157 K07407 K07403 K07400 K07401 K01809 K01800 K01803 K01804 K01664 K01669 K02863 K02862 K02860 K02867 K02864 K05362 K05365 K03402 K03403 K03405 K03409 K02317 K02316 K02313 K02319 K12152 K12151 K07091 K07093 K07094 K07097 K07096 K07098 K11175 K11177 K11179 K11178 K00322 K00320 K00324 K00325 K00329 K05945 K06945 K06946 K06415

0.537095104 0.988351249 0.876986193 0.068352731 0.298774992 0.944340515 0.978225001 0.978225001 0.058987656 0.414992521 0.978225001 0.543868832 0.112185153 0.412421052 0.978225001 0.330487207 0.117688682 0.773149483 0.941827781 0.816532142 0.978225001 0.978225001 0.123706543 0.143277082 0.432823013 0.978225001 0.978225001 0.197636978 0.120989946 0.321357781 0.199633174 0.058210128 0.753013541 0.221541938 0.833983709 0.257464626 0.177980344 0.274129235 0.438086117 0.978225001 0.073612348 0.592354613 0.869269461 0.387830045 0.978225001 0.338623727 0.232927189 0.455900978 0.978225001 0.978225001 0.483857176 0.770737141 0.902532144 0.902660635 0.945797678 0.666587679 0.146882749 0.882149686 0.978225001 0.881923217 0.978225001 0.237462213 0.187493303 0.525480448 0.946922613 0.128861059 0.460102241 0.979802948 0.844594722

TE D

4.98794E-05 7.21096E-07 6.87338E-06 1.22997E-05 -1.95116E-07 8.11487E-06 -4.13576E-05 -1.01628E-06 2.53771E-06 3.43624E-06 4.70004E-06 1.76843E-06 1.06028E-06 2.85451E-06 6.02885E-06 -1.45475E-05 1.06176E-06 1.05764E-06 1.02632E-08 1.92777E-05 3.9068E-05 8.03869E-06 -4.32154E-09 1.06698E-06 4.97637E-08 9.8424E-09 -9.37405E-06 9.8424E-09 9.27038E-06 1.05756E-06 4.98474E-08 8.56098E-09 3.9684E-08 2.91294E-05 7.77365E-08 4.17096E-08 -4.07699E-09 3.19824E-07 -1.42557E-05 -3.07574E-06 9.25023E-06 -5.67622E-06 -1.8632E-08 4.86683E-05 2.68443E-05 5.05485E-05 2.95279E-05 9.76484E-06 8.20016E-06 1.5808E-05 1.07299E-06 -9.45146E-07 -4.21175E-09 -1.66705E-08 -1.49839E-08 5.51808E-07 3.9898E-08 -2.19307E-06 -4.22897E-09 -4.22897E-09 1.33305E-06 -7.71553E-08 1.58306E-05 7.97547E-05 1.4785E-05 -2.76209E-07 -1.31269E-05 5.84978E-08 2.59968E-06

SC

M AN U

-2.87397E-05 -1.57E-06 5.8972E-06 2.52148E-05 1.20221E-05 -8.80738E-06 5.49329E-06 9.41238E-07 -3.20848E-06 3.00537E-07 1.74036E-05 3.29828E-07 -4.41168E-06 6.13645E-06 2.11123E-05 4.16418E-07 3.29634E-07 6.0436E-08 1.9933E-05 -6.18334E-05 1.59802E-05 -2.58066E-07 3.61429E-07 1.23655E-06 7.07775E-08 7.12708E-06 7.07775E-08 1.37306E-05 3.39464E-07 7.80879E-08 7.05303E-08 8.42109E-08 -1.09234E-05 1.46956E-07 9.11546E-08 -4.0443E-09 -8.06812E-07 2.60915E-05 6.11426E-06 1.36518E-05 7.43963E-06 -1.57876E-08 -5.49719E-06 -4.36361E-05 -1.54531E-05 -3.18408E-05 9.03109E-06 2.89596E-06 1.12404E-05 -9.06335E-07 -1.10016E-06 1.3244E-08 -1.20095E-08 6.93301E-08 -5.96791E-07 9.90734E-07 -8.20983E-06 1.78553E-08 1.78553E-08 3.83554E-06 2.39854E-10 3.92697E-06 -4.67482E-05 3.47206E-05 -6.2245E-07 5.79748E-05 2.05207E-07 -2.86165E-05

RI PT

ACCEPTED MANUSCRIPT -2.7312E-05

EP

0.000773413 0.000733163 6.53089E-06 8.48279E-06 1.429E-05 1.49936E-05 0.000723387 5.89579E-06 3.91916E-06 3.8222E-06 4.22335E-06 0.000620545 3.67841E-06 9.43339E-06 1.15006E-05 2.09827E-05 3.62389E-06 3.67806E-06 4.03352E-08 1.91788E-05 0.000227564 3.11064E-05 5.79677E-07 3.68411E-06 1.17066E-06 3.45435E-08 4.99062E-05 3.45435E-08 1.37167E-05 3.66547E-06 3.82505E-08 3.94549E-08 7.41471E-08 2.3202E-05 7.84863E-08 7.32078E-08 5.98349E-09 5.04605E-06 0.000747077 1.52894E-05 1.37081E-05 1.19906E-05 1.19189E-07 0.001564827 0.000106543 9.80167E-05 0.00011591 2.96793E-05 4.75194E-06 1.43176E-05 2.07862E-06 3.4625E-06 4.02593E-09 3.25466E-08 5.23281E-08 3.01634E-06 1.16567E-06 8.37384E-06 1.91741E-08 1.91741E-08 7.48873E-06 1.53968E-07 6.48541E-05 0.000440303 0.000584388 1.04742E-06 6.66853E-05 1.71023E-07 0.000733489

AC C

K06941 K06942 K10806 K10804 K10805 K06948 K06949 K09138 K09136 K09137 K09131 K05808 K05809 K05804 K05805 K05800 K05802 K05803 K01044 K01046 K05568 K05567 K14274 K02062 K05245 K05564 K01322 K05560 K02243 K02679 K02676 K02674 K02672 K02241 K02670 K02671 K00810 K00813 K00817 K02530 K02245 K02244 K01499 K01491 K02418 K02412 K02413 K02411 K02415 K00121 K13058 K13727 K13057 K00435 K03231 K03230 K12059 K12058 K12239 K12238 K12234 K05992 K06330 K07138 K07139 K11811 K07132 K07131 K01866

0.180456319 0.244961327 0.352649777 0.557344253 0.062232553 0.11624109 0.34325109 0.419562114 0.877739844 0.388511574 0.360305789 0.922405855 0.978225001 0.560781892 0.511190895 0.137044452 0.978225001 0.978225001 0.21942742 0.052178192 0.075517491 0.560781892 0.800973833 0.978225001 0.822297292 0.091631055 0.978225001 0.091631055 0.050459699 0.978225001 0.096783337 0.140439679 0.169332591 0.373895353 0.107130341 0.146209299 0.5474367 0.979010779 0.435537208 0.773149483 0.051666 0.300845686 0.978225001 0.435458169 0.052412614 0.094474366 0.122848519 0.548757803 0.120989946 0.21437863 0.877739844 0.978225001 0.121911106 0.837038322 0.455900978 0.978225001 0.89871753 0.815128945 0.860952258 0.860952258 0.694961461 0.898160378 0.748201355 0.056299591 0.537671899 0.86885099 0.118951167 0.187157416 0.227813154

TE D

-1.08067E-06 2.24622E-05 7.63505E-07 6.46411E-06 -1.61538E-08 2.04779E-06 -3.01235E-05 -1.40456E-05 5.99001E-06 -1.64337E-08 7.01635E-06 1.07063E-06 -5.26827E-06 1.08998E-06 -1.14694E-06 -5.05366E-06 3.02942E-08 8.12721E-07 1.91886E-05 6.49045E-06 -2.76203E-07 -7.44992E-06 -4.942E-05 5.78781E-07 -1.70953E-05 1.42676E-06 8.4277E-07 -6.95245E-06 8.24647E-07 8.35116E-07 6.47296E-09 6.12508E-06 4.25424E-05 -5.43716E-06 3.33048E-06 5.88144E-08 -4.9737E-06 -2.29676E-07 2.84941E-05 6.00801E-06 4.75871E-06 -3.00997E-05 8.68935E-07 -1.94621E-06 4.67024E-05 5.81419E-08 1.08002E-06 -1.16417E-05 3.92434E-06 2.80723E-06 3.14989E-08 5.82481E-08 3.58719E-06 5.91366E-06 5.33921E-07 1.53592E-06 7.97115E-07 7.79246E-07 1.28741E-06 7.79248E-07 4.91536E-05 2.35783E-06 6.30808E-10 2.61477E-07 2.61553E-07 5.43006E-06 6.69617E-07 -5.21941E-07 1.17818E-06

SC

M AN U

-1.11979E-05 -3.05624E-05 4.88635E-07 -1.0238E-08 -1.17336E-06 3.41646E-05 -9.77416E-05 6.44287E-06 -4.67051E-09 -1.49408E-06 3.87644E-07 -8.69773E-06 3.8893E-07 4.35471E-06 -3.6606E-06 1.2105E-06 2.70676E-07 -1.27991E-05 5.05662E-07 4.74975E-08 2.51413E-05 1.96595E-05 -1.47404E-07 -3.36603E-06 -2.97304E-05 -3.05058E-05 -2.79448E-05 -3.05176E-05 -3.05089E-05 6.93293E-08 1.25032E-05 3.69935E-05 8.98662E-06 1.21876E-05 1.14265E-07 -6.40796E-06 2.73123E-06 -3.31655E-06 6.46567E-06 -2.5574E-06 -1.99057E-05 1.04003E-07 -3.19327E-05 9.98474E-06 1.11373E-07 3.82037E-07 1.33407E-05 -2.76076E-05 1.39383E-06 1.4257E-07 1.47624E-07 5.60378E-06 2.11769E-06 2.30145E-06 4.80326E-06 -3.03997E-07 -3.78926E-07 -3.03954E-05 -3.77551E-07 -0.000107535 9.58156E-06 1.63212E-09 1.18859E-07 1.24353E-07 -2.77086E-07 5.79808E-06 -1.3439E-06 4.29034E-07

RI PT

ACCEPTED MANUSCRIPT -3.20065E-05

EP

0.000735577 0.000753282 0.000732973 4.26766E-06 2.48541E-08 1.75676E-05 6.53052E-05 0.000813857 1.11797E-05 2.75741E-08 3.03431E-05 3.71462E-06 1.58241E-05 3.72189E-06 6.36557E-06 9.19947E-06 1.27754E-06 2.89062E-06 7.24468E-05 4.37296E-06 4.17104E-07 0.000841977 0.000534235 4.35874E-06 0.000648777 0.000732132 0.000732934 0.000728645 0.000732941 0.000732937 4.82711E-09 1.27145E-05 8.27701E-05 1.11906E-05 1.97177E-05 7.53242E-08 6.60836E-06 2.5327E-06 4.3101E-05 1.11877E-05 0.000697675 0.000730368 3.54668E-06 0.000732027 0.000179686 7.47168E-08 3.71825E-06 3.24961E-05 0.000729602 4.15559E-06 7.03499E-08 6.91698E-08 8.62248E-06 1.24647E-05 5.1486E-06 1.50879E-05 3.31326E-06 3.38139E-06 0.000732722 3.38139E-06 0.001665789 9.22676E-06 2.96357E-09 4.82551E-07 4.82526E-07 5.9436E-06 4.10255E-06 1.75699E-06 1.30207E-06

AC C

K01867 K01868 K01869 K06140 K04766 K04767 K04764 K04763 K04760 K04768 K08313 K08312 K08311 K08310 K08317 K08315 K08319 K08318 K14392 K14393 K14645 K01689 K01685 K01682 K01681 K02888 K02884 K02887 K02886 K02881 K13743 K02086 K02081 K02080 K02082 K03428 K03932 K03933 K03930 K02339 K02338 K02337 K02336 K02335 K03688 K03689 K03683 K03684 K03685 K07300 K07303 K07302 K07305 K07306 K07309 K07308 K02617 K02610 K02963 K02612 K09686 K09684 K09681 K09688 K09689 K05967 K05964 K05968 K00309

0.165158007 0.079066763 0.197699759 0.466334677 0.520976961 0.978225001 0.066490346 0.107340461 0.485337124 0.574928117 0.85625514 0.978225001 0.814758325 0.978225001 0.795564507 0.878810641 0.835514244 0.978225001 0.370355183 0.463941833 0.450101827 0.756588353 0.63380578 0.989619614 0.935287645 0.223936952 0.19789644 0.327760508 0.19789644 0.19789644 0.239243018 0.108613238 0.149104908 0.532071898 0.533097857 0.55895016 0.100697104 0.613511875 0.548757803 0.483857176 0.978225001 0.368956758 0.978225001 0.17566423 0.272880062 0.560781892 0.978225001 0.592881873 0.245974784 0.854881274 0.142494419 0.141183672 0.781680055 0.978225001 0.916512751 0.893360809 0.978225001 0.978225001 0.197699759 0.978225001 0.248811799 0.198587618 0.848912695 0.920618357 0.919259502 0.406565407 0.598616628 0.933921734 0.485337124

TE D

5.31669E-09 7.28444E-06 3.37205E-07 9.44443E-06 8.31048E-08 -6.94447E-09 1.20423E-05 6.90018E-06 1.81464E-07 -8.65563E-10 1.91858E-07 1.09108E-06 3.69994E-05 6.58585E-06 6.49537E-08 8.31445E-05 -1.01392E-05 3.76736E-09 -4.17604E-09 1.06578E-06 -5.53951E-09 -6.33674E-05 4.34507E-06 1.37213E-06 7.6428E-07 9.75681E-06 -3.99314E-05 5.99906E-06 -8.36016E-05 5.53549E-07 -2.24552E-05 8.70269E-07 -1.74733E-05 8.03659E-07 7.88248E-07 8.4236E-07 5.62435E-07 5.60212E-07 7.68543E-07 3.65511E-10 9.64002E-06 1.48637E-06 9.5984E-09 -1.22648E-06 -1.22648E-06 -1.22648E-06 -1.77073E-05 -1.56336E-09 1.04852E-06 2.1814E-08 -9.95407E-06 -5.86857E-07 7.85277E-07 -5.776E-06 -5.65147E-06 -1.70484E-05 -5.80485E-07 5.90964E-07 1.08709E-07 5.88063E-08 8.57807E-07 8.71409E-07 5.88063E-08 1.18252E-08 -1.02728E-05 -1.37548E-06 -6.6771E-08 -6.57575E-06 -3.26661E-06

SC

M AN U

-1.62878E-06 1.69156E-07 4.13981E-06 -9.69687E-08 6.36576E-08 -1.50758E-05 3.20328E-06 3.85758E-07 2.4028E-09 3.16813E-07 8.91109E-08 -8.04443E-07 -1.88004E-05 1.53899E-07 -1.16038E-05 -8.52271E-06 -8.56565E-08 -2.71691E-09 3.43606E-07 1.71584E-08 -2.75448E-05 -3.82279E-06 4.78259E-07 1.41661E-08 -9.22548E-06 -4.12119E-06 6.46476E-06 1.17466E-07 -5.96061E-07 7.6964E-06 1.14107E-07 3.29699E-05 4.74768E-08 3.06804E-08 1.31669E-06 7.67319E-07 7.67034E-07 7.97269E-07 1.14464E-08 2.4702E-05 -4.53891E-06 4.79719E-09 6.22942E-07 6.22942E-07 6.22942E-07 3.02459E-05 6.5187E-08 -8.94629E-07 3.9046E-08 6.12681E-06 -1.06544E-06 -1.62172E-07 -7.90979E-06 -1.92802E-06 -2.41937E-05 -1.13399E-06 -9.32312E-07 2.1399E-07 1.1135E-07 5.87818E-08 1.33166E-07 1.1135E-07 4.39891E-08 1.89818E-05 -1.31887E-06 -1.30015E-08 -7.33396E-06 -3.57696E-05

RI PT

ACCEPTED MANUSCRIPT 6.64527E-08

EP

4.35537E-08 9.45309E-06 4.18319E-07 1.2347E-05 1.4441E-06 7.09996E-08 5.13337E-05 2.51337E-06 2.81435E-07 2.36208E-09 3.39452E-07 4.97662E-06 5.76155E-05 0.000725613 1.47664E-07 0.00078311 0.000690755 2.3493E-07 9.71273E-09 3.67636E-06 1.9864E-08 0.00012065 9.70801E-06 4.2357E-06 3.60713E-06 0.000735813 0.000727357 1.1209E-05 0.000471839 3.01512E-06 0.00068804 3.62272E-06 3.37363E-05 3.45109E-06 3.55218E-06 2.10737E-06 1.77377E-06 1.77189E-06 2.19556E-06 4.079E-09 0.000101707 5.30673E-06 5.53201E-09 1.65333E-06 1.65333E-06 1.65333E-06 0.000196456 4.88063E-08 2.0897E-06 2.53998E-08 0.000692227 2.85598E-06 3.55552E-06 1.09005E-05 8.75296E-06 5.57321E-05 2.64577E-06 2.30471E-06 1.56955E-07 7.47491E-08 3.51747E-06 3.55385E-06 7.47491E-08 3.9254E-08 1.10779E-05 1.46437E-06 1.09736E-07 1.43303E-05 0.000754258

AC C

K00301 K00303 K06434 K06436 K10820 K14257 K01308 K01303 K02658 K00672 K02656 K05685 K00879 K00873 K00870 K04486 K04485 K04480 K13693 K13695 K05977 K09516 K02436 K03745 K03747 K03210 K03217 K03215 K03742 K03219 K03218 K03749 K03748 K09475 K09476 K09471 K09470 K09473 K09472 K13967 K13963 K00737 K05345 K11706 K11704 K11705 K07443 K07116 K07117 K07110 K07447 K07113 K07119 K01844 K01846 K01841 K06219 K08482 K08481 K08480 K08485 K08484 K00464 K00466 K00462 K01518 K04748 K04749 K01515

0.10116362 0.603678548 0.695832529 0.174387357 0.978225001 0.80603689 0.326600163 0.130996752 0.467279957 0.592871843 0.246632392 0.978225001 0.520570997 0.526340116 0.574928117 0.180262001 0.974355418 0.949151531 0.89871753 0.978225001 0.862941965 0.085630744 0.311766321 0.978225001 0.979010779 0.866491873 0.242113342 0.483857176 0.057019265 0.978225001 0.589834602 0.978225001 0.06821195 0.978225001 0.978378683 0.877739844 0.978225001 0.978225001 0.975854706 0.099129702 0.627301994 0.128147257 0.502173046 0.842408256 0.842408256 0.842408256 0.514096374 0.507694988 0.883116695 0.254698198 0.956927696 0.978225001 0.978225001 0.242113342 0.925654519 0.243561059 0.978225001 0.978225001 0.593262948 0.560781892 0.978225001 0.978225001 0.560781892 0.511274158 0.063893801 0.876986193 0.730937211 0.471256862 0.694986241

TE D

-7.33977E-05 -7.79376E-09 -6.66578E-07 1.06693E-06 1.06693E-06 1.06787E-06 4.01894E-06 -7.76893E-09 -1.28651E-08 -2.85064E-05 8.41908E-07 4.24586E-06 4.45482E-06 -1.01483E-07 5.46265E-08 5.64184E-07 6.33768E-06 5.99086E-06 7.65705E-07 -4.76856E-05 7.07948E-06 5.99312E-06 -2.0626E-06 -2.80656E-05 6.31471E-06 -4.12838E-07 -6.60462E-07 8.22767E-06 3.44543E-08 7.16924E-06 -3.88899E-07 1.06191E-06 -1.59198E-08 3.6306E-08 3.37695E-06 6.43756E-06 -1.50892E-05 1.10979E-05 6.87559E-05 -1.56313E-06 -7.52512E-05 7.76304E-07 -3.33406E-06 1.04938E-06 5.82109E-08 3.29941E-09 8.494E-07 -5.13174E-08 -2.43727E-06 3.70087E-06 1.08505E-05 -2.65816E-05 -6.18761E-07 1.96556E-09 8.42822E-07 3.62493E-06 -6.1288E-06 8.01381E-06 -3.41513E-06 -9.65568E-06 -2.02627E-05 -5.71204E-05 1.25449E-07 -8.51902E-07 -4.07108E-07 2.20901E-06 1.07923E-07 -1.21566E-06 5.81419E-08

SC

M AN U

-6.21129E-09 -1.13828E-06 4.12615E-07 4.12615E-07 4.07389E-07 4.11523E-05 3.07329E-08 -9.51339E-09 -1.30567E-05 -3.05978E-05 -2.52331E-05 6.72423E-06 -1.77934E-07 2.70779E-07 9.5872E-07 6.51706E-06 6.43672E-06 7.60301E-08 -4.93679E-05 1.75468E-06 6.44666E-06 -3.14233E-05 3.45422E-05 6.46435E-06 -2.79509E-07 -1.06331E-06 9.47787E-06 9.84543E-07 8.40964E-06 -4.32895E-07 -9.20614E-07 3.05381E-08 1.25493E-06 -3.47652E-06 4.35278E-07 1.34441E-05 -3.256E-06 3.55244E-05 1.09599E-05 2.21447E-06 -4.50011E-08 -3.82161E-06 3.51279E-07 2.3145E-07 3.66729E-08 1.74156E-06 -1.1276E-07 -2.49015E-05 1.55442E-07 4.91669E-05 -4.57061E-06 -6.35793E-07 3.11569E-08 1.7409E-07 5.73996E-06 5.54415E-06 5.99736E-06 -3.14976E-05 -3.3518E-05 6.96047E-05 9.29488E-05 -5.04393E-07 -8.26956E-07 -3.2739E-07 -2.87684E-05 2.12712E-07 -2.76607E-05 1.11373E-07

RI PT

ACCEPTED MANUSCRIPT -4.3399E-05

EP

0.000164991 9.05876E-09 2.6177E-06 3.71418E-06 3.71418E-06 3.71269E-06 0.000755907 1.67677E-08 2.044E-08 0.001326106 0.000732978 0.000741908 9.88549E-06 4.11691E-07 1.21433E-07 1.68598E-06 1.17509E-05 1.11859E-05 3.37847E-06 0.001962377 5.37141E-06 1.1186E-05 0.000736487 5.86923E-05 1.16595E-05 7.15452E-07 4.76067E-06 1.70612E-05 1.15356E-06 0.000165868 6.76453E-07 2.08002E-06 4.83281E-08 1.19374E-06 4.7327E-06 4.33539E-06 6.54222E-05 1.66359E-05 0.000230063 2.04528E-06 0.000176979 3.47728E-06 2.32536E-05 3.58788E-06 1.21082E-07 3.0981E-08 8.24879E-07 2.02191E-07 3.37426E-05 8.12664E-06 0.000125245 0.00056296 1.64277E-06 3.07851E-08 3.70433E-06 8.24402E-06 1.85903E-05 2.02573E-05 0.000731284 0.000724621 0.00012953 0.000608782 1.10342E-06 1.21672E-06 4.05549E-07 0.000733384 1.57345E-07 0.00072967 7.47168E-08

AC C

K14623 K03918 K03919 K12372 K12370 K12371 K02358 K02351 K02352 K02355 K02357 K02356 K13574 K13573 K13572 K12113 K07323 K07320 K08163 K06180 K06181 K06186 K06187 K06188 K06189 K08359 K07589 K07586 K11139 K05985 K05987 K05986 K10843 K08354 K10844 K00673 K00674 K00675 K00676 K06988 K06989 K08351 K06980 K08350 K06985 K06986 K00587 K00584 K02441 K00588 K02440 K00018 K00019 K02442 K00855 K00856 K00851 K00853 K00858 K00859 K01185 K01188 K02596 K13766 K13767 K02986 K02636 K02982 K02638

0.081094585 0.880631007 0.978225001 0.978225001 0.978225001 0.978225001 0.242440264 0.176519159 0.486378906 0.811733699 0.197699759 0.333708829 0.486378906 0.897272301 0.163577807 0.96401381 0.467415482 0.485337124 0.979010779 0.613567443 0.444147222 0.485337124 0.195608083 0.053292207 0.473966418 0.978225001 0.978225001 0.199603927 0.89871753 0.978225001 0.973984306 0.877991063 0.678279309 0.816238734 0.360305789 0.467279957 0.655099109 0.435458169 0.154502018 0.090632475 0.055269763 0.978225001 0.978225001 0.978225001 0.093719393 0.476583129 0.72426989 0.860952258 0.094482074 0.848912695 0.187008286 0.853099521 0.943064485 0.606765744 0.978225001 0.550997229 0.736940151 0.848452218 0.236736668 0.206105785 0.33729471 0.148215283 0.973754344 0.916137685 0.321567705 0.225080446 0.594789428 0.307930005 0.560781892

TE D

1.08324E-07 -3.04257E-05 1.17569E-06 5.11601E-08 5.99031E-06 5.9106E-06 8.19589E-05 7.34643E-06 1.11311E-06 2.51532E-06 1.69727E-06 3.90929E-06 -7.71678E-07 5.11164E-09 -3.63009E-06 -1.48534E-05 -3.00754E-05 8.34856E-06 7.01958E-05 5.5943E-07 -3.19086E-07 -1.10414E-05 8.16072E-07 3.93536E-06 8.13207E-07 -8.16801E-06 -2.89188E-05 2.57585E-06 5.25461E-08 8.33057E-09 -4.99782E-07 -2.00298E-06 -3.24209E-07 -2.00298E-06 4.03012E-08 4.83829E-05 -2.12777E-08 8.59693E-07 7.75808E-06 1.80312E-05 6.77862E-05 1.02738E-07 -1.49839E-08 -8.83912E-06 -1.49839E-08 2.34561E-05 8.20158E-07 3.42942E-06 -2.16818E-09 -1.21529E-05 8.10088E-07 7.66892E-09 -2.03074E-07 1.06359E-06 -3.75849E-07 -3.70805E-07 -2.12463E-09 1.09854E-05 6.19543E-06 -1.01126E-05 -9.89803E-06 1.31879E-05 -1.09178E-06 2.09108E-05 5.88063E-08 5.88063E-08 -1.97935E-06 4.45922E-09 7.77475E-07

SC

M AN U

8.04358E-06 1.05497E-06 1.2432E-06 6.45943E-06 6.41861E-06 1.67665E-05 1.90607E-06 4.45476E-07 1.08846E-06 -1.04618E-06 6.65943E-06 -8.49449E-07 3.2955E-07 -3.46813E-06 2.55845E-05 -7.35547E-05 9.61925E-06 -0.000121391 7.91116E-07 -8.76059E-07 1.66259E-05 6.97324E-08 3.36522E-06 5.4567E-08 3.16836E-06 -4.26072E-05 4.4894E-06 1.20266E-06 5.59453E-08 -1.68906E-06 -8.23441E-06 -9.97683E-07 -8.23304E-06 7.09859E-08 1.27947E-05 1.85431E-08 5.90027E-08 7.72807E-06 -1.06965E-05 -1.04768E-05 4.26187E-07 6.93301E-08 -9.87334E-06 6.93301E-08 1.69374E-05 5.1033E-08 1.63751E-06 1.3477E-08 -1.77023E-05 -1.34995E-08 1.85679E-08 5.50449E-06 -9.20843E-07 -3.94093E-07 -4.14488E-07 4.20036E-09 1.07263E-07 1.22266E-07 -4.62586E-07 -9.31086E-07 -1.89037E-05 2.06874E-06 -4.41913E-05 1.1135E-07 1.1135E-07 -8.15849E-06 3.24579E-08 1.20243E-06

RI PT

ACCEPTED MANUSCRIPT 3.82003E-07

EP

5.4638E-07 0.000688943 3.71353E-06 1.17157E-06 1.12016E-05 1.12192E-05 0.000576261 5.55281E-06 3.75562E-06 1.26507E-06 2.53331E-06 4.09824E-06 1.35618E-06 1.53657E-07 4.01043E-06 4.12877E-05 0.000586233 3.95959E-06 0.000875994 1.68152E-06 2.75589E-06 2.61506E-05 3.56011E-06 1.36091E-05 3.48752E-06 2.50894E-05 0.001506303 2.54751E-06 1.19827E-06 3.50705E-08 2.89825E-06 8.30369E-06 1.60893E-06 8.30369E-06 4.14026E-08 0.000103397 4.37639E-08 3.51583E-06 1.22966E-05 4.70948E-05 0.00023861 2.36703E-07 5.23281E-08 0.000663765 5.23281E-08 3.26288E-05 3.41558E-06 5.98403E-06 2.0571E-09 0.000155628 3.43667E-06 9.58021E-09 1.65252E-06 2.08167E-06 8.04639E-07 7.96422E-07 5.63602E-09 5.7955E-06 5.37241E-06 1.33795E-05 1.39014E-05 0.000731135 4.20287E-07 0.000629019 7.47491E-08 7.47491E-08 8.45874E-06 2.83773E-08 1.87688E-06

AC C

K02639 K02988 K08298 K08299 K03583 K03582 K03581 K03580 K03586 K01725 K01724 K01727 K01721 K01720 K01729 K01728 K02188 K02182 K03768 K03765 K03764 K03762 K03761 K03760 K09456 K09459 K00602 K09981 K09980 K09983 K09982 K09985 K09984 K09987 K09986 K09988 K12583 K12582 K11720 K07469 K07464 K07465 K07466 K07460 K07463 K10679 K10678 K10677 K10676 K08722 K08723 K08721 K08728 K00118 K00449 K00448 K00446 K00117 K00116 K00113 K00112 K01533 K01535 K01537 K14605 K14606 K00413 K05600 K03972

0.874841845 0.431019937 0.917127154 0.820455549 0.484808015 0.489318569 0.091254751 0.511274158 0.978225001 0.537671899 0.844430547 0.136191105 0.977326987 0.067859247 0.104058062 0.3903134 0.063771154 0.057682423 0.063771154 0.978225001 0.978225001 0.408461475 0.978225001 0.877739844 0.978225001 0.751356735 0.883116695 0.059740686 0.840563972 0.157649073 0.900410996 0.821693218 0.910794376 0.821693218 0.14257936 0.057278028 0.711608385 0.978225001 0.383082987 0.280882142 0.136992407 0.145899157 0.455900978 0.901450432 0.455900978 0.45112604 0.978225001 0.827382784 0.154295735 0.826703997 0.978225001 0.42796637 0.194922575 0.877991063 0.978225001 0.978225001 0.810985881 0.425517734 0.586815496 0.140197176 0.146882749 0.304910188 0.073612348 0.214101135 0.560781892 0.560781892 0.825136667 0.570717249 0.892028671

TE D

8.48785E-07 8.02831E-07 -2.51243E-05 3.66044E-06 8.56624E-07 8.07775E-06 2.05282E-05 -3.47574E-05 1.71065E-07 1.08105E-05 1.0765E-07 -4.29274E-06 -1.08897E-06 -4.79824E-06 -4.52031E-06 4.29869E-09 -4.41222E-07 1.22723E-09 -1.29983E-08 5.64358E-06 8.17332E-07 2.6225E-05 -1.25002E-06 0.000219011 -3.60658E-06 6.26033E-07 6.25946E-07 6.04817E-07 6.41857E-07 8.41381E-06 6.73006E-06 8.02509E-07 2.70366E-07 4.8184E-07 2.68999E-07 1.12833E-06 5.77884E-06 4.28584E-08 5.04024E-05 5.96923E-06 -6.73796E-07 2.01737E-06 1.16683E-05 8.12773E-07 7.71148E-07 3.16609E-06 7.6881E-07 1.39169E-06 7.79248E-07 7.54198E-07 -3.14546E-05 -4.50538E-06 6.06175E-06 -6.37606E-07 5.95635E-06 -5.86839E-06 -7.23871E-05 7.86375E-06 1.07344E-08 1.07419E-06 3.53066E-06 1.01032E-06 6.32167E-06 8.08258E-07 7.82375E-07 -9.22518E-06 8.57274E-06 -4.04299E-06 -1.20917E-06

SC

M AN U

-1.7573E-08 -3.63102E-05 -3.00843E-05 5.87814E-08 -2.65763E-05 -2.47276E-05 9.43406E-05 -1.76516E-08 -2.02269E-05 2.5301E-06 -2.39369E-06 -1.4985E-06 -3.68607E-06 -3.25529E-06 3.57543E-08 3.0586E-06 2.71091E-08 -8.74447E-09 -5.55218E-06 1.831E-06 6.52205E-05 6.84657E-07 7.80764E-05 -5.78526E-06 2.06924E-05 2.06928E-05 2.07759E-05 -1.13246E-07 1.32122E-05 1.18805E-05 -2.39788E-08 -1.04778E-06 -4.01699E-07 -1.04925E-06 1.02162E-06 6.1558E-06 1.16798E-06 8.14661E-06 6.04566E-06 -1.45111E-06 -3.4205E-06 -5.06944E-06 3.89911E-08 -3.8088E-07 -2.90196E-05 -3.81407E-07 -3.05462E-05 -3.77551E-07 -3.91248E-07 -5.07804E-06 -3.40063E-06 6.13648E-06 -2.39746E-06 6.41985E-06 -3.75047E-06 2.2337E-05 8.54573E-06 7.49281E-09 -5.25107E-07 5.81111E-06 -6.6781E-07 1.20353E-05 -4.53078E-08 -3.05674E-05 -4.32006E-05 -2.85656E-05 9.19435E-06 -1.575E-06

RI PT

ACCEPTED MANUSCRIPT 9.71257E-08

EP

3.54063E-06 3.44734E-06 0.000682061 0.000730183 3.51892E-06 0.000727493 9.52516E-05 0.000906539 4.62816E-07 5.71806E-05 2.68321E-06 6.75768E-06 2.13985E-06 5.38998E-06 5.69258E-06 2.85166E-08 3.21314E-06 9.80675E-09 2.07861E-08 1.33345E-05 2.41883E-06 0.000596095 1.72966E-06 0.002096463 6.84891E-06 7.4109E-06 7.41054E-06 7.42612E-06 3.70146E-06 1.71176E-05 1.60857E-05 3.44769E-06 4.94359E-06 4.07343E-06 4.94507E-06 2.63975E-06 1.1002E-05 1.18714E-06 0.000110606 1.13629E-05 2.55359E-06 7.5061E-06 1.44879E-05 3.48916E-06 3.36993E-06 0.000729827 3.37203E-06 0.000732611 3.38139E-06 3.40015E-06 0.000660227 9.32811E-06 1.14611E-05 8.4945E-06 1.11575E-05 2.20339E-05 0.00020265 7.77906E-06 5.18898E-09 2.23897E-06 7.73416E-06 2.21881E-06 2.55792E-05 3.52156E-06 0.000732976 0.000122514 0.000730713 8.58759E-06 3.67272E-06

AC C

K03970 K03971 K03976 K03977 K03974 K03979 K02379 K03394 K03392 K03390 K12136 K12137 K06610 K12138 K12139 K11444 K11440 K11443 K11442 K00612 K00613 K00616 K00614 K00615 K00619 K10240 K10241 K10242 K05517 K07707 K07706 K07701 K07700 K07703 K07702 K07709 K07708 K09934 K09935 K09937 K13745 K06211 K06212 K09933 K02618 K02967 K02616 K02965 K02611 K02613 K03565 K06218 K03567 K03566 K03560 K03562 K01709 K01708 K14165 K14161 K14160 K14162 K03709 K08160 K03702 K03707 K06287 K06286 K06285

0.978225001 0.978225001 0.20337061 0.185255776 0.978225001 0.280882142 0.132486883 0.108811408 0.978225001 0.236195393 0.483857176 0.820848331 0.727594105 0.656176879 0.730027352 0.490885355 0.269979767 0.052738978 0.487021349 0.483235277 0.414339666 0.058210128 0.833983709 0.0673584 0.532545607 0.057019265 0.057019265 0.055507042 0.982757702 0.183092071 0.197699759 0.978225001 0.978612853 0.988328535 0.978612853 0.897272301 0.521028192 0.849491818 0.086885035 0.525480448 0.946922613 0.527570497 0.060007758 0.978225001 0.978225001 0.221541938 0.978225001 0.193913427 0.978225001 0.978225001 0.320525163 0.789654455 0.512123791 0.978225001 0.487021349 0.925371398 0.121240529 0.167580448 0.345094891 0.89871753 0.533097857 0.904829668 0.593994105 0.978225001 0.197699759 0.239849825 0.206731525 0.135968794 0.630183515

TE D

1.31337E-05 1.06182E-06 4.7324E-08 1.00868E-06 3.52875E-06 1.1237E-06 1.93133E-06 8.00586E-07 -2.63916E-06 2.33173E-06 1.92315E-06 5.76161E-06 3.81125E-06 8.10562E-07 -8.26048E-07 8.04077E-07 2.49627E-07 -1.72166E-08 2.1141E-06 1.70697E-06 4.2369E-06 -1.02729E-06 3.63059E-06 -3.54439E-08 4.19114E-10 2.05779E-06 7.69258E-10 9.19311E-07 8.12102E-07 -7.90688E-06 8.12102E-07 2.79269E-09 -4.4105E-09 2.02016E-08 8.77234E-07 2.51819E-05 -2.67099E-05 -5.90132E-06 8.83667E-07 -5.71572E-06 -1.2886E-07 1.19569E-06 1.27134E-06 3.45733E-05 2.41613E-06 3.7971E-08 8.01614E-07 1.46177E-05 3.42689E-06 5.72258E-06 7.19512E-07 -3.46437E-05 -1.82143E-05 -3.13585E-05 3.68477E-07 8.57787E-09 1.07943E-06 -1.33908E-06 -1.84707E-08 1.2829E-05 5.8818E-08 4.89566E-08 6.00943E-06 6.37504E-06 7.526E-06 8.09996E-07 9.93284E-06 -1.26976E-05 -2.03312E-07

SC

M AN U

3.34604E-07 3.18662E-07 -8.40313E-07 5.74343E-06 -3.14824E-06 -3.56582E-06 1.86582E-08 -2.50667E-07 -2.17103E-05 -3.00908E-05 3.67019E-06 -1.15059E-06 2.32575E-07 -8.93275E-07 -1.41644E-08 -1.66782E-06 -3.18749E-08 -3.31099E-06 -2.73182E-06 -3.83825E-06 -6.48893E-06 -5.88056E-06 2.35661E-08 1.2247E-08 3.75514E-06 4.71857E-08 -1.51559E-06 2.98282E-07 2.86271E-05 2.98282E-07 1.39408E-09 -4.69844E-09 -3.63962E-09 7.28562E-07 -3.65829E-05 -5.21395E-05 -5.49593E-06 7.6511E-07 -5.29965E-06 2.37359E-06 5.68097E-06 -2.93945E-07 3.387E-06 -5.56842E-07 1.07657E-06 8.02028E-09 1.94872E-05 -2.25696E-05 1.13511E-05 1.59764E-06 -1.71997E-05 3.43156E-05 -1.60213E-05 5.57653E-08 8.49536E-09 3.74925E-07 -2.56392E-06 -1.69367E-08 4.82181E-06 1.1251E-07 1.16616E-06 5.47796E-06 1.19342E-05 -8.7165E-06 1.92719E-08 -7.8959E-06 -6.76391E-05 -2.5663E-07

RI PT

ACCEPTED MANUSCRIPT 7.5736E-06

EP

1.25393E-05 3.67413E-06 1.62306E-07 2.14919E-06 7.71661E-06 3.76768E-06 7.05084E-06 3.37432E-06 2.40979E-05 0.000741922 0.000736265 2.71654E-06 9.64047E-06 2.80645E-06 1.0256E-06 3.44067E-06 3.102E-06 3.18749E-08 3.70112E-06 6.44526E-06 7.67353E-06 1.12326E-05 1.24575E-05 7.26581E-08 3.38527E-09 2.67723E-06 5.08288E-08 3.32893E-06 2.81335E-06 0.000105069 2.81335E-06 1.58091E-09 8.60417E-09 1.12176E-08 3.0613E-06 9.69143E-05 0.000105577 1.1751E-05 3.0718E-06 1.15538E-05 1.31733E-07 4.16379E-06 3.85633E-06 0.000787 1.83676E-05 1.19119E-06 3.36304E-06 2.5276E-05 7.34707E-05 1.43527E-05 1.30426E-06 0.00071681 0.000656203 0.000718076 5.40125E-07 1.10163E-08 3.71814E-06 1.18145E-05 1.17384E-07 2.0032E-05 7.47448E-08 1.16349E-06 1.17966E-05 1.82841E-05 4.24684E-05 3.49024E-06 2.16383E-05 0.000122082 1.16723E-06

AC C

K06867 K06866 K06860 K12658 K15022 K08700 K08162 K00137 K00135 K00134 K00133 K00131 K00130 K00138 K00429 K00427 K14083 K14081 K14086 K14087 K14084 K14088 K14089 K01556 K01557 K01554 K01555 K13688 K13683 K13685 K13684 K13687 K13686 K14159 K02399 K02398 K02395 K02394 K02391 K02393 K13531 K13530 K14054 K02601 K12339 K14060 K11685 K11689 K11688 K03048 K13820 K03043 K03040 K03046 K00692 K00635 K00631 K00632 K00696 K00694 K00695 K07811 K07810 K07812 K07814 K00090 K00091 K00096 K00098

0.181216126 0.978225001 0.066042996 0.897272301 0.540767285 0.666678254 0.511190895 0.978225001 0.978225001 0.485337124 0.193913427 0.163544 0.785201586 0.978225001 0.599005698 0.978225001 0.664930941 0.460526251 0.158336407 0.379791618 0.164196585 0.513698249 0.191849068 0.824371214 0.052453299 0.356645578 0.424213305 0.881923217 0.978225001 0.243367284 0.978225001 0.658583149 0.641382498 0.181216126 0.978225001 0.090554742 0.227616032 0.635472226 0.978225001 0.663224518 0.148780095 0.384744744 0.978225001 0.240001821 0.978225001 0.877739844 0.978225001 0.068041662 0.272927844 0.210030665 0.451849267 0.303066475 0.26832645 0.394501439 0.616521672 0.849491818 0.978225001 0.978225001 0.978225001 0.305049708 0.560781892 0.848912695 0.593994105 0.548767229 0.637938946 0.978225001 0.12981799 0.056671098 0.978225001

TE D

-2.86757E-05 -2.40276E-08 -2.39584E-08 2.34302E-07 1.50815E-06 6.02727E-06 9.44654E-08 4.68684E-05 9.44523E-07 2.20016E-06 6.10189E-06 8.5876E-07 3.54195E-06 5.93595E-06 2.07054E-06 8.6051E-07 9.66016E-07 1.84143E-06 4.09873E-09 5.31132E-06 -6.09255E-09 1.06812E-06 -1.58586E-08 -3.33903E-05 -3.88552E-07 -6.37511E-07 1.06886E-06 -1.6679E-08 1.10744E-06 1.09771E-06 -6.96473E-06 6.37079E-06 -2.32177E-07 7.10429E-07 -4.74607E-05 6.88513E-09 -4.54188E-06 1.07005E-06 9.2987E-06 1.00264E-07 -3.36595E-05 -3.07939E-05 -0.000104243 -2.12517E-05 1.631E-05 1.39541E-06 1.06163E-06 7.4356E-06 4.69505E-08 -6.59527E-08 1.72228E-07 -6.08389E-08 8.57076E-08 1.12526E-07 2.51449E-07 2.55781E-07 -4.63605E-08 2.2005E-07 5.883E-08 1.10375E-07 7.67738E-07 5.85936E-08 -5.84804E-09 1.8276E-08 8.76992E-07 8.828E-07 1.00806E-06 -1.58454E-06 -1.78293E-08

SC

M AN U

4.86544E-08 4.89074E-08 -4.2599E-07 6.33735E-06 -2.24208E-05 8.22712E-08 -1.60913E-05 1.04603E-06 -3.70715E-07 1.43211E-05 5.87074E-08 -1.15634E-05 2.33409E-05 1.44216E-06 6.11013E-08 -3.04364E-05 -5.95033E-06 1.74775E-07 8.03299E-06 3.21692E-06 3.71279E-07 1.05436E-07 -1.74054E-05 -2.69576E-07 -1.1526E-06 3.99821E-07 -1.02033E-08 4.31947E-07 4.49016E-07 2.46025E-05 1.52862E-06 -2.11946E-07 1.56696E-06 2.6312E-05 5.03776E-08 1.34313E-05 3.83802E-07 2.40394E-05 1.83258E-07 -7.38876E-05 -5.12843E-05 -4.51651E-06 2.91879E-05 -6.33945E-05 2.95926E-07 3.28736E-07 1.2416E-05 1.06429E-06 -1.28577E-06 -1.96472E-06 -1.26294E-06 1.40174E-06 -2.05177E-06 -1.38774E-06 -1.67078E-06 -1.2885E-06 -1.46834E-06 1.13671E-07 2.15336E-07 -3.80608E-07 1.11403E-07 -4.26431E-09 1.36564E-07 -8.20649E-07 -8.10858E-07 -7.69976E-07 1.32328E-05 -1.83907E-08

RI PT

ACCEPTED MANUSCRIPT -2.99524E-05

EP

0.000709572 5.84416E-08 5.88039E-08 5.83219E-07 3.24699E-06 0.000723481 5.16313E-08 0.000793989 2.66124E-06 5.49614E-06 2.30299E-05 3.51613E-06 4.91147E-05 1.89742E-05 2.32628E-06 3.5146E-06 0.000732782 0.000698399 1.19693E-08 1.75346E-05 1.20126E-05 3.70807E-06 4.37986E-08 0.000717649 8.08332E-07 2.57362E-06 3.72073E-06 2.48195E-08 3.75439E-06 3.7502E-06 2.21027E-05 2.94195E-06 2.33877E-07 1.4325E-06 0.000602813 3.15451E-08 4.23839E-05 3.70294E-06 2.84575E-05 1.1675E-07 0.000589063 0.000613654 0.001077384 0.000644595 0.000157533 3.85923E-06 3.67654E-06 1.67727E-05 1.16479E-06 1.6869E-06 6.8937E-06 1.73399E-06 1.30962E-06 6.8249E-06 5.74528E-06 5.69899E-06 1.80791E-06 5.72633E-06 7.47404E-08 1.55913E-07 3.3699E-06 7.48297E-08 1.22184E-08 1.61262E-07 2.30126E-06 2.30642E-06 2.28624E-06 3.03469E-06 1.18995E-07

AC C

K00099 K10228 K10229 K10227 K05822 K01945 K01947 K07727 K07724 K07723 K07722 K00892 K00897 K08151 K08153 K08154 K02948 K02946 K13793 K01768 K01761 K01766 K08164 K02493 K08166 K08167 K02496 K02497 K02494 K02498 K14415 K14414 K00436 K00437 K03547 K10941 K03549 K03548 K02236 K02234 K02232 K02233 K02231 K03723 K03722 K03721 K03720 K03724 K12678 K11898 K11896 K11897 K11894 K11895 K11892 K11893 K11890 K11891 K11325 K11329 K00151 K00150 K00153 K00407 K00406 K00405 K00404 K00158 K01342

0.290098702 0.69556773 0.69556773 0.660409218 0.051727212 0.343643941 0.143277082 0.517953995 0.978225001 0.706463761 0.507928152 0.978225001 0.392827772 0.159175475 0.570854196 0.978225001 0.198561944 0.978225001 0.150079273 0.88894686 0.978225001 0.978225001 0.16850244 0.336682936 0.85625514 0.978225001 0.978225001 0.487021349 0.978225001 0.978225001 0.114228311 0.34250624 0.873192385 0.459923032 0.096886627 0.290604152 0.913188667 0.978225001 0.224444314 0.197699759 0.056228418 0.183640418 0.159657095 0.413979415 0.075809547 0.978225001 0.978225001 0.150863132 0.878464178 0.848912695 0.978225001 0.860005446 0.789654455 0.978225001 0.978225001 0.978225001 0.853154734 0.978225001 0.559363104 0.588106435 0.978225001 0.561984117 0.749938596 0.392848113 0.934274287 0.933830804 0.89871753 0.094338786 0.978225001

TE D

1.51812E-05 1.69977E-05 6.35751E-09 1.19163E-08 6.40262E-06 -1.15332E-06 7.35583E-10 -1.97705E-07 -7.97194E-06 3.55292E-09 -2.7571E-06 -3.0885E-07 8.10562E-07 3.27243E-08 2.55049E-09 8.56368E-07 3.05392E-05 2.72648E-05 -1.29983E-08 7.92656E-07 4.84846E-09 3.46683E-07 -0.000187123 -8.2981E-07 1.50912E-08 8.07856E-07 1.10105E-06 2.43752E-05 -3.61179E-07 3.81182E-06 7.94295E-07 -4.06956E-06 5.88119E-08 1.63365E-05 1.01145E-07 8.18136E-07 -3.53939E-07 1.1413E-05 -1.7207E-08 -1.71996E-08 -1.7207E-08 -7.42142E-05 3.78945E-09 -6.43746E-05 2.30382E-05 -9.65277E-06 1.08414E-06 -1.08802E-05 1.78129E-06 3.6106E-08 1.76328E-06 5.45259E-07 8.77454E-06 -3.92048E-07 5.81419E-08 -3.7854E-05 3.55565E-06 -1.84372E-08 5.91355E-08 -6.22546E-09 5.28449E-08 5.88063E-08 2.53538E-07 5.88063E-08 1.75877E-07 5.88063E-08 -5.02359E-05 -6.37032E-05 -5.44183E-05

SC

M AN U

-1.80151E-05 1.47002E-07 5.82024E-08 1.0446E-06 -1.3388E-06 1.14541E-08 2.5829E-06 3.1614E-05 4.58846E-08 -4.83488E-07 7.52698E-07 2.32575E-07 1.66661E-06 5.515E-08 2.64428E-07 4.49071E-05 -1.47176E-05 -8.74447E-09 5.54504E-06 5.79475E-08 -9.9505E-08 -8.0831E-06 -8.0345E-07 8.55046E-08 1.90105E-08 5.91192E-07 -3.53865E-06 -3.96613E-07 -2.76875E-05 1.34274E-08 -3.063E-06 1.12083E-07 2.29857E-05 7.05328E-07 2.09541E-06 1.34043E-06 6.56369E-06 -2.77454E-08 -2.6366E-08 -2.77454E-08 -6.91054E-05 2.76765E-08 -7.05125E-05 4.07722E-05 -6.18233E-06 3.89216E-07 -6.19708E-06 -1.39701E-07 1.59579E-08 7.83902E-08 1.47056E-06 -1.0899E-06 -4.37333E-07 1.11373E-07 1.16264E-05 5.77884E-06 -1.80231E-08 1.13724E-07 -1.9907E-08 1.11152E-07 1.1135E-07 1.25584E-06 1.1135E-07 -1.80649E-08 1.1135E-07 -4.69487E-05 3.37599E-06 -3.41595E-06

RI PT

ACCEPTED MANUSCRIPT -1.69906E-05

EP

0.000194901 0.000141639 8.64816E-08 6.83876E-09 5.56309E-06 1.65808E-06 3.82468E-09 8.27204E-08 3.28077E-05 3.29872E-08 5.7959E-06 2.21336E-06 2.80645E-06 1.77285E-06 3.06767E-08 2.93146E-06 0.000686486 5.15789E-05 2.07861E-08 5.09198E-06 2.36974E-08 4.82248E-07 0.00134675 1.21517E-06 4.93785E-08 3.48189E-06 1.99717E-06 6.98513E-05 7.19766E-07 0.000730059 3.37995E-06 4.27344E-06 7.47468E-08 2.21081E-05 6.67044E-07 1.10179E-05 1.01835E-06 9.80184E-06 3.18686E-08 3.18637E-08 3.18686E-08 0.000730796 8.14763E-09 0.000750276 0.000733599 0.000682051 3.71772E-06 9.79394E-05 4.59152E-06 8.91271E-09 6.96236E-06 1.81458E-06 7.362E-06 6.80891E-07 7.47168E-08 0.000252101 7.7491E-06 1.17285E-07 7.46822E-08 1.9907E-08 9.65104E-08 7.47491E-08 3.51358E-07 7.47491E-08 4.64181E-07 7.47491E-08 0.000344594 0.00028989 0.000280476

AC C

K04094 K04095 K04097 K04090 K04091 K04093 K04098 K01574 K01575 K01576 K01577 K04337 K04336 K00004 K10943 K07290 K10206 K10202 K10208 K10209 K01965 K01964 K01961 K01969 K01968 K07740 K07746 K01299 K05603 K02926 K00216 K00210 K00218 K00219 K01035 K01034 K01031 K01039 K14128 K14127 K14126 K03521 K03520 K03522 K03527 K03526 K03528 K03299 K03298 K13472 K03291 K03290 K03297 K13009 K07190 K07192 K06020 K06027 K09744 K07991 K09835 K09834 K06351 K09833 K10924 K10697 K00179 K00177 K00176

0.836857553 0.735813457 0.099129702 0.09325004 0.581956221 0.848452218 0.066042996 0.145614639 0.051413711 0.29669974 0.852590588 0.978225001 0.978225001 0.897978071 0.211207788 0.978225001 0.166724812 0.062580638 0.487021349 0.272528713 0.099129702 0.548757803 0.103321087 0.924722264 0.112118621 0.978225001 0.952600859 0.426710163 0.978225001 0.243648012 0.978225001 0.660409218 0.560781892 0.050011665 0.769353088 0.978225001 0.593994105 0.36288799 0.555491754 0.576382408 0.555491754 0.140197176 0.085689113 0.191941309 0.219864642 0.949761932 0.978225001 0.931862363 0.9767413 0.175950147 0.978225001 0.866354432 0.064025019 0.973587989 0.560781892 0.527570497 0.53496023 0.978225001 0.558476198 0.860005446 0.578018241 0.560781892 0.233482753 0.560781892 0.978225001 0.560781892 0.575028673 0.394407688 0.557344253

TE D

-1.52855E-09 -1.92122E-08 -1.58461E-08 -1.8517E-08 5.88063E-08 5.88063E-08 2.58614E-07 -3.38211E-05 1.99231E-06 -3.39463E-06 1.77863E-05 -5.28888E-05 8.33127E-07 -5.51099E-08 4.6786E-08 1.84365E-05 -5.40555E-06 -1.72293E-06 9.5348E-06 -7.1027E-05 -1.39996E-07 -4.59344E-05 -1.40584E-08 -1.78295E-07 -1.25635E-06 3.61944E-09 -8.231E-06 -9.29162E-08 1.53501E-05 -2.18123E-06 3.46875E-09 -5.87362E-06 6.44246E-07 6.40471E-06 7.68032E-06 8.55688E-07 2.48515E-07 -1.59541E-06 1.57475E-06 -3.72177E-06 -8.46585E-07 5.88063E-08 -1.46496E-05 -6.56957E-07 8.44904E-06 5.93175E-06 -1.60939E-05 -1.61226E-05 2.8869E-10 -1.74437E-06 5.88063E-08 -1.27653E-06 5.96335E-06 1.07059E-06 8.10431E-07 8.63473E-06 8.50517E-07 6.40349E-06 1.08039E-06 7.98607E-07 5.51733E-06 8.02244E-07 -3.13844E-05 -3.5204E-07 -2.25572E-06 -3.29425E-05 1.2844E-05 -1.17499E-09 1.05772E-06

SC

M AN U

2.08414E-08 4.82244E-08 1.97555E-08 1.1135E-07 1.1135E-07 -4.48311E-07 -1.42979E-05 1.92964E-06 -3.02913E-05 1.87857E-05 -2.46028E-05 2.294E-06 -2.71473E-09 -6.1608E-08 2.29234E-06 2.19429E-05 -4.66647E-06 -8.33954E-06 -4.53286E-05 5.72372E-08 3.87282E-05 2.15256E-08 -1.42989E-07 6.86423E-07 3.01553E-08 6.64361E-06 2.42166E-07 6.84261E-06 -1.69236E-05 2.99735E-08 -3.76906E-06 1.71728E-07 3.93781E-07 2.64187E-06 5.98272E-07 3.08497E-08 -2.14088E-06 5.0162E-06 1.7082E-05 -8.49644E-07 1.1135E-07 2.11863E-05 -1.07167E-06 1.59089E-05 6.36128E-06 3.6944E-05 3.69142E-05 6.93666E-08 -1.33016E-05 1.1135E-07 -2.1142E-06 6.44546E-06 3.95845E-07 2.10142E-08 -2.9363E-06 -8.84969E-08 -3.58995E-08 2.09454E-07 -3.85462E-07 -2.8903E-05 -2.42917E-08 -2.7803E-05 -3.00617E-05 -1.81986E-05 -2.48251E-05 7.71857E-06 -5.14494E-09 -9.2066E-07

RI PT

ACCEPTED MANUSCRIPT -3.43602E-09

EP

5.84917E-09 3.97703E-08 6.59666E-08 3.84223E-08 7.47491E-08 7.47491E-08 5.04444E-07 0.00071886 7.53289E-06 0.000738157 6.21165E-05 0.00070121 1.85102E-06 6.01605E-08 9.30457E-08 1.63231E-05 1.84403E-05 1.05487E-05 9.86377E-05 0.000151747 2.57883E-07 0.000117605 4.45844E-08 1.68808E-07 1.7296E-06 2.81056E-08 1.57567E-05 9.86808E-08 2.40558E-05 5.42422E-05 2.8286E-08 2.20466E-05 4.21606E-06 4.16655E-06 1.4447E-05 2.53008E-06 4.73034E-07 3.75132E-06 3.23844E-06 7.58553E-06 1.26002E-06 7.47491E-08 1.80676E-05 4.86483E-06 3.18388E-05 1.11164E-05 8.298E-05 8.30135E-05 3.81087E-08 0.000706781 7.47491E-08 6.50759E-06 1.10928E-05 3.71741E-06 3.4841E-06 8.22221E-06 3.43997E-06 4.17784E-06 4.42282E-06 3.38491E-06 0.000733621 3.448E-06 0.000722437 0.000733479 0.000710148 0.000679657 1.30737E-05 1.37543E-08 2.09893E-06

AC C

K14338 K14339 K14335 K14337 K14330 K14331 K14333 K04078 K04076 K04077 K04074 K04075 K04073 K04071 K08280 K13641 K13640 K02024 K02023 K02022 K02021 K03885 K03889 K12998 K12999 K12993 K12990 K12991 K12996 K12997 K12994 K03089 K03087 K08970 K03082 K03080 K11646 K07506 K07505 K07504 K07501 K08698 K10778 K14287 K00140 K05501 K01903 K01902 K01907 K00147 K07769 K06203 K06202 K09921 K09920 K09927 K09024 K09023 K09020 K09021 K02909 K08219 K02904 K02906 K02907 K02902 K00230 K00232 K08976

0.978225001 0.727167921 0.560781892 0.759454065 0.560781892 0.560781892 0.593994105 0.370625596 0.803841587 0.221562424 0.240279136 0.057500178 0.567789076 0.628367877 0.603986222 0.115765171 0.105241157 0.978225001 0.860952258 0.188151411 0.39763143 0.063783603 0.830560557 0.723861282 0.831492799 0.616064683 0.487471032 0.070116031 0.243908367 0.825947192 0.621560686 0.924722264 0.987133167 0.466995862 0.6308808 0.978225001 0.945356409 0.89870186 0.414390081 0.197057654 0.910103102 0.560781892 0.070141477 0.978225001 0.66961624 0.491365741 0.385779692 0.385829759 0.09288328 0.861452439 0.560781892 0.978225001 0.485337124 0.978225001 0.978225001 0.057019265 0.978225001 0.452779629 0.978225001 0.978225001 0.206274 0.978225001 0.065526339 0.224607885 0.633052924 0.345333582 0.121257354 0.958007779 0.878464178

TE D

-6.19753E-05 5.33435E-07 -2.41903E-05 -2.66714E-06 -1.6104E-06 -1.65265E-06 6.25448E-09 2.29638E-05 8.89172E-07 -4.32154E-09 2.75824E-09 1.24287E-07 2.35066E-09 8.41893E-09 -4.77137E-08 -3.22889E-07 2.46941E-07 -5.43368E-07 -1.51325E-06 -2.81093E-05 -5.72462E-05 1.91884E-05 2.24406E-05 5.52639E-07 1.65435E-07 6.42233E-07 8.07208E-07 1.07525E-06 8.09318E-07 8.07208E-07 1.89487E-06 4.52458E-07 7.46505E-09 4.04082E-09 -6.22546E-09 -4.2582E-08 6.4192E-06 6.38589E-08 -4.69786E-06 1.98926E-06 -2.45558E-06 -2.00298E-06 6.20492E-07 2.18721E-06 4.99507E-08 3.52471E-05 7.90235E-07 3.30968E-05 1.38683E-08 -5.98838E-09 -3.88899E-07 -9.33035E-06 1.06397E-06 -3.18565E-05 4.85908E-06 4.5759E-06 5.6939E-08 4.39602E-06 4.62046E-06 4.88975E-06 -3.51616E-05 -7.41365E-07 -1.14031E-05 -8.78322E-07 1.05995E-06 -1.28335E-07 -1.20353E-06 -1.27432E-08 6.09651E-05

SC

M AN U

-1.10144E-06 -2.66489E-05 -8.35602E-06 -9.16487E-06 -9.29459E-06 3.62786E-08 2.60533E-05 9.7408E-08 -2.58066E-07 1.92253E-08 2.79437E-07 -2.84274E-09 4.92253E-08 7.11833E-08 -5.62946E-07 2.72788E-08 7.10146E-06 6.95032E-06 4.08564E-05 3.05734E-05 6.25844E-07 -3.96091E-06 -7.2726E-07 -2.93655E-08 -1.08646E-06 -3.26449E-09 4.01868E-08 8.59144E-09 -3.26449E-09 4.81883E-07 -1.6133E-06 8.03811E-08 8.01411E-08 -1.9907E-08 -2.51059E-08 1.49318E-08 2.51334E-07 7.70322E-06 2.11923E-07 -8.39614E-06 -8.23017E-06 -9.42691E-07 1.24061E-06 3.19316E-08 5.83762E-06 7.52291E-09 5.23345E-06 3.22692E-08 1.1484E-08 -4.32895E-07 5.55119E-06 3.79157E-07 -6.0133E-05 1.67885E-06 1.78477E-06 1.49607E-07 2.25012E-06 1.8001E-06 8.734E-07 -2.561E-05 -1.66669E-06 5.1945E-06 -1.62387E-06 3.39112E-07 4.88653E-07 -1.2088E-06 -9.6035E-09 3.66772E-05

RI PT

ACCEPTED MANUSCRIPT 3.51494E-05

EP

0.000482203 2.51454E-06 0.000724508 8.80072E-06 1.09361E-05 1.10644E-05 1.29878E-08 0.000222484 3.54437E-06 5.79677E-07 2.26251E-09 2.00642E-07 4.60605E-09 3.00283E-08 2.08465E-07 1.61843E-06 4.74014E-07 5.66382E-06 3.11713E-06 0.000544988 0.000528632 0.000739405 0.000735637 2.86797E-06 4.66398E-07 2.68029E-06 3.48217E-06 3.86238E-06 3.48501E-06 3.48217E-06 6.12631E-06 5.78512E-06 1.59133E-08 1.6098E-08 1.9907E-08 1.40547E-07 4.12732E-06 1.27186E-07 0.000739593 7.11276E-06 8.91945E-06 8.30369E-06 2.26439E-06 4.08023E-06 3.29974E-08 6.53572E-05 3.44595E-06 6.51148E-05 3.45811E-08 7.13012E-08 6.76453E-07 2.02155E-05 3.62905E-06 0.000629085 7.24366E-06 7.13796E-06 1.07894E-07 6.57007E-06 7.07241E-06 5.34483E-06 0.000700611 2.62392E-06 1.16396E-05 2.19761E-06 3.68062E-06 1.78605E-07 1.21101E-06 2.31064E-08 0.00078158

AC C

K00239 K09928 K03501 K02276 K02274 K02275 K12508 K12506 K12500 K14587 K06597 K06596 K06595 K06598 K07978 K10906 K10908 K09819 K09818 K09817 K09816 K09812 K09811 K04058 K04059 K04056 K10015 K10014 K10017 K10016 K10011 K10013 K10019 K10018 K13665 K13668 K07641 K13590 K01465 K01460 K13599 K13598 K01469 K09251 K09252 K02041 K02043 K02044 K05549 K05548 K06046 K03317 K03314 K02945 K06162 K06163 K06160 K06166 K06164 K06165 K06168 K06169 K13020 K04835 K11991 K11622 K11626 K11629 K07567

0.119234673 0.978225001 0.147641456 0.783212069 0.815128945 0.80877392 0.103521788 0.89870186 0.978225001 0.800973833 0.266928796 0.405577122 0.485452253 0.29898007 0.85625514 0.978225001 0.945877497 0.435458169 0.078384984 0.195850973 0.055482785 0.492668583 0.31001266 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.216895935 0.218657489 0.860005446 0.802420354 0.452980155 0.069924622 0.978225001 0.978225001 0.791767067 0.821700861 0.978225001 0.918139035 0.337719309 0.09573644 0.978225001 0.137587947 0.616008997 0.978225001 0.973984306 0.711494941 0.978225001 0.124093858 0.57133813 0.613511875 0.379364168 0.614848464 0.604124862 0.537528566 0.334782688 0.89871753 0.437727604 0.89871753 0.978225001 0.091151623 0.848912695 0.49333943 0.075530197

TE D

-1.1868E-06 6.23574E-07 -3.88899E-07 -3.88899E-07 -1.34633E-09 2.76639E-05 1.0647E-07 -2.83574E-07 -1.03428E-09 3.09044E-09 -3.36308E-05 -1.87733E-05 3.21637E-06 -8.83386E-06 -6.33696E-05 -1.36725E-05 -1.68148E-06 6.61261E-06 9.99568E-07 7.11535E-08 1.76568E-06 4.96501E-08 8.05017E-07 5.23679E-07 4.80381E-07 1.91285E-05 2.17856E-05 6.46818E-08 7.57015E-06 -3.87312E-07 1.89195E-09 4.74876E-09 1.99036E-05 -3.45234E-06 -3.21222E-05 1.15337E-05 -8.25006E-07 7.87966E-07 -1.98626E-07 -2.83254E-08 8.82103E-07 2.32261E-07 5.32089E-06 -1.58923E-09 1.37215E-08 1.04245E-08 1.01508E-08 4.19813E-06 -3.96252E-06 1.52363E-06 -3.55712E-07 5.82191E-07 2.13998E-06 -1.05379E-05 -7.26254E-08 2.67003E-05 1.3371E-05 -1.20953E-05 -1.61065E-06 8.79535E-07 1.72404E-05 3.79182E-05 1.37561E-05 -1.79058E-10 -9.66121E-06 -1.171E-08 -3.53436E-05 1.06075E-06 -2.1428E-06

SC

M AN U

1.32067E-06 -4.32895E-07 -4.32895E-07 8.0043E-09 -5.54832E-07 1.32499E-06 -3.13141E-07 4.58396E-09 -8.43088E-10 7.40466E-07 -4.15268E-06 6.98049E-06 -9.31919E-06 -2.66172E-05 -4.67409E-05 -2.91299E-05 5.46241E-07 1.9696E-07 1.16131E-07 1.61618E-06 1.16646E-06 -2.12991E-08 -2.45496E-07 -3.9827E-07 -1.43605E-05 -4.98171E-05 1.3987E-07 -6.34157E-05 -4.17903E-07 1.79231E-08 3.50633E-08 1.39452E-05 6.88412E-06 9.58652E-07 2.79144E-05 -9.15722E-07 1.19447E-07 -1.51916E-07 2.10659E-06 1.74362E-06 1.49066E-06 -2.9177E-06 6.93208E-08 8.84769E-08 2.78081E-08 3.57855E-09 -5.16977E-07 9.21751E-06 1.25213E-06 1.67725E-06 -2.47182E-06 1.51666E-06 -1.9048E-06 3.29845E-06 9.55704E-06 -3.28876E-06 -2.82201E-06 -6.64582E-07 2.56415E-06 4.87021E-06 3.55648E-05 1.00298E-06 9.05334E-09 -7.84306E-06 -1.05956E-08 -1.38484E-05 3.50562E-07 -8.20774E-06

RI PT

ACCEPTED MANUSCRIPT -2.0659E-07

EP

2.35601E-06 1.88247E-06 6.76453E-07 6.76453E-07 2.89987E-09 4.9293E-05 1.23591E-06 3.15691E-07 2.56336E-09 2.96337E-09 0.000762801 0.000736673 8.62002E-06 1.33029E-05 0.000556496 0.000766589 0.00073035 4.35776E-06 3.56343E-06 9.41528E-08 3.55887E-06 1.16181E-06 3.44501E-06 4.15135E-06 4.13328E-06 0.000720919 0.000687964 1.6442E-07 0.000206541 6.8153E-07 5.77864E-09 2.80516E-08 3.75521E-05 2.10415E-05 0.000608906 4.71485E-05 1.0077E-06 3.41147E-06 2.76888E-07 5.6241E-06 8.24356E-07 4.18698E-06 1.87805E-05 9.44741E-08 5.13951E-08 9.8175E-09 9.13713E-09 2.22271E-06 8.62138E-06 4.85218E-06 8.98998E-07 6.10031E-06 3.30448E-06 2.35527E-05 3.73579E-06 9.63625E-05 8.37825E-05 2.28598E-05 3.48846E-06 7.92561E-06 2.27612E-05 0.000845884 1.24638E-05 5.57166E-09 1.25713E-05 2.47103E-08 0.00070781 3.67792E-06 8.37453E-06

AC C

K09925 K11192 K11196 K11195 K10713 K10711 K10716 K02490 K10714 K10715 K01929 K01928 K01922 K01920 K01926 K01925 K01924 K07789 K07788 K07785 K07784 K07786 K07781 K07782 K05835 K00783 K00784 K00785 K00786 K00039 K00035 K00032 K00030 K01259 K01258 K01255 K01253 K01252 K09008 K09000 K09003 K09005 K09007 K00252 K00253 K00256 K00255 K01078 K01071 K01070 K01073 K01076 K14475 K02788 K02782 K02783 K02781 K02786 K02787 K02784 K01060 K01783 K01782 K01780 K02525 K02250 K02520 K02521 K02258

0.978225001 0.88894686 0.973984306 0.973984306 0.171822136 0.180905231 0.795323225 0.697122499 0.321567705 0.60837722 0.43639045 0.795831888 0.487255115 0.560781892 0.08825469 0.110890195 0.291694774 0.455900978 0.978225001 0.522136322 0.937456319 0.848912695 0.978225001 0.989619614 0.988351249 0.362911615 0.374900024 0.568125525 0.321564243 0.978225001 0.069916387 0.511725062 0.117739082 0.757317284 0.600584421 0.291417435 0.590762166 0.97870793 0.943879206 0.978225001 0.709012676 0.72692552 0.852663896 0.473981792 0.099129702 0.123675851 0.613567443 0.58882578 0.13549271 0.978225001 0.689750165 0.87335018 0.345333582 0.860952258 0.284556453 0.627301994 0.920642585 0.561322025 0.884291984 0.968395125 0.189707103 0.169681934 0.607011233 0.402111508 0.475726829 0.579059833 0.406086666 0.978225001 0.816717446

TE D

-1.47422E-06 -4.03435E-07 6.35512E-05 -4.2944E-06 1.04766E-06 -1.49839E-08 5.34306E-09 1.63722E-06 2.71275E-06 1.10322E-06 1.29543E-06 5.88371E-08 6.47296E-09 6.01936E-07 1.08914E-09 4.53921E-06 -4.4105E-09 6.83407E-07 5.33272E-09 8.63742E-06 5.6902E-07 5.88144E-08 -1.44451E-05 -1.07775E-05 5.88144E-08 5.88144E-08 2.3198E-08 1.23972E-05 -9.91775E-08 6.43446E-07 -4.07638E-07 -3.16736E-07 -3.44753E-07 -4.05659E-07 -1.66301E-06 1.38586E-08 8.33376E-07 4.5759E-06 4.5759E-06 1.06365E-06 1.38683E-08 9.75997E-07 6.11854E-06 -1.98894E-06 9.56926E-05 8.0697E-06 2.89781E-07 2.13375E-06 -2.44779E-08 9.8424E-09 9.8424E-09 9.8424E-09 2.9241E-07 -1.24661E-07 7.99268E-06 -1.26553E-11 1.33832E-05 6.42052E-06 -1.15001E-06 1.07861E-06 8.57834E-07 5.64227E-07 -3.73542E-07 7.35674E-07 -1.71693E-05 -1.84592E-07 6.67656E-06 4.80415E-06 4.79241E-06

SC

M AN U

7.56878E-06 6.82159E-06 -1.03226E-05 3.49915E-07 6.93301E-08 -4.57748E-10 1.2219E-07 8.70234E-07 6.8793E-07 6.02511E-07 1.16278E-07 6.93293E-08 -6.02277E-07 6.58776E-10 -9.71723E-06 -4.69844E-09 -9.97618E-07 5.14117E-08 1.0292E-05 9.85509E-07 1.14265E-07 2.32792E-05 3.14907E-06 1.14265E-07 1.14265E-07 5.66051E-08 -6.47406E-05 4.12643E-07 -4.0972E-07 -1.2898E-07 -3.85186E-07 1.21874E-06 -1.32998E-07 4.82845E-06 3.34393E-08 7.2445E-08 1.78477E-06 1.78477E-06 3.72943E-07 3.22692E-08 4.78095E-07 6.32168E-06 9.01695E-07 -2.59737E-05 1.63547E-05 -8.84304E-07 -1.8016E-07 1.11435E-08 7.07775E-08 7.07775E-08 7.07775E-08 -8.72646E-07 5.0976E-07 2.70297E-06 4.13481E-09 4.66765E-06 3.4404E-07 -1.08242E-06 3.79469E-07 5.73595E-08 -2.17831E-07 -2.54823E-07 3.06026E-08 2.03803E-05 -2.25616E-07 6.97196E-06 -8.45547E-08 -8.32481E-08

RI PT

ACCEPTED MANUSCRIPT -9.10165E-06

EP

1.07177E-05 0.000739602 0.000162595 1.88043E-05 3.59089E-06 5.23281E-08 4.36536E-09 6.99605E-06 1.09064E-05 3.82667E-06 4.03186E-06 7.5316E-08 4.82711E-09 7.80446E-07 2.06471E-09 2.72635E-05 8.60417E-09 2.73101E-06 2.78802E-08 1.30048E-05 1.71948E-06 7.53242E-08 1.83199E-05 1.41947E-05 7.53242E-08 7.53242E-08 3.86092E-08 0.000412985 3.2992E-06 4.47113E-06 7.26506E-07 1.89028E-06 1.65818E-06 7.24461E-07 5.97649E-06 3.45735E-08 3.53439E-06 7.13796E-06 7.13796E-06 3.71004E-06 3.45811E-08 3.05531E-06 1.18823E-05 6.51365E-06 0.00143771 3.04055E-05 4.98942E-06 2.00707E-05 7.2037E-08 3.45435E-08 3.45435E-08 3.45435E-08 4.99131E-06 1.79787E-07 7.69801E-06 5.07904E-09 1.68742E-05 4.24558E-06 1.23699E-06 3.71552E-06 3.51748E-06 4.18432E-06 6.85125E-07 3.56961E-06 2.67727E-05 2.36611E-07 1.17864E-05 2.79749E-06 2.8006E-06

AC C

K02259 K02528 K03780 K03782 K03788 K03124 K12526 K12525 K09786 K09781 K09780 K10960 K10965 K06311 K06314 K06317 K11387 K11384 K11383 K04032 K04033 K04037 K04034 K04035 K04038 K04039 K07044 K07045 K02584 K10037 K04785 K04781 K04782 K04783 K13607 K05783 K05782 K05781 K05780 K05787 K05784 K05789 K05788 K01446 K01448 K05569 K02063 K05566 K05565 K05563 K05562 K05561 K02064 K03339 K03332 K03333 K03336 K12957 K12950 K06149 K06144 K06145 K06146 K06141 K06143 K13810 K14665 K11607 K11606

0.818699061 0.978225001 0.077793393 0.839216271 0.978225001 0.455900978 0.680110934 0.978225001 0.949761932 0.978225001 0.978225001 0.547500475 0.239243018 1 0.962358809 0.406627701 0.641382498 0.978225001 0.238046809 0.465397552 0.958007779 0.55895016 0.08131979 0.581383693 0.55895016 0.55895016 0.525480448 0.523022723 0.991848618 0.981674722 0.978225001 0.979747825 0.978225001 0.978225001 0.459923032 0.593345482 0.978225001 0.613511875 0.613511875 0.978225001 0.616008997 0.978225001 0.492946578 0.891779703 0.286336321 0.559602636 0.978225001 0.978225001 0.827831533 0.091631055 0.091631055 0.091631055 0.978225001 0.088636989 0.220905537 0.906235746 0.082566426 0.464992692 0.877739844 0.978225001 0.978225001 0.989397998 0.978225001 0.979384842 0.122815627 0.892401989 0.43181012 0.54034505 0.542327065

TE D

4.79241E-06 4.80045E-06 -6.85335E-07 2.70153E-05 1.11632E-05 1.12123E-05 9.62242E-07 1.07733E-06 7.66156E-09 1.06637E-06 1.0786E-06 4.03459E-09 -2.803E-07 8.15341E-07 8.03432E-07 -1.00748E-05 1.07264E-06 2.48438E-07 -7.44455E-07 3.01294E-05 8.61388E-06 0.000112747 -2.71952E-06 -3.53055E-07 -1.29983E-08 5.52597E-08 3.3312E-06 7.80617E-07 2.67497E-10 4.42453E-07 1.63566E-06 1.06384E-06 -1.01704E-06 1.17525E-07 2.0135E-06 7.92003E-07 -3.58096E-07 5.81715E-08 8.3949E-07 1.05946E-05 1.14395E-05 8.21715E-07 1.06208E-06 1.06141E-06 9.91187E-07 7.79687E-06 7.71528E-07 4.07937E-06 7.97975E-07 2.44527E-05 -4.8233E-05 -6.66105E-10 -5.44271E-10 -6.66105E-10 -8.51427E-09 8.59693E-07 4.40006E-09 4.23393E-09 3.48657E-08 3.48657E-08 3.48657E-08 6.22733E-06 2.1539E-08 3.85485E-06 4.32274E-07 1.05458E-07 2.51287E-06 3.07277E-09 -9.03772E-07

SC

M AN U

-8.34555E-08 -9.33105E-08 -4.65111E-06 1.73456E-05 1.76515E-05 1.05313E-06 3.78318E-07 1.04749E-07 3.80415E-07 3.78957E-07 6.74014E-08 -6.40328E-07 5.75719E-08 4.46976E-09 -7.96358E-06 -9.16777E-07 -9.72265E-07 3.75489E-06 -8.54103E-06 -1.36596E-05 1.26921E-05 -2.49411E-06 7.79425E-07 -8.74447E-09 1.08835E-07 5.08801E-06 -4.79928E-07 1.63834E-09 -1.04411E-05 6.11056E-08 9.41632E-06 -7.07906E-06 2.12656E-07 9.09114E-07 -3.05423E-05 -3.45476E-07 1.14427E-07 1.33082E-05 -1.54827E-05 -1.45187E-05 -2.03684E-05 3.31461E-07 3.33022E-07 2.5785E-07 2.89346E-06 -3.83615E-07 4.07526E-06 -3.05459E-05 -2.80766E-05 -1.01521E-05 4.15163E-08 2.64434E-08 4.15163E-08 1.30315E-08 5.90027E-08 3.78816E-08 3.6575E-08 9.84544E-07 9.84544E-07 9.84544E-07 -5.11496E-06 9.23329E-09 -1.10467E-06 -9.60722E-07 1.90209E-06 5.54275E-06 5.56684E-08 -9.60983E-07

RI PT

ACCEPTED MANUSCRIPT -8.32481E-08

EP

2.8006E-06 2.80132E-06 4.19046E-06 5.71312E-05 1.24019E-05 1.24399E-05 5.06055E-06 3.71667E-06 1.0984E-07 3.71182E-06 3.71603E-06 3.45236E-08 1.0246E-06 3.49426E-06 3.36796E-06 1.0068E-05 2.07528E-06 4.55222E-06 1.92059E-06 7.29564E-05 0.000698437 0.000549184 3.74734E-06 5.77921E-07 2.07861E-08 7.95698E-08 6.72938E-06 3.30069E-06 1.79958E-09 1.77665E-05 7.05115E-06 5.16695E-06 1.43077E-05 1.58685E-07 2.99892E-06 0.000732948 7.31233E-07 7.47058E-08 1.44646E-05 0.000706577 0.000705831 0.000720264 3.67678E-06 3.67757E-06 3.51912E-06 5.4337E-06 3.36589E-06 1.23985E-05 0.000732974 0.00079642 0.001844065 3.33645E-08 3.33841E-08 3.33645E-08 2.43463E-08 3.51583E-06 3.08747E-08 3.21766E-08 1.15356E-06 1.15356E-06 1.15356E-06 6.98982E-06 5.03406E-08 4.41705E-06 5.17152E-06 1.4339E-06 1.21683E-05 2.93905E-08 1.23681E-06

AC C

K11605 K11604 K10558 K10559 K10550 K10551 K10557 K07235 K07234 K07237 K07236 K07231 K07233 K07232 K02467 K05304 K05303 K02565 K08643 K00010 K00013 K00016 K08252 K08253 K08255 K08259 K00274 K00276 K00273 K01274 K00906 K00904 K00903 K00908 K01053 K01056 K01055 K01054 K01058 K02500 K02501 K02503 K02504 K02505 K02506 K02507 K02508 K02509 K03106 K03101 K03100 K12541 K12543 K12542 K12545 K06080 K11016 K11017 K11014 K11015 K11013 K06883 K06882 K09857 K06884 K06887 K06886 K10942 K09859

0.542327065 0.540767285 0.978225001 0.187008286 0.102128246 0.093758396 0.978225001 0.978225001 0.393503389 0.978225001 0.978225001 0.097063541 0.853172933 0.978225001 0.978225001 0.49698934 0.877739844 0.978225001 0.252046799 0.09451063 0.629719682 0.142561044 0.89871753 0.238046809 0.487021349 0.580783346 0.513528249 0.978225001 0.860189113 0.887699774 0.978225001 0.298986805 0.73174021 0.593994105 0.877991063 0.197699759 0.978225001 0.555087186 0.639184795 0.610706696 0.615204384 0.5474367 0.978225001 0.978225001 0.978225001 0.377669023 0.978225001 0.876104541 0.197699759 0.075696773 0.789349166 0.421300877 0.73681942 0.421300877 0.916512751 0.978225001 0.442256658 0.486893642 0.89871753 0.89871753 0.89871753 0.584727207 1 0.768272151 0.978225001 0.604124862 0.891682283 0.216967742 0.884291984

TE D

6.35983E-06 1.33828E-05 -3.77697E-07 -3.75553E-07 6.05401E-08 8.89047E-07 1.06121E-06 8.00426E-06 2.66911E-07 5.49416E-07 6.99965E-07 -1.32195E-08 7.95737E-07 8.57328E-07 4.40497E-08 8.65063E-06 9.96918E-07 7.12447E-06 2.65342E-07 4.35815E-08 5.60803E-08 -1.50353E-05 -1.53689E-08 3.85199E-08 -3.62429E-06 2.41002E-07 9.31397E-06 -1.17746E-06 -3.56827E-06 1.6996E-06 8.12102E-07 2.28906E-05 5.84979E-06 3.94838E-10 5.97536E-06 5.81419E-08 1.56503E-08 1.07059E-06 8.59696E-07 5.41291E-07 7.99493E-07 3.60888E-09 5.38038E-08 -7.35516E-07 8.59693E-07 8.59693E-07 3.55472E-09 5.81419E-08 5.81783E-08 5.81419E-08 5.81419E-08 5.81419E-08 5.81419E-08 5.81419E-08 5.81419E-08 5.81419E-08 5.81419E-08 4.02541E-05 5.88063E-08 7.32E-06 1.23474E-07 -5.57778E-05 2.23495E-05 3.64979E-08 8.59478E-07 -4.8532E-06 4.17193E-08 5.56361E-09 3.48831E-05

SC

M AN U

1.73529E-05 -3.82713E-07 -9.72906E-08 1.12671E-07 -3.36606E-07 3.28249E-07 1.18138E-05 1.79196E-06 -2.98063E-07 -4.3891E-07 -8.42318E-09 1.17587E-07 6.29741E-08 1.46817E-06 1.031E-05 5.57593E-06 1.9861E-05 1.79926E-06 1.46984E-06 1.93776E-06 -1.01934E-05 7.08408E-08 1.24062E-07 -4.36926E-06 -3.40638E-07 5.05585E-06 -9.52409E-07 -4.30561E-06 -1.48254E-06 2.99656E-07 -1.45982E-05 -3.89627E-06 1.1092E-08 6.43527E-06 1.11373E-07 9.05414E-08 -6.5284E-07 6.0377E-08 -2.89903E-07 -8.04153E-09 5.15939E-08 1.16373E-06 -7.19256E-07 5.90027E-08 5.90027E-08 2.33095E-09 1.11373E-07 1.14855E-07 1.11373E-07 1.11373E-07 1.11373E-07 1.11373E-07 1.11373E-07 1.11373E-07 1.11373E-07 1.11373E-07 2.86887E-05 1.1135E-07 4.8945E-06 1.06325E-07 3.31849E-05 1.74565E-05 1.34391E-08 6.11362E-08 -6.56025E-06 5.43264E-08 5.34597E-08 -4.02191E-05

RI PT

ACCEPTED MANUSCRIPT 5.64711E-06

EP

1.29059E-05 1.46794E-05 7.22392E-07 8.31979E-07 7.7223E-08 3.43644E-06 3.67703E-06 1.87585E-05 1.54107E-06 4.14508E-06 4.56105E-06 2.14165E-08 2.80651E-06 3.51946E-06 1.2139E-06 1.29988E-05 8.70565E-06 2.92088E-05 1.44699E-06 1.21223E-06 3.91026E-06 1.56932E-05 5.32783E-08 1.1061E-07 1.16457E-05 5.85458E-07 2.28867E-05 1.7219E-06 2.33094E-05 2.74102E-06 2.81335E-06 5.46832E-05 8.27148E-06 3.38226E-09 1.11776E-05 7.47168E-08 9.02462E-08 8.36321E-06 3.51583E-06 4.05856E-06 3.45563E-06 2.97082E-08 1.16454E-06 7.35876E-07 3.51583E-06 3.51583E-06 1.46942E-08 7.47168E-08 7.47036E-08 7.47168E-08 7.47168E-08 7.47168E-08 7.47168E-08 7.47168E-08 7.47168E-08 7.47168E-08 7.47168E-08 8.95666E-05 7.47491E-08 1.73106E-05 7.61997E-08 0.000152764 4.63362E-05 9.10712E-08 3.51733E-06 1.03523E-05 4.23489E-08 2.86749E-08 0.000150068

AC C

K09858 K00483 K00481 K00480 K00486 K00484 K09901 K07684 K07685 K07686 K07687 K07681 K07688 K07689 K04018 K04019 K04014 K04015 K04016 K04017 K04013 K07063 K07064 K07065 K07067 K07068 K07069 K13629 K13628 K13622 K13620 K01428 K01429 K13086 K07287 K02722 K12979 K12972 K12973 K12974 K12975 K12976 K07821 K07683 K12288 K12289 K12283 K11957 K11956 K11955 K11954 K11953 K11952 K11951 K11950 K11959 K11958 K13889 K11963 K07217 K07215 K07214 K07213 K07218 K12150 K01043 K00154 K10531 K10536

0.615818699 0.098710941 0.978225001 0.978225001 0.560781892 0.978225001 0.978225001 0.542412405 0.622219493 0.988487791 0.97914664 0.481640199 0.978225001 0.978225001 0.738774294 0.464735798 0.419205738 0.274353696 0.609629821 0.738072682 0.723033225 0.075419875 0.434935841 0.536104586 0.796747922 0.787545028 0.590293636 0.89870186 0.978225001 0.623619594 0.978225001 0.147883337 0.160962795 0.073266362 0.485600936 0.560781892 0.398559865 0.988352676 0.978225001 0.988766521 0.978225001 0.236195393 0.849657883 0.876179133 0.978225001 0.978225001 0.978225001 0.560781892 0.552616025 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.383149347 0.560781892 0.786836142 0.055096638 0.314728572 0.54034505 0.88418482 0.978225001 0.387357204 0.293838094 0.199493092 0.105422791

TE D

2.98191E-09 8.12955E-07 1.05735E-05 -9.34097E-07 5.01876E-05 -3.43952E-05 -4.18334E-05 4.66024E-08 1.0883E-07 8.4401E-07 5.81538E-08 2.74234E-08 5.00056E-08 4.18801E-06 4.97637E-08 1.99717E-07 6.43485E-06 -1.15373E-05 8.02524E-07 -5.32779E-06 -3.09487E-06 -4.6294E-06 2.28988E-06 -6.48367E-06 1.07044E-06 1.53701E-05 -6.24723E-06 -3.99338E-06 -6.1611E-05 8.90535E-07 8.89256E-07 3.97402E-07 5.89089E-06 1.04296E-06 8.68119E-07 1.06344E-06 5.883E-08 5.82211E-06 8.89256E-07 -0.000200482 -5.10474E-05 -2.19537E-09 -2.09573E-08 6.68643E-06 8.58721E-07 1.06427E-06 6.42155E-06 5.64618E-07 8.19775E-07 2.19492E-06 1.1009E-06 1.77839E-06 6.30973E-06 -2.38168E-06 -1.62909E-06 4.86142E-06 4.41739E-07 1.08793E-06 8.62372E-07 6.4943E-06 1.35711E-05 1.60278E-05 5.11086E-08 1.56299E-06 -8.13855E-06 8.14441E-07 -1.15477E-06 5.88063E-08 9.63597E-07

SC

M AN U

-3.91666E-09 6.8047E-06 9.08157E-07 2.29892E-05 -5.52639E-05 -2.10733E-05 1.07473E-07 2.12824E-07 -3.04942E-05 1.12534E-07 1.08332E-07 1.24766E-06 2.52527E-06 1.23655E-06 1.6073E-06 4.19487E-07 5.05978E-06 3.43143E-07 1.85488E-05 4.38832E-06 1.33644E-05 2.88463E-07 5.33807E-05 3.87806E-07 -1.95205E-05 -2.59475E-05 -2.85649E-05 2.9551E-05 1.14808E-07 1.14168E-07 2.41183E-06 7.97353E-06 -1.45395E-07 1.44489E-06 3.43738E-07 1.13671E-07 8.6316E-06 1.14168E-07 -6.85E-05 -8.16292E-10 9.75015E-10 1.85566E-08 6.85863E-07 7.10891E-08 3.55726E-07 3.1665E-08 -2.60936E-07 1.24088E-08 2.92539E-05 4.97918E-07 5.79872E-07 5.12448E-06 2.49381E-05 -3.29092E-07 8.39848E-05 1.62231E-06 -3.0189E-05 6.93645E-08 7.07489E-06 -5.0905E-05 -2.63247E-05 1.16259E-06 4.08721E-07 -9.00006E-06 1.78976E-08 -3.36692E-06 1.1135E-07 -7.74436E-07

RI PT

ACCEPTED MANUSCRIPT -2.18448E-08

EP

6.4273E-08 3.45901E-06 3.99266E-06 2.59753E-06 8.09652E-05 0.000626399 0.000735064 8.69597E-08 1.56093E-07 0.000733007 7.47125E-08 1.52464E-07 1.21307E-06 3.74323E-06 1.17066E-06 1.6911E-06 4.41273E-06 1.17822E-05 3.39794E-06 2.00869E-05 7.62006E-06 7.81324E-06 3.67864E-06 7.37687E-05 3.71108E-06 4.49709E-05 0.000726333 0.000730923 0.000295314 3.55924E-06 3.55988E-06 3.49508E-06 9.28926E-06 3.59957E-06 3.25028E-06 3.67782E-06 7.47404E-08 1.1367E-05 3.55988E-06 0.001807711 0.000680242 8.78287E-09 4.31228E-08 4.46178E-06 3.51681E-06 3.67936E-06 4.13012E-06 4.17826E-06 3.48641E-06 0.000156895 3.84749E-06 1.67784E-06 1.55829E-05 1.79694E-05 3.68977E-06 0.000511222 1.00857E-06 0.000732452 3.51746E-06 1.21904E-05 0.000725346 0.000877586 1.17616E-06 7.12773E-06 1.32711E-05 3.47888E-06 1.73946E-05 7.47491E-08 2.20693E-06

AC C

K10535 K10538 K00073 K13934 K00076 K00077 K00075 K00079 K02290 K02563 K02292 K02294 K08279 K08276 K08277 K00298 K00299 K00294 K07757 K01210 K01215 K01216 K01219 K01218 K02742 K00924 K00925 K00927 K00929 K02298 K02299 K02568 K02569 K02562 K02291 K02560 K02293 K02567 K02297 K03169 K03168 K11038 K07669 K07666 K07664 K07662 K07663 K07660 K07661 K03927 K07008 K07002 K07000 K07006 K07004 K07005 K03921 K02956 K01407 K01150 K01151 K01409 K05523 K05522 K05527 K05526 K05524 K14518 K14519

1 0.978225001 0.050774557 0.978225001 0.058210128 0.358011054 0.195601142 0.60380649 0.593994105 0.197699759 0.560781892 0.826081151 0.822297292 0.628471666 0.822297292 0.903513315 0.467751082 0.435458169 0.978225001 0.196770679 0.406882911 0.39763143 0.560781892 0.343823404 0.978225001 0.069304577 0.458713031 0.266478734 0.167944508 0.978225001 0.978225001 0.568553868 0.253102228 0.978225001 0.813323253 0.978225001 0.559363104 0.233482753 0.978225001 0.075517491 0.097599688 0.978225001 0.718239862 0.436430318 0.978225001 0.978225001 0.453122957 0.988766521 0.978225001 0.756109982 0.978225001 0.814724716 0.802420354 0.092189509 0.886288523 0.161892538 0.873438399 0.206255354 0.978225001 0.435458169 0.082566426 0.665120258 0.849657883 0.979010779 0.60837722 0.978225001 0.978225001 0.560781892 0.910103102

TE D

-6.3989E-09 9.12319E-07 9.17713E-06 -6.3989E-09 3.48512E-05 8.41368E-09 7.63813E-06 1.22355E-05 5.98731E-06 1.06028E-06 -4.24489E-06 2.46902E-07 -2.50145E-07 9.75099E-06 -3.27923E-06 -6.71254E-08 5.12817E-08 8.60301E-07 8.56251E-07 -6.73889E-08 8.07937E-07 1.34252E-06 8.63809E-07 7.98858E-07 1.07255E-06 2.60876E-06 8.04432E-07 -3.9491E-06 -8.71976E-05 7.34935E-07 1.57728E-06 -1.90313E-06 9.59814E-08 6.08256E-06 5.88063E-08 -8.75557E-09 -3.38915E-07 8.45789E-07 1.07626E-06 -5.87123E-09 4.89874E-06 -5.60312E-06 4.09873E-09 7.37111E-09 6.34316E-05 -1.10088E-08 -5.60997E-09 7.57743E-06 6.02992E-05 0.000101661 8.47082E-07 8.93916E-08 -1.93363E-06 -1.97437E-07 -1.29522E-08 -2.45932E-06 7.84169E-07 2.7944E-06 2.16482E-06 -3.46104E-07 -7.49954E-07 -1.48012E-05 -1.33995E-06 4.62819E-12 -1.56607E-06 7.6297E-06 1.36737E-08 7.46912E-07 -1.33512E-08

SC

M AN U

1.49838E-07 -9.43679E-07 -9.3185E-09 -3.28049E-05 5.38698E-08 9.19848E-07 2.75322E-06 6.43539E-06 3.29828E-07 4.87212E-06 1.27071E-06 -6.41635E-08 -3.35541E-05 -1.44786E-06 -1.30712E-06 1.16621E-06 9.13264E-08 9.07251E-08 -1.29829E-06 -2.33931E-07 7.62883E-07 9.21913E-08 5.85106E-09 -9.19836E-07 4.5158E-06 -2.04844E-08 -2.85109E-06 1.77223E-05 -1.07862E-08 -1.66195E-06 -8.24034E-06 2.63945E-06 6.51252E-06 1.1135E-07 2.68658E-08 -1.03912E-06 1.73257E-07 -8.69399E-07 1.5446E-08 -6.70763E-07 1.08482E-05 1.74775E-07 1.10107E-07 -2.17625E-05 -2.16227E-06 7.5056E-09 -5.87797E-06 0.000108518 1.7083E-05 8.07698E-08 4.3663E-06 3.1319E-06 1.26897E-06 2.69594E-06 2.73212E-06 -2.24391E-07 3.49212E-06 6.46422E-07 7.81043E-07 -7.41265E-07 -4.62813E-05 -8.84184E-07 1.2355E-08 9.7503E-06 6.43512E-06 8.58147E-08 -3.07648E-05 1.79333E-07

RI PT

ACCEPTED MANUSCRIPT -9.3185E-09

EP

1.70492E-08 3.5829E-06 1.74714E-05 1.70492E-08 5.90193E-05 4.22473E-08 8.07975E-06 5.43982E-06 1.11833E-05 3.67841E-06 9.28225E-06 1.12114E-06 3.14063E-07 4.34862E-05 7.02705E-06 1.72056E-06 1.16348E-06 3.43845E-06 3.43438E-06 1.71119E-06 2.7846E-06 3.46072E-06 3.43291E-06 3.36521E-06 2.07562E-06 2.51554E-06 3.44419E-06 4.37883E-06 0.000216586 3.76236E-06 8.42744E-06 8.27394E-06 2.389E-06 1.1194E-05 7.47491E-08 1.28679E-08 1.58789E-06 3.70295E-06 2.08168E-06 6.35179E-09 5.7576E-06 5.33936E-05 1.19693E-08 6.29614E-08 0.000227558 3.78E-06 1.58957E-08 1.45576E-05 0.000193555 0.000323886 3.42847E-06 4.28144E-06 3.13528E-06 5.0594E-07 3.33158E-06 9.84473E-06 3.36894E-06 3.66524E-06 3.21987E-06 5.72817E-07 8.39861E-07 0.000757817 1.27897E-06 4.3206E-09 1.11441E-05 1.46496E-05 7.20763E-08 0.000732842 3.51022E-08

AC C

K02171 K02170 K02173 K02172 K06416 K03379 K03808 K03809 K03806 K03804 K12296 K03802 K06413 K01028 K01029 K11931 K11930 K11933 K11932 K11935 K11937 K11936 K11939 K11938 K10800 K06419 K11929 K07270 K07273 K07275 K07274 K07276 K07279 K07278 K11520 K02480 K08170 K02485 K09956 K09957 K09954 K09952 K09953 K09950 K09951 K09958 K09959 K07495 K07497 K07496 K07490 K07493 K07492 K07499 K07498 K11209 K11208 K11201 K11200 K00729 K00055 K00057 K00720 K14189 K14188 K14187 K01236 K01890 K02764

0.738072682 0.978225001 0.214391011 0.738072682 0.155719502 0.373895353 0.709656893 0.082300031 0.485337124 0.978225001 0.464735798 0.617805562 0.483857176 0.105900561 0.648963088 0.847062542 0.848912695 0.978225001 0.978225001 0.848912695 0.978225001 0.978225001 0.978225001 0.978225001 0.877739844 0.063728941 0.978225001 0.696390984 0.077113255 0.979384842 0.978225001 0.823880733 0.800973833 0.477913404 0.560781892 0.216159812 0.89870186 0.978225001 0.877991063 0.21595039 0.665120258 0.886288523 0.150079273 0.213086172 0.110866503 0.965270676 0.881923217 0.877991063 0.145557267 0.168416655 0.978225001 0.880570179 0.334640538 0.234036746 0.827382784 0.848912695 0.978225001 0.616288023 0.877739844 0.243908367 0.864937093 0.070117681 0.358771211 0.060893016 0.103521788 0.639122385 0.294384248 0.192639002 0.39126297

TE D

-1.75182E-05 8.24493E-06 -7.7334E-05 2.60525E-07 7.84593E-06 1.39175E-05 -2.69674E-06 -8.42638E-08 -1.60796E-06 2.74655E-06 3.20522E-06 -1.60578E-06 1.09121E-05 8.40668E-07 7.63854E-07 1.78607E-06 -6.8568E-07 1.0604E-06 1.06543E-06 1.07949E-06 1.06121E-06 1.06304E-06 -3.18945E-07 1.06028E-06 1.00415E-06 1.06028E-06 1.06869E-06 1.06028E-06 -7.01012E-07 3.38611E-08 1.2324E-06 1.43854E-05 -5.68328E-06 3.4442E-06 6.21142E-06 1.1547E-05 3.80372E-05 5.12817E-08 8.31687E-07 -2.71802E-05 -9.92337E-10 -1.35098E-05 5.84753E-08 6.39545E-06 4.10362E-09 3.20878E-08 3.01178E-05 -3.2145E-06 1.22448E-06 -6.2509E-06 2.49998E-08 -1.49839E-08 -8.76367E-06 4.4757E-07 1.65056E-05 4.13385E-05 1.07261E-06 -3.09956E-06 8.1911E-06 -1.14281E-06 -9.84223E-06 -4.82871E-08 3.2057E-05 9.43231E-07 2.76059E-06 -6.42978E-09 -4.40923E-09 -1.97376E-07 4.25478E-09

SC

M AN U

-1.52386E-05 3.98537E-05 -4.29664E-07 8.29184E-06 1.43372E-05 -9.68968E-08 8.57837E-06 -6.65426E-07 -2.27331E-06 1.10566E-06 -3.25522E-07 5.87948E-06 4.44338E-06 2.14721E-07 -1.84504E-06 -1.72161E-06 3.42525E-07 3.44053E-07 3.77869E-07 3.28249E-07 3.43553E-07 -8.76635E-07 3.29828E-07 2.12925E-07 3.29828E-07 3.85709E-07 3.29828E-07 -1.23394E-06 1.10165E-07 3.19669E-07 3.44811E-07 -9.54442E-06 -3.12322E-05 -6.72738E-07 6.69783E-06 6.78264E-05 1.16621E-06 -8.85447E-08 2.50306E-05 5.08034E-08 -2.17899E-07 1.81915E-07 3.13368E-05 5.70001E-08 9.11634E-08 3.82212E-05 3.89086E-05 4.32125E-07 -9.23365E-06 2.21431E-08 6.93301E-08 -3.53248E-06 7.64453E-07 -2.91616E-06 -3.17788E-05 -9.05348E-07 -0.000202909 3.83919E-06 -8.1543E-07 -1.21414E-05 1.15241E-07 1.3318E-05 1.44981E-08 1.34918E-08 1.62976E-08 1.95009E-08 1.57794E-07 4.71205E-08

RI PT

ACCEPTED MANUSCRIPT -1.36446E-05

EP

0.000785693 0.000274072 0.001282359 6.67016E-07 1.18014E-05 2.39958E-05 5.16207E-06 1.24103E-05 3.48552E-06 5.86013E-06 8.79717E-06 3.57957E-06 1.3425E-05 1.25535E-05 3.47908E-06 4.32106E-06 2.51719E-06 3.67903E-06 3.67317E-06 3.71599E-06 3.67703E-06 3.67938E-06 2.75647E-06 3.67841E-06 3.68413E-06 3.67841E-06 3.70834E-06 3.67841E-06 2.5281E-06 2.00877E-07 4.14547E-06 1.78442E-05 1.51016E-05 0.000654327 5.82124E-06 1.20049E-05 0.000582018 1.16348E-06 2.84897E-06 0.000565399 3.88665E-08 1.80091E-05 1.11515E-07 0.001142671 4.39687E-08 6.9037E-08 0.000174442 0.000649542 3.81042E-06 1.40093E-05 6.75868E-09 5.23281E-08 1.37093E-05 1.03037E-06 7.23752E-05 0.000112407 2.07536E-06 0.000592646 7.57226E-06 1.73711E-06 3.29201E-05 1.3361E-07 0.000554597 4.14344E-06 4.99561E-06 2.07128E-08 1.93667E-08 8.80051E-07 2.79779E-08

AC C

K00942 K00943 K00941 K00947 K01093 K03490 K03493 K03492 K02817 K02814 K02815 K02818 K03636 K03146 K06048 K06045 K06044 K09897 K09896 K09895 K09894 K09893 K09892 K09891 K09890 K09899 K09898 K07648 K07649 K07399 K07640 K07393 K07390 K07391 K07644 K07645 K07646 K07647 K07026 K07027 K07020 K07021 K07028 K07029 K01390 K02673 K05895 K00554 K00557 K00556 K00551 K01170 K01173 K01174 K01175 K01176 K01178 K01179 K03828 K03829 K03820 K03821 K03823 K03824 K03825 K12242 K12243 K12240 K11913

0.782379266 0.978225001 0.074220218 0.573863813 0.281541482 0.280763155 0.753013541 0.805395747 0.884473701 0.660409218 0.89340201 0.895358974 0.424139661 0.978225001 0.979384842 0.920245786 0.897272301 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.659584498 0.978225001 0.217173692 0.751356735 0.337733968 0.609608847 0.282509439 0.225640681 0.848912695 0.978225001 0.669078376 0.293024369 0.511106379 0.224444314 0.870478632 0.242113342 0.108613238 0.225896543 0.254647889 0.978225001 0.337733968 0.204364457 0.455900978 0.288136158 0.388312676 0.799346256 0.275099769 0.877739844 0.134935737 0.607011233 0.920245786 0.694986241 0.26832645 0.395763697 0.978225001 0.87236342 0.87307182 0.823880733 0.880631007 0.28055197

TE D

4.69564E-09 8.38791E-07 3.30717E-07 -4.22897E-09 2.37355E-09 2.6693E-09 1.92667E-09 1.87499E-08 3.03829E-08 2.86607E-08 2.86607E-08 2.48453E-08 1.71059E-08 -2.78925E-06 3.98976E-08 3.07941E-08 8.42682E-07 1.04576E-05 -1.9763E-05 -4.08573E-07 -4.11049E-07 5.88063E-08 -4.07638E-07 -1.26082E-09 3.03999E-06 5.6725E-06 -3.14194E-05 8.77397E-07 8.64585E-07 -2.7669E-06 8.8334E-06 1.93141E-06 5.49146E-07 4.41048E-07 8.71112E-07 3.3645E-06 -3.56852E-07 -6.80287E-09 3.86299E-06 3.22815E-05 -1.94349E-05 7.18344E-09 5.2945E-08 2.23246E-08 3.71238E-06 1.09496E-07 1.86031E-07 7.88125E-07 5.88063E-08 5.88063E-08 -6.60313E-08 1.49143E-05 1.51325E-05 3.67858E-10 -4.18232E-05 4.03121E-05 7.9027E-07 7.83684E-07 5.31238E-06 4.94067E-08 3.68265E-05 -2.14335E-05 -5.69515E-06 5.30908E-05 3.1906E-07 3.73968E-06 -8.8533E-08 -1.75839E-08 8.47135E-07

SC

M AN U

-4.65516E-07 1.60365E-07 1.78553E-08 4.42925E-08 6.50268E-08 4.35258E-08 1.0433E-06 1.0753E-06 1.07359E-06 1.07359E-06 1.08382E-06 1.04104E-06 -7.20987E-06 9.93482E-07 1.07617E-06 -1.19564E-07 -1.02588E-05 -2.05322E-06 -1.34737E-07 -1.32713E-07 1.1135E-07 -1.2898E-07 5.33003E-08 5.57241E-06 7.07973E-06 1.99485E-05 1.57281E-07 8.41257E-08 -5.41872E-06 3.75447E-08 2.42758E-05 7.81457E-07 -6.17528E-07 9.9617E-08 -1.415E-06 2.18595E-09 1.3083E-09 -3.20334E-05 1.62582E-05 -2.10726E-05 1.5381E-08 2.72264E-07 2.7502E-08 -5.03282E-07 2.128E-07 2.3369E-07 -3.62973E-09 1.1135E-07 1.1135E-07 3.78545E-06 1.55221E-05 7.31553E-05 2.57992E-08 4.19649E-05 8.61967E-05 -3.05136E-05 -3.05623E-05 7.28574E-06 1.17415E-06 -5.30937E-06 -5.76426E-05 -3.44771E-06 -4.29447E-05 4.17724E-06 -1.7487E-06 -3.78455E-07 5.12348E-08 1.11223E-07

RI PT

ACCEPTED MANUSCRIPT 4.67176E-08

EP

2.7953E-08 3.3668E-06 2.77249E-06 1.91741E-08 2.97333E-08 2.99483E-08 2.97759E-08 1.27408E-06 1.1938E-06 1.19551E-06 1.19551E-06 1.21447E-06 1.27572E-06 9.59477E-06 1.16567E-06 1.1938E-06 3.50765E-06 3.64977E-05 2.50412E-05 7.27574E-07 7.30239E-07 7.47491E-08 7.26506E-07 3.50367E-08 8.85696E-06 9.44689E-06 5.32774E-05 3.47572E-06 3.51438E-06 9.49874E-06 1.11236E-05 1.20753E-05 1.67661E-06 7.01653E-07 3.54882E-06 3.20407E-06 5.34436E-07 2.10535E-08 0.000731132 0.000225288 0.000708863 9.3144E-09 4.67019E-07 6.83507E-08 9.12203E-06 1.56125E-07 2.62737E-07 3.35882E-06 7.47491E-08 7.47491E-08 4.01118E-06 3.11791E-05 0.000191453 9.63515E-09 0.000502193 0.000625792 0.000732387 0.000732977 8.46879E-06 1.16438E-06 3.44888E-05 0.000579139 2.14332E-05 0.000261929 6.1361E-06 3.57877E-06 6.68143E-07 5.6713E-08 3.43868E-06

AC C

K11912 K11911 K11910 K11917 K11916 K11915 K11914 K12068 K12062 K12063 K12060 K12061 K12066 K12067 K12064 K12065 K07251 K07250 K07257 K05372 K05373 K05371 K05374 K05375 K09970 K09971 K09973 K09975 K09978 K09979 K11261 K11263 K11264 K10794 K13053 K03192 K00964 K00961 K00962 K00963 K00969 K12681 K02703 K08364 K08365 K02706 K08363 K08361 K02708 K02709 K08368 K08369 K01615 K01617 K01613 K01619 K02834 K02835 K03619 K03618 K03616 K03614 K03611 K03610 K09705 K09701 K09700 K09709 K11074

0.281466331 0.978225001 0.992259567 0.860952258 0.335301773 0.168953697 0.351598219 0.886288523 0.877739844 0.877739844 0.877739844 0.876986193 0.887160522 0.87307182 0.89871753 0.877739844 0.978225001 0.607024647 0.189835758 0.978225001 0.978225001 0.560781892 0.978225001 0.233675353 0.588106435 0.349631099 0.059812862 0.978225001 0.978225001 0.657734762 0.14437356 0.103558651 0.978225001 0.376891188 0.978225001 0.678279309 0.600626549 0.978225001 0.142871185 0.81719334 0.421946352 0.560781892 0.917796999 0.909276643 0.911926243 0.593994105 0.285309441 0.978225001 0.560781892 0.560781892 0.298004473 0.418845363 0.175329335 0.060935869 0.131066988 0.091254751 0.199171278 0.197699759 0.327188244 0.848452218 0.303484981 0.128390151 0.935287645 0.06819834 0.789654455 0.662666084 0.867548785 0.495879552 0.978225001

TE D

8.34776E-07 8.3958E-07 8.75916E-07 3.46683E-07 -1.11944E-06 6.47296E-09 1.53195E-05 3.3244E-09 -3.61891E-07 6.18476E-09 5.90228E-08 2.54406E-05 4.29558E-08 -6.29514E-08 5.79029E-07 2.12793E-06 2.12911E-06 -4.4105E-09 -3.13696E-07 3.78417E-08 3.39592E-08 1.30857E-06 1.17858E-06 8.68283E-07 8.03253E-07 3.01343E-07 3.02952E-06 -1.37899E-06 -4.69442E-08 -1.04091E-07 9.33825E-05 1.47999E-07 1.04519E-08 5.06476E-09 5.16202E-08 4.60722E-08 4.93671E-08 -1.47655E-06 1.05521E-06 6.47296E-09 6.47296E-09 1.83817E-05 8.57834E-07 7.7554E-06 1.09496E-07 -3.87915E-07 -3.89085E-07 1.33519E-06 2.73886E-08 -8.51624E-06 7.82155E-07 7.82155E-07 7.75028E-07 3.94838E-10 1.54245E-07 3.44543E-08 -4.8832E-10 -1.06382E-07 8.07982E-07 6.5879E-08 -1.44319E-09 4.67508E-06 1.06121E-06 1.06304E-06 8.78798E-07 1.06121E-06 6.41402E-06 8.54507E-07 9.65353E-06

SC

M AN U

1.09383E-07 2.45791E-07 -9.9505E-08 -8.40789E-07 6.93293E-08 7.85841E-06 2.9699E-08 2.37527E-06 1.58787E-08 1.29894E-07 -3.95922E-05 4.78741E-08 2.62606E-07 -1.85149E-06 -3.12762E-06 -3.19347E-06 -4.69844E-09 -1.16853E-07 1.00069E-06 9.9751E-07 1.22002E-07 -9.24986E-08 2.17886E-07 9.2705E-08 1.50644E-06 -1.88937E-06 -1.32178E-06 2.61387E-07 1.37081E-05 2.59847E-05 4.66231E-07 7.64523E-11 5.2619E-08 8.93271E-08 8.82429E-08 7.48489E-08 -2.42498E-06 -9.33721E-07 6.93293E-08 6.93293E-08 8.01619E-06 5.73595E-08 7.67858E-06 2.128E-07 -4.20815E-07 -4.30384E-07 -3.40633E-05 3.40198E-06 -9.25203E-06 -8.78155E-09 -8.78155E-09 -1.46361E-07 1.1092E-08 1.11217E-06 9.84543E-07 4.61615E-08 2.37346E-06 -5.1052E-08 2.2054E-07 1.53386E-09 3.07349E-07 3.28249E-07 3.42179E-07 1.02459E-07 3.28249E-07 3.79914E-07 5.90443E-08 1.34863E-05

RI PT

ACCEPTED MANUSCRIPT 9.60042E-08

EP

3.42795E-06 3.46235E-06 3.56324E-06 4.82248E-07 1.89578E-06 4.82711E-09 1.20863E-05 2.91856E-08 1.26814E-07 1.01142E-08 7.46737E-08 5.27291E-05 1.98826E-08 5.47123E-08 3.91479E-06 3.73189E-06 3.68494E-06 8.60417E-09 5.11933E-07 1.15908E-06 1.15538E-06 3.75608E-06 4.78556E-06 2.88231E-06 2.89598E-06 9.13981E-07 8.25351E-06 1.47047E-06 2.07456E-07 1.27945E-05 0.000483905 2.044E-07 4.71181E-09 2.82424E-08 8.16739E-08 6.9942E-08 3.73278E-08 2.54184E-06 2.17814E-06 4.82711E-09 4.82711E-09 0.000741686 3.51748E-06 1.35775E-05 1.56125E-07 6.77025E-07 6.76691E-07 4.2152E-05 1.96797E-06 1.31399E-05 3.36397E-06 3.36397E-06 3.38841E-06 3.38226E-09 5.16968E-07 1.15356E-06 3.83815E-08 1.14789E-07 3.47169E-06 1.95745E-07 1.68751E-09 4.04666E-06 3.67703E-06 3.67938E-06 3.55214E-06 3.67703E-06 4.27376E-06 3.53458E-06 1.77697E-05

AC C

K11075 K11076 K11073 K06936 K06938 K13381 K05916 K05913 K05910 K05918 K00392 K00390 K00395 K01376 K01225 K09145 K09144 K09146 K09141 K05709 K05708 K05875 K05874 K05877 K05876 K05873 K00573 K01157 K01112 K01113 K04477 K01114 K01115 K08085 K08084 K08083 K08082 K01152 K09822 K10934 K10930 K01755 K03840 K03841 K13799 K13795 K13794 K12268 K12269 K12262 K12264 K12265 K12266 K12237 K13245 K13244 K12415 K10211 K09918 K09919 K06720 K09913 K09910 K09911 K09916 K09917 K09915 K11535 K11534

0.978225001 0.978225001 0.978225001 0.548757803 0.927240654 0.239243018 0.115437912 0.630183515 0.170750945 0.548757803 0.466995862 0.135223457 0.3568204 0.208228487 0.693804014 0.18254955 0.173784946 0.641382498 0.878464178 0.898519128 0.89870186 0.978225001 0.978225001 0.978225001 0.978225001 0.453122957 0.89871753 0.876179133 0.265823345 0.572000613 0.123203525 0.142992563 0.256502843 0.234261723 0.189516631 0.133338767 0.09573644 0.237750223 0.878464178 0.239243018 0.239243018 0.849602167 0.978225001 0.471256862 0.593994105 0.977908719 0.974355418 0.145498858 0.412421052 0.578018241 0.978225001 0.978225001 0.978225001 0.073266362 0.073349565 0.89871753 0.277911544 0.164196585 0.978225001 0.369916821 0.465177015 0.60192026 0.978225001 0.978225001 0.978225001 0.978225001 0.466995862 0.978225001 0.122848519

TE D

7.82766E-07 1.09496E-07 -1.9869E-05 3.66409E-05 1.26405E-06 7.62472E-06 7.98399E-06 3.95625E-06 -5.40399E-05 3.30195E-05 2.42029E-07 -2.18817E-07 -7.60375E-08 1.80601E-07 -1.88509E-05 3.00618E-06 6.89367E-05 -1.52858E-05 1.10419E-07 1.19112E-05 -3.38389E-06 1.0148E-05 -3.69894E-07 7.88125E-07 7.8597E-07 1.10247E-07 -4.4105E-09 5.88063E-08 3.44543E-08 5.9892E-06 7.30799E-06 -4.37822E-05 1.44965E-06 8.66668E-07 -6.39771E-06 4.99642E-07 9.03455E-06 7.64711E-07 4.09002E-07 -7.79881E-07 8.26455E-07 8.20113E-07 5.49896E-07 -8.28297E-06 -2.74518E-06 1.05864E-06 5.97488E-06 -6.2258E-07 -1.94405E-06 6.43692E-06 7.82424E-06 8.13587E-07 -7.87293E-08 9.2195E-07 -9.72358E-06 1.94255E-05 3.72156E-08 2.65286E-06 8.75751E-07 2.2893E-05 3.54885E-05 -8.95264E-06 8.5875E-07 3.39962E-05 9.1141E-07 2.28873E-05 2.28879E-05 5.88063E-08 -9.16781E-06

SC

M AN U

2.128E-07 -5.246E-05 -4.55098E-06 3.20713E-07 2.12896E-05 1.0589E-05 1.0475E-05 -5.13254E-05 -1.47158E-05 -1.09495E-06 1.63373E-06 -8.92807E-09 1.26635E-06 3.53426E-05 -5.99516E-06 -5.99237E-06 -5.69343E-06 1.34767E-06 -9.19929E-07 3.40074E-05 -2.26754E-05 7.61673E-07 -3.62973E-09 -2.16455E-07 2.13527E-07 -4.69844E-09 1.1135E-07 9.84543E-07 6.39661E-06 1.57098E-05 -5.37679E-05 1.35902E-06 1.41788E-07 1.31531E-05 -3.20048E-07 1.09411E-05 -4.02704E-07 -2.63827E-05 2.69173E-06 2.84772E-07 -6.82475E-08 7.81833E-07 7.00683E-06 -1.49647E-06 3.27968E-07 6.50891E-06 -4.04662E-07 -2.92904E-06 3.8695E-07 1.21441E-05 5.50114E-08 4.2526E-07 -9.16088E-08 -9.42841E-06 4.11524E-05 9.75846E-08 8.55706E-07 6.06389E-08 -1.46099E-05 -5.04991E-06 -9.38108E-06 6.03653E-08 -8.91468E-06 1.53035E-07 -1.46107E-05 -1.46105E-05 1.1135E-07 3.50087E-05

RI PT

ACCEPTED MANUSCRIPT -4.8209E-07

EP

3.30138E-06 1.56125E-07 0.000536468 0.000587531 4.21517E-06 4.1594E-05 1.59832E-05 2.18121E-05 0.000349013 0.00024327 4.92177E-06 4.00302E-07 1.5115E-07 1.15789E-06 0.000127224 1.65823E-05 0.000227041 0.000766687 1.27874E-06 2.1078E-05 4.03525E-05 0.00072504 6.17221E-07 3.35882E-06 3.34237E-06 1.55409E-07 8.60417E-09 7.47491E-08 1.15356E-06 1.1311E-05 5.81194E-05 0.000492402 4.73368E-06 3.59596E-06 1.22375E-05 4.00417E-06 7.40428E-06 3.33166E-06 4.45377E-05 9.56353E-07 2.89538E-06 2.75828E-06 1.69298E-06 1.27335E-05 4.11811E-06 3.68164E-06 1.1281E-05 1.02805E-05 1.31544E-05 4.36299E-06 2.00405E-05 3.41697E-06 9.45624E-07 4.17797E-06 1.37976E-05 0.000633152 1.04969E-07 6.76161E-06 3.51694E-06 5.46782E-05 8.33117E-05 1.33078E-05 3.52131E-06 7.66054E-05 3.58931E-06 5.46815E-05 5.46819E-05 7.47491E-08 2.29591E-05

AC C

K11531 K11532 K00767 K00765 K00769 K00184 K00185 K00183 K00180 K10110 K10111 K10116 K04641 K13282 K00989 K00984 K00980 K00981 K01584 K13497 K01589 K01588 K14941 K08347 K08348 K02720 K14949 K02723 K03459 K03981 K03980 K01639 K01638 K01637 K01635 K01631 K01630 K02615 K02589 K02859 K14051 K14053 K14052 K02853 K02850 K02851 K14058 K02586 K02587 K03670 K03673 K03672 K03675 K03674 K03676 K09761 K09763 K09764 K06006 K03187 K03186 K03185 K03184 K03182 K03181 K03189 K03188 K02715 K12454

0.978225001 0.593994105 0.237337045 0.313621003 0.978225001 0.548277737 0.542436995 0.680515009 0.532849411 0.789349166 0.978225001 0.126867646 0.910103102 0.635216773 0.222249701 0.620194369 0.079435742 0.880677963 0.789654455 0.386419962 0.131066988 0.238523378 0.238046809 0.978225001 0.978225001 0.592871843 0.641382498 0.560781892 0.89871753 0.486886206 0.816532142 0.188499366 0.978225001 0.978225001 0.182813477 0.988938244 0.100399704 0.978225001 0.099129702 0.364218566 0.978225001 0.978225001 0.978225001 0.589834602 0.945877497 0.978225001 0.484808015 0.989619614 0.919572801 0.465821122 0.548757803 0.978225001 0.978225001 0.978225001 0.526424067 0.206692563 0.679652073 0.641337955 0.978225001 0.147870701 0.060204499 0.560781892 0.978225001 0.051727212 0.978225001 0.147870701 0.147870701 0.560781892 0.230104715

TE D

4.96501E-08 8.06148E-07 1.0398E-06 3.44543E-08 3.44543E-08 3.44543E-08 3.44543E-08 6.28381E-07 5.40577E-07 1.06677E-06 3.12671E-07 -8.60344E-06 2.23718E-07 1.00288E-05 3.43224E-09 9.31827E-07 5.69111E-09 5.93497E-09 -1.42901E-07 1.32172E-05 2.88159E-06 3.53383E-08 7.92862E-06 1.01274E-06 -4.7865E-08 8.51083E-09 1.10537E-06 6.40427E-06 5.53713E-08 2.27993E-08 1.06897E-06 8.11407E-07 -8.80203E-06 7.92906E-07 1.72834E-07 1.21651E-07 5.88422E-08 1.11262E-07 -6.18778E-05 -3.71932E-07 5.88063E-08 5.88063E-08 5.88063E-08 1.09582E-07 5.88063E-08 5.88063E-08 8.19089E-06 -0.000106549 1.31693E-06 -1.54544E-07 -2.94139E-05 -1.53408E-05 1.57084E-06 1.29568E-06 4.91682E-05 1.77848E-05 1.67402E-05 3.67012E-05 5.83487E-09 -4.47777E-08 1.05165E-06 4.15898E-09 -3.15938E-06 -1.27854E-06 -1.71471E-07 -3.6368E-07 2.35636E-07 -1.14139E-06 -1.14819E-06

SC

M AN U

-2.46569E-07 9.46407E-07 9.84543E-07 9.84543E-07 9.84543E-07 9.84543E-07 1.36299E-06 -2.11005E-07 3.52492E-07 -1.83384E-06 -9.29073E-06 1.22075E-05 4.41834E-06 4.98365E-08 1.04141E-06 5.57356E-08 4.24287E-08 2.51802E-06 1.01672E-06 -3.16429E-05 1.28608E-08 6.24257E-08 -9.33045E-07 4.01208E-08 -1.79304E-09 4.05182E-07 2.71076E-05 1.26925E-06 1.213E-08 3.82114E-07 1.74251E-08 2.48703E-05 1.96924E-08 -1.83235E-08 2.64395E-07 1.14831E-07 2.14233E-07 -9.95615E-05 -1.47313E-06 1.1135E-07 1.1135E-07 1.1135E-07 2.13551E-07 1.1135E-07 1.1135E-07 1.21172E-05 6.37473E-06 -5.67421E-07 5.49564E-06 7.05569E-06 1.4643E-05 -3.21999E-06 -1.3767E-06 -2.85001E-06 2.16002E-05 -6.50316E-07 -1.59012E-06 4.66313E-08 4.80941E-06 6.23907E-07 4.97989E-08 1.36734E-05 -8.41368E-06 2.06582E-07 -4.3137E-07 -3.12662E-09 -1.29127E-06 -1.28801E-06

RI PT

ACCEPTED MANUSCRIPT 1.16646E-06

EP

1.16181E-06 2.73048E-06 4.58365E-06 1.15356E-06 1.15356E-06 1.15356E-06 1.15356E-06 1.81991E-06 4.057E-06 3.6818E-06 6.8331E-06 1.32461E-05 1.02584E-05 3.87796E-06 2.94538E-08 1.66855E-06 3.50323E-08 2.90825E-08 1.7068E-07 8.89446E-06 0.000688048 8.9815E-08 5.12715E-06 2.10042E-06 1.65084E-07 1.65762E-08 3.71791E-06 1.5732E-05 1.20122E-06 5.10478E-08 3.71144E-06 3.48256E-06 1.82534E-05 3.39578E-06 4.61888E-07 2.06915E-07 7.47359E-08 1.56174E-07 0.000566437 1.52986E-06 7.47491E-08 7.47491E-08 7.47491E-08 1.55377E-07 7.47491E-08 7.47491E-08 1.20202E-05 0.000854239 4.25969E-06 3.27039E-06 3.11398E-05 1.65874E-05 6.05224E-06 2.59093E-06 0.000774388 0.000551718 3.91912E-05 0.000595941 3.3496E-08 1.37253E-05 3.66817E-06 2.87399E-08 1.17911E-05 1.41765E-05 8.84864E-07 7.67641E-07 5.06969E-07 1.72582E-06 1.7254E-06

AC C

K07358 K07356 K07357 K07354 K07355 K07352 K07353 K07350 K07351 K06918 K06917 K06916 K08987 K08984 K08985 K08982 K08983 K08988 K05937 K05939 K00378 K00376 K00372 K09166 K09165 K09164 K09160 K01354 K01355 K05601 K05851 K03807 K05606 K03805 K00518 K00510 K00514 K05971 K03154 K11147 K05581 K05580 K05583 K05582 K05585 K05584 K05589 K03150 K03623 K14205 K01134 K01135 K01136 K01137 K02113 K02117 K02116 K02118 K02448 K01036 K03212 K13007 K13006 K13004 K13001 K01032 K06951 K03862 K03863

0.848912695 0.978225001 0.978225001 0.89871753 0.89871753 0.89871753 0.89871753 0.878477017 0.989619614 0.978225001 0.978225001 0.574928117 0.19789644 0.293838094 0.26524048 0.565161021 0.18958241 0.360082124 0.132334739 0.440830613 0.520618271 0.89340201 0.287473648 0.889415567 0.732789041 0.974636515 0.978225001 0.076554948 0.813834786 1 0.978225001 0.978225001 0.111638551 0.978225001 0.978225001 0.459923032 0.552616025 0.590762166 0.056965361 0.590762166 0.560781892 0.560781892 0.560781892 0.592871843 0.560781892 0.560781892 0.085684633 0.102128246 0.978225001 0.280578093 0.059184218 0.214509031 0.899245967 0.773149483 0.238046809 0.865943585 0.251750746 0.632912852 0.316449402 0.88894686 0.978225001 0.254497801 0.44043202 0.45698411 0.870807209 0.978225001 0.949032232 0.857623261 0.858498572

TE D

1.06345E-06 -6.53669E-07 4.34026E-09 4.34026E-09 8.61583E-07 1.08711E-06 8.13832E-07 -5.52791E-06 1.64918E-06 -6.43419E-08 8.59056E-09 8.59693E-07 -4.29557E-08 -5.9199E-06 -1.21454E-06 6.01559E-08 -2.42833E-08 3.99622E-05 -9.65374E-07 -5.888E-08 -2.14412E-07 3.29578E-05 7.85369E-07 -1.51899E-05 4.31475E-08 8.40352E-07 -1.70755E-05 5.88063E-08 4.63353E-05 2.54352E-07 -2.51964E-06 -3.01841E-05 1.6766E-06 7.9192E-07 -2.04103E-07 -5.13057E-05 1.2213E-07 7.91621E-07 8.69398E-07 -2.45478E-05 1.13942E-05 5.82971E-09 -3.45566E-07 8.89373E-07 -6.40479E-06 -2.75764E-06 2.17547E-05 1.07189E-06 0.000136282 1.11311E-06 -2.58536E-06 -4.4105E-09 1.48123E-06 -5.29998E-05 -2.05515E-06 3.40634E-06 -3.36372E-06 -6.51435E-06 5.67885E-08 5.39665E-06 8.86445E-05 -4.89263E-06 -2.22482E-09 4.91936E-09 -3.04588E-07 -1.87404E-06 -8.09082E-05 -5.6709E-09 1.1296E-06

SC

M AN U

-1.72299E-06 3.19623E-08 3.19623E-08 6.09323E-08 1.32373E-06 2.35264E-07 -3.25288E-05 -3.60231E-07 -2.03724E-06 5.00354E-08 5.90027E-08 7.91398E-07 -4.76773E-06 -1.00582E-06 1.19131E-07 -1.13495E-08 7.17632E-06 2.84754E-06 -1.33666E-06 -4.04753E-07 1.8286E-05 -5.79894E-09 -1.94618E-06 1.46334E-06 3.57817E-08 4.30962E-05 1.1135E-07 -3.39811E-05 1.28877E-06 -3.01874E-05 -1.5995E-05 -2.90677E-05 -3.05485E-05 -3.09779E-05 -2.80964E-05 2.07248E-07 8.9321E-09 1.02971E-07 1.33978E-05 1.58391E-06 4.74829E-08 9.66437E-08 1.11496E-07 -9.99515E-06 -2.63391E-06 1.39057E-05 4.43088E-07 1.57621E-06 4.43253E-07 -5.69215E-06 -4.69844E-09 2.44052E-06 -8.41725E-06 -4.34442E-05 -5.72812E-06 -5.42344E-06 -1.0075E-05 1.29644E-07 -2.14323E-06 1.27912E-05 4.62269E-06 1.35769E-09 1.4246E-08 -1.27715E-06 -4.58519E-07 -2.31044E-05 1.82289E-08 -8.42608E-07

RI PT

ACCEPTED MANUSCRIPT 3.45113E-07

EP

3.67782E-06 2.41753E-06 2.80955E-08 2.80955E-08 3.51894E-06 3.62072E-06 2.80651E-06 0.000735733 2.26725E-06 3.73268E-06 3.15375E-08 3.51583E-06 8.57386E-07 5.93804E-06 3.41937E-06 7.84906E-08 4.5582E-08 0.000135086 5.58654E-06 1.77207E-06 1.18656E-06 6.695E-05 3.36099E-06 3.01247E-05 1.20858E-06 3.50349E-06 0.000525806 7.47491E-08 0.000715379 4.30365E-07 0.000731464 0.000716881 0.000728099 0.000732976 0.000732823 0.000686795 1.95616E-06 3.36629E-06 3.54613E-06 0.000680441 1.01845E-05 3.34942E-08 4.73691E-07 3.55974E-06 1.53175E-05 2.93112E-06 2.67584E-05 3.80824E-06 0.001632997 3.75571E-06 1.32846E-05 8.60417E-09 4.75466E-06 0.000153408 0.000545371 1.82275E-05 5.96344E-06 1.06252E-05 7.68283E-08 4.72986E-06 0.000514601 1.25226E-05 4.41542E-08 4.32835E-09 2.64734E-06 5.10027E-06 0.000616033 1.16481E-08 2.14533E-06

AC C

K06957 K06954 K10814 K10816 K07136 K13918 K06214 K06217 K09930 K09932 K09938 K13301 K00745 K00743 K07165 K07167 K07161 K07160 K07162 K07169 K07168 K08322 K08320 K08321 K08326 K08324 K01658 K02637 K01653 K01655 K02874 K02876 K02871 K02878 K02879 K09748 K09740 K03477 K03472 K03470 K03478 K02305 K02303 K02300 K02301 K03653 K03652 K03651 K03657 K03656 K03658 K12437 K06979 K06978 K06973 K06976 K07083 K07081 K07086 K07084 K07089 K00356 K00354 K00353 K05952 K00689 K00680 K00683 K00685

0.978225001 0.894045697 0.575076939 0.575076939 0.978225001 0.978225001 0.978225001 0.163052689 0.696840391 0.978225001 0.306216424 0.978225001 0.901870504 0.374900024 0.978225001 0.525480448 0.834980987 0.169681934 0.330640143 0.833983709 0.978225001 0.148031093 0.978225001 0.641382498 0.741407687 0.978225001 0.277206371 0.560781892 0.186477883 0.220028369 0.265224825 0.414339666 0.240001821 0.197699759 0.1938772 0.071709788 0.981674722 0.978225001 0.978225001 0.519299193 0.060602172 0.300056068 0.2216672 0.978225001 0.697896552 0.876986193 0.359068805 0.978225001 0.05239283 0.978225001 0.689263433 0.641382498 0.745886408 0.153004616 0.455584152 0.624204016 0.482646767 0.265662758 0.471256862 0.186477883 0.084901605 0.858639742 0.997085995 0.489885134 0.978225001 0.908880987 0.288136158 0.208373828 0.868899815

TE D

-3.01351E-06 1.99381E-09 5.66466E-06 -1.13563E-06 1.42308E-06 -2.00673E-07 8.70628E-07 2.79564E-05 1.2227E-05 -3.45041E-08 1.09582E-07 2.50329E-07 2.68738E-07 0.000125461 9.29317E-07 1.226E-09 4.00292E-08 5.33272E-09 6.23578E-09 1.06028E-06 1.00567E-06 4.86799E-07 6.02783E-06 5.88063E-08 6.06678E-06 2.89914E-06 8.01155E-08 2.461E-05 8.149E-07 3.39857E-06 6.82759E-06 6.64727E-08 1.91133E-06 3.17366E-06 -7.68481E-07 -1.58792E-06 -7.58251E-07 4.70025E-07 4.99355E-07 4.30015E-07 1.44013E-08 4.68299E-10 1.45132E-06 -6.64382E-07 -6.88323E-07 1.31384E-08 1.64769E-08 4.74155E-06 7.98444E-07 -6.49414E-06 1.71656E-06 6.08463E-06 6.08463E-06 1.44506E-05 6.08463E-06 6.35789E-07 1.75647E-07 1.84408E-07 5.53506E-07 6.06734E-06 5.51808E-07 2.10366E-07 -2.84435E-08 2.21856E-06 8.57834E-07 3.68546E-07 1.90555E-06 8.57331E-07 -3.49642E-05

SC

M AN U

-3.16118E-10 6.03482E-06 -1.68475E-06 1.07498E-06 2.54973E-05 8.43974E-08 -5.1411E-05 5.19134E-06 -7.76276E-08 2.13551E-07 3.69681E-08 1.28933E-06 9.45871E-06 1.0757E-07 3.79919E-08 9.04099E-08 5.14117E-08 5.26996E-08 3.29828E-07 2.48257E-07 9.29526E-07 6.91364E-06 1.1135E-07 -3.44149E-05 3.73394E-07 1.99049E-07 -7.76293E-06 2.06834E-08 2.18978E-05 -2.10108E-06 1.2492E-06 4.841E-06 7.62162E-06 -8.96959E-07 -1.35632E-06 -8.47794E-07 -2.17624E-07 -2.0964E-07 -2.18736E-07 3.38159E-08 2.63883E-08 4.83206E-07 -1.41926E-06 -1.20653E-06 9.87897E-09 7.17256E-09 1.81349E-06 -2.38196E-08 8.15967E-06 1.30926E-07 1.95758E-06 1.95758E-06 -7.96538E-06 1.95758E-06 -1.09514E-06 1.46989E-07 4.412E-07 -5.95598E-07 1.78467E-06 -5.96791E-07 5.16698E-07 -8.34183E-08 6.16975E-06 5.73595E-08 1.64201E-06 6.66634E-07 5.68057E-08 -3.24917E-05

RI PT

ACCEPTED MANUSCRIPT 6.50865E-06

EP

7.57335E-06 2.03157E-09 1.09194E-05 3.27639E-06 4.6404E-06 1.43565E-05 3.54768E-06 0.000167792 1.10536E-05 1.68411E-07 1.55377E-07 4.72703E-07 3.18295E-07 0.000338289 3.55821E-06 3.92162E-08 8.50688E-08 2.78802E-08 2.77725E-08 3.67841E-06 3.60898E-06 2.96727E-06 1.03528E-05 7.47491E-08 0.000738672 5.72831E-06 1.22277E-07 0.000709195 3.47884E-06 2.28551E-05 1.14186E-05 1.20899E-06 6.12079E-06 6.62665E-06 1.43373E-06 2.78611E-06 1.36874E-06 4.08543E-06 4.0968E-06 4.21563E-06 3.7879E-08 3.15796E-08 5.07447E-06 2.56995E-06 2.47959E-06 1.08693E-08 7.41995E-09 6.97239E-06 3.45084E-06 9.96617E-06 7.03177E-06 2.57751E-06 2.57751E-06 0.00069493 2.57751E-06 2.76627E-06 5.66519E-07 6.02644E-07 3.01601E-06 2.56345E-06 3.01634E-06 7.64779E-07 1.73082E-07 5.19366E-06 3.51748E-06 1.01771E-06 7.38643E-06 3.51803E-06 0.001431986

AC C

K00687 K00686 K05834 K05836 K05839 K05838 K07677 K00533 K00532 K00531 K00535 K00534 K00538 K14260 K14261 K14266 K14267 K14268 K14269 K02682 K02681 K02680 K02686 K02689 K00826 K00823 K00822 K01489 K01484 K01485 K01482 K01483 K02468 K02466 K02465 K02464 K02463 K02462 K02461 K02460 K13061 K13063 K13069 K08964 K03078 K13285 K13287 K13281 K13283 K00054 K05368 K03228 K03229 K00052 K03222 K03223 K03220 K03221 K03226 K03227 K03224 K03225 K09482 K05363 K08682 K08687 K11751 K11750 K11753

0.222249701 0.773730262 0.537339905 0.975075984 0.978225001 0.061746486 0.978225001 0.131066988 0.060167875 0.973984306 0.592871843 0.944340515 0.206968605 0.053209267 0.978225001 0.487255115 0.178656932 0.238046809 0.225174174 0.978225001 0.978225001 0.978225001 0.387830045 0.560781892 0.102862264 0.891139221 0.160212474 0.420600997 0.978225001 0.070924443 0.527570497 0.823177197 0.42796637 0.171715543 0.971003245 0.978225001 0.978225001 0.991834924 0.991154727 0.992517199 0.642469694 0.712043693 0.978225001 0.952972718 0.978225001 0.560549011 0.415613239 0.197699759 0.978225001 0.168780103 0.978225001 0.387865762 0.387865762 0.753656236 0.387865762 0.978225001 0.9767413 0.641382498 0.978225001 0.394096267 0.978225001 0.580096723 0.958007779 0.238302604 0.978225001 0.16736682 0.978225001 0.978225001 0.395995723

TE D

1.57791E-05 1.70252E-06 -7.04121E-07 -9.31858E-07 -6.8575E-07 -9.33209E-07 -9.33209E-07 -6.87602E-07 1.04144E-06 3.52862E-06 1.75237E-07 6.25706E-06 -9.1243E-06 1.18747E-06 4.24908E-05 8.57543E-07 -2.6829E-06 -5.0048E-06 9.23451E-06 -1.48042E-05 -2.97953E-05 6.52679E-06 6.31659E-06 1.3197E-06 -2.25127E-06 -1.50519E-05 8.6248E-07 3.68454E-05 5.19556E-07 7.93067E-07 -1.35447E-06 -3.14231E-05 -3.78854E-06 8.1724E-07 8.25555E-07 5.81419E-08 5.88063E-08 5.88063E-08 5.88063E-08 5.88063E-08 5.88063E-08 2.32168E-05 1.63132E-05 9.74392E-07 3.45159E-07 1.86418E-09 -7.6985E-10 6.74835E-08 1.90911E-07 1.18399E-07 8.05017E-07 -9.83635E-06 -9.83635E-06 -4.35117E-06 1.88975E-07 1.41792E-06 8.59693E-07 8.54361E-07 1.72629E-07 -1.35073E-09 4.96501E-08 -1.32283E-05 2.57402E-05 8.02244E-07 -2.73696E-06 4.98903E-06 4.96501E-08 -1.59451E-06 2.05658E-05

SC

M AN U

4.80413E-07 -1.48769E-06 9.09916E-07 -1.45656E-06 9.10213E-07 9.10213E-07 -1.45306E-06 -1.34131E-07 5.74508E-06 -1.96253E-08 5.43976E-07 -2.69041E-07 8.13771E-06 -8.74278E-06 1.99693E-07 8.34446E-06 -4.12777E-05 -2.86916E-05 7.42079E-06 1.67682E-05 6.47296E-06 6.51408E-06 3.55821E-07 2.31663E-05 4.55118E-05 6.19943E-08 3.15649E-05 1.6454E-06 2.19424E-08 3.8441E-06 -1.60518E-05 -2.89883E-05 -3.05202E-05 -3.05376E-05 1.11373E-07 1.1135E-07 1.1135E-07 1.1135E-07 1.1135E-07 1.1135E-07 -4.09204E-05 -4.58648E-05 4.57698E-07 3.80665E-07 5.20942E-09 2.702E-09 3.50212E-07 1.34623E-06 2.23443E-07 -2.12991E-08 -1.05067E-05 -1.05054E-05 -3.01902E-06 1.24229E-06 1.06914E-06 5.90027E-08 2.89824E-08 1.90134E-06 -1.00655E-07 1.16646E-06 2.01934E-05 -4.24768E-05 -2.42917E-08 -2.63505E-06 6.95289E-06 1.16646E-06 1.16115E-05 -3.24857E-05

RI PT

ACCEPTED MANUSCRIPT -0.000109427

EP

0.0002208 5.92881E-06 2.44017E-06 2.59522E-06 2.47067E-06 2.59648E-06 2.59648E-06 2.47523E-06 3.58968E-06 7.71827E-06 4.58046E-07 4.70819E-06 2.20638E-05 1.21053E-05 0.000203715 3.6531E-06 1.22855E-05 0.000685532 0.000738031 2.20028E-05 0.00027406 1.22181E-05 1.1695E-05 4.16081E-06 2.80268E-05 0.000541531 3.51284E-06 0.000125842 9.81821E-07 2.87556E-06 2.936E-06 0.000718233 0.000728276 0.000732943 0.000732965 7.47168E-08 7.47491E-08 7.47491E-08 7.47491E-08 7.47491E-08 7.47491E-08 0.000123968 0.000102513 3.10383E-06 8.49311E-07 3.80634E-09 2.27198E-09 2.91238E-07 1.32675E-06 1.8376E-07 3.44501E-06 1.52922E-05 1.52922E-05 7.40524E-06 1.32693E-06 4.64624E-06 3.51583E-06 3.41445E-06 3.20032E-06 2.59597E-07 1.16181E-06 2.55686E-05 0.000216575 3.448E-06 2.99286E-06 9.13779E-06 1.16181E-06 2.06114E-05 9.81231E-05

AC C

K02407 K13938 K13936 K13935 K13933 K13932 K13931 K13930 K09612 K05394 K05395 K07147 K07146 K07145 K07141 K07140 K01816 K01814 K01810 K01819 K01818 K08304 K08305 K08306 K08300 K08301 K08308 K08309 K01672 K01671 K01674 K02899 K02895 K02892 K02890 K02096 K02097 K02094 K02095 K02092 K02093 K03411 K03412 K03414 K03417 K13543 K13540 K13541 K12145 K12144 K12147 K12141 K12140 K12143 K12142 K12149 K12148 K07312 K07310 K07317 K07314 K07315 K07319 K03425 K03423 K03757 K03755 K11144 K03752

0.067823994 0.978225001 0.935287645 0.978225001 0.944601394 0.978225001 0.978225001 0.945356409 0.978225001 0.540767285 0.978225001 0.491442929 0.848452218 0.532545607 0.256502843 0.978225001 0.697896552 0.093086132 0.181202033 0.466334677 0.627301994 0.471256862 0.470833247 0.978225001 0.373895353 0.190891682 0.978225001 0.563896296 0.853154734 0.978225001 0.575161895 0.393503389 0.264920096 0.19789644 0.197731698 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.125498087 0.09329834 0.978225001 0.413979415 0.544711064 0.657734762 0.252921814 0.797134313 0.310858105 0.978225001 0.186833375 0.186833375 0.839747643 0.831390393 0.978225001 0.978225001 0.978225001 0.724751507 0.907674954 0.848912695 0.224444314 0.411557581 0.978225001 0.877739844 0.395495116 0.848912695 0.483857176 0.138270599

TE D

3.71103E-06 -8.51134E-07 -8.16192E-07 -2.12471E-08 2.89648E-05 5.1404E-08 4.34026E-09 1.53322E-05 5.81334E-09 -1.80754E-08 3.50196E-07 -1.91528E-06 1.27502E-06 5.59495E-07 5.47512E-07 8.68585E-07 8.59253E-07 -2.53176E-05 3.44561E-08 2.69005E-06 1.13057E-05 -2.30823E-06 1.53177E-06 8.57834E-07 5.91008E-06 6.21025E-06 4.16672E-06 4.537E-08 4.00258E-08 6.75078E-08 4.26433E-08 -2.61432E-07 1.78792E-07 7.18897E-06 4.11219E-08 2.20198E-05 6.04704E-07 2.18488E-06 2.48953E-05 8.82559E-07 8.83313E-07 5.58042E-05 -1.06382E-07 7.42211E-06 2.56861E-07 1.51146E-07 -1.60368E-06 1.73087E-06 -4.12662E-07 -5.92139E-06 7.92991E-07 -2.79659E-06 -5.46513E-06 -4.08131E-06 4.96511E-07 -1.216E-06 5.36082E-08 -4.27753E-06 8.64948E-10 -6.03559E-06 -1.63824E-08 -3.24079E-06 8.79489E-09 -3.53208E-07 1.24193E-06 1.79514E-06 1.15844E-06 1.09153E-06 -8.27295E-06

SC

M AN U

-7.36396E-06 -7.35471E-06 9.0379E-08 5.07825E-05 1.65538E-07 3.19623E-08 5.57628E-06 1.65297E-08 -1.51897E-08 -1.02441E-07 1.87981E-05 4.81604E-06 7.34101E-07 7.40597E-07 1.09558E-07 8.7075E-08 2.23745E-05 9.88714E-07 3.89632E-06 6.49314E-06 -3.08311E-05 2.12261E-05 5.73595E-08 6.22294E-06 4.67499E-06 -9.85174E-07 6.4069E-08 7.62022E-08 9.51648E-07 7.98974E-08 -1.98956E-07 3.84096E-07 1.89607E-06 1.82483E-07 4.58531E-06 -9.63777E-07 -2.86784E-05 -3.76065E-05 3.74555E-07 3.73167E-07 -0.000124077 2.37484E-06 -1.00528E-05 -4.5109E-07 2.21639E-06 -6.54456E-07 5.20208E-06 -2.82693E-07 -9.60342E-06 2.76508E-07 -1.14616E-06 -8.98233E-06 -3.76733E-06 -3.59645E-08 3.27894E-06 1.23546E-06 -3.31644E-06 8.68531E-09 -3.37732E-06 2.285E-08 8.7016E-06 8.51966E-08 -6.98905E-07 3.57346E-07 1.01137E-06 -9.00689E-07 3.93214E-07 3.02043E-05

RI PT

ACCEPTED MANUSCRIPT 1.06216E-05

EP

5.69645E-06 1.19412E-05 1.19279E-05 6.34995E-08 7.01816E-05 1.14303E-07 2.80955E-08 0.000642268 9.96743E-09 1.17982E-07 4.8642E-07 6.18721E-06 3.25253E-06 1.68031E-06 1.67508E-06 3.5474E-06 3.43803E-06 0.000606782 1.15356E-06 4.71057E-06 1.18955E-05 0.000735715 4.67353E-05 3.51748E-06 1.13194E-05 1.21368E-05 2.52483E-06 3.51405E-08 6.87853E-08 1.20912E-06 6.62825E-08 1.15089E-06 2.78509E-07 6.1804E-06 1.33787E-07 0.000748367 2.37396E-06 0.000724689 0.000126352 2.98039E-06 2.9804E-06 0.001431759 1.14789E-07 2.00281E-05 5.04427E-07 2.49018E-06 3.4858E-06 8.69704E-06 7.15216E-07 2.43855E-05 2.83737E-06 1.58386E-05 9.71813E-06 1.7955E-05 3.15819E-06 1.53064E-05 1.17001E-06 4.25185E-06 5.70618E-09 2.28669E-05 3.70646E-08 1.29476E-05 3.4341E-08 9.70061E-07 4.19065E-06 3.08076E-06 2.05984E-06 3.71766E-06 2.02318E-05

AC C

K05979 K00333 K00332 K06953 K10819 K06955 K10815 K06959 K09129 K09127 K09126 K09124 K01233 K05819 K05818 K05812 K05811 K05810 K05817 K05816 K01894 K01892 K01234 K01146 K01141 K01414 K06350 K02668 K02665 K02664 K02667 K02666 K02660 K02663 K00809 K00806 K00801 K00800 K02400 K02403 K02402 K05366 K10210 K13049 K06122 K13735 K13734 K13041 K13040 K03204 K03207 K03200 K03201 K03203 K03208 K03758 K03759 K09469 K09461 K06204 K13950 K13953 K06324 K07128 K07121 K07120 K07123 K07122 K07127

0.118625789 0.920245786 0.920618357 0.209759144 0.471256862 0.293024369 0.575076939 0.89871753 0.527570497 0.978225001 0.541065367 0.185485972 0.480783353 0.978225001 0.978225001 0.978225001 0.978225001 0.488167989 0.89871753 0.666762729 0.306995257 0.203921069 0.39743252 0.978225001 0.517833294 0.717657063 0.511396292 0.183752602 0.214108619 0.745170755 0.184180429 0.933966255 0.47110154 0.219465401 0.242440264 0.220397466 0.978225001 0.234954085 0.116620889 0.978225001 0.978225001 0.056272232 0.163852005 0.227458423 0.592903426 0.876104541 0.886171297 0.688639752 0.978225001 0.661039656 0.978225001 0.978225001 0.532545607 0.89871753 0.985498413 0.978225001 0.822843365 0.613511875 0.714550834 0.928065674 0.529707347 0.270684584 0.16688471 0.788353519 0.978225001 0.815128945 0.854881274 0.978225001 0.189877656

TE D

7.18928E-07 -1.06254E-05 -5.16291E-06 1.68743E-06 -1.63946E-05 1.8755E-05 -4.8873E-10 3.3658E-08 5.23129E-10 7.52993E-09 8.19906E-07 1.07627E-06 6.41488E-06 1.0604E-06 1.15013E-05 4.0144E-08 -3.06274E-07 6.00245E-05 -1.53847E-06 9.04924E-07 4.95321E-06 3.52614E-06 4.4008E-06 -4.07797E-06 6.53597E-06 1.75692E-05 4.20768E-07 2.17561E-06 -4.99637E-05 3.23999E-06 -6.83678E-08 1.01644E-06 1.06026E-06 8.65459E-07 -1.58475E-05 -2.97538E-06 9.05248E-07 -3.46373E-08 4.04649E-09 6.24524E-06 -6.76845E-07 1.07238E-06 1.07318E-06 2.62612E-05 2.61968E-05 -4.83319E-08 -2.19266E-07 5.8578E-06 4.96501E-08 8.29616E-07 8.59693E-07 7.30892E-06 -1.12061E-08 -1.14169E-05 -1.83213E-06 1.31997E-09 -2.00265E-06 3.38123E-09 -3.73542E-07 3.69382E-07 -8.11191E-07 3.44721E-07 -3.73966E-07 8.45784E-07 -2.10357E-06 -6.71425E-06 3.00078E-07 1.10052E-05 6.30201E-06

SC

M AN U

-3.48092E-05 -5.12178E-06 -3.02337E-05 -8.28417E-07 -6.43748E-05 4.55382E-09 9.86503E-07 4.37785E-08 7.30567E-08 -2.18536E-08 3.91414E-07 3.2002E-07 3.42525E-07 6.63981E-06 8.60179E-08 9.68599E-08 4.41562E-05 2.36996E-05 2.18827E-07 5.55348E-06 -2.17581E-05 -7.96234E-06 1.53695E-05 4.48555E-07 -1.37815E-05 -6.22807E-07 3.73512E-05 1.93313E-05 5.51989E-05 -2.74447E-05 -9.60623E-07 3.34776E-07 4.338E-08 1.07252E-05 9.62965E-06 1.60905E-07 -2.8102E-08 6.65726E-08 1.43896E-06 -1.11215E-06 -9.07703E-07 -9.06462E-07 1.59156E-05 1.58838E-05 7.9571E-07 2.36135E-06 3.26593E-05 1.16646E-06 3.85023E-07 5.90027E-08 -1.06922E-05 2.444E-08 5.20491E-06 -8.11451E-06 5.77643E-09 -8.23301E-06 1.59137E-08 -2.54823E-07 -1.4357E-07 -1.73837E-06 -1.01835E-07 -2.52118E-07 6.24776E-07 9.91312E-06 5.17032E-07 1.88075E-07 6.252E-06 6.45388E-06

RI PT

ACCEPTED MANUSCRIPT -3.06679E-05

EP

0.000732961 0.000735022 0.000699629 0.000733465 0.000706503 0.000784931 5.89601E-09 1.15435E-06 3.75883E-08 3.49802E-08 3.44694E-06 3.71902E-06 4.30572E-06 3.67903E-06 1.19752E-05 7.57415E-08 2.66726E-06 0.000205143 1.26946E-05 3.50597E-06 8.91169E-06 0.000719792 1.81345E-05 0.000606549 5.17625E-06 0.000715696 4.68219E-06 3.2037E-05 0.000661189 0.000587642 0.000729104 2.24923E-06 3.6783E-06 3.60291E-06 0.00067054 7.69783E-06 3.59356E-06 3.49175E-08 3.45256E-08 2.5239E-06 4.96873E-06 2.07877E-06 2.07953E-06 5.62244E-05 5.63478E-05 1.02625E-06 1.36582E-07 8.86712E-05 1.16181E-06 2.83484E-06 3.51583E-06 0.000101216 2.97887E-08 1.1693E-05 8.33957E-06 2.0142E-09 8.30641E-06 2.78316E-09 6.85125E-07 8.37182E-07 4.15906E-06 4.84583E-07 6.85627E-07 2.43792E-06 1.20335E-05 1.405E-05 2.85181E-06 1.32209E-05 1.17337E-05

AC C

K01870 K01873 K01872 K01875 K01874 K01876 K00472 K00470 K00471 K00479 K04775 K04774 K04771 K04770 K04772 K09926 K01699 K01698 K01697 K01690 K07227 K03439 K03928 K03925 K03926 K03437 K03435 K02348 K02343 K02340 K02341 K02347 K02344 K02345 K03696 K03693 K03690 K13566 K07338 K07336 K07337 K09695 K09694 K09697 K09696 K09693 K09699 K07590 K07591 K07592 K05997 K05993 K05991 K00318 K00311 K00316 K00643 K00314 K02812 K06425 K06423 K06421 K02813 K03815 K03367 K03366 K03812 K03635 K03634

0.196770679 0.162678493 0.978225001 0.190551319 0.89340201 0.152709932 0.742935239 0.89871753 0.465821122 0.082300031 0.978225001 0.978225001 0.465294764 0.978225001 0.288136158 0.153486562 0.989746507 0.069765831 0.055749144 0.978225001 0.586815496 0.410988272 0.548757803 0.89870186 0.489602748 0.512198325 0.985246161 0.082300031 0.050920281 0.105513479 0.304050122 0.885911858 0.978225001 0.978225001 0.69556773 0.132055881 0.978225001 0.209759144 0.102862264 0.299762558 0.978225001 0.877739844 0.877739844 0.210030665 0.211816424 0.902532144 0.207432987 0.206968605 0.848912695 0.978225001 0.978225001 0.900316743 0.737490995 0.436482336 0.833048257 0.552820232 0.821693218 0.103883013 0.978225001 0.706463761 0.693804014 0.550266187 0.978225001 0.978225001 0.143334679 0.901870504 0.992818913 0.403799415 0.474465946

TE D

-3.23794E-05 1.06028E-06 1.06028E-06 9.51228E-05 -8.58083E-07 -6.49314E-06 3.98795E-05 -1.16716E-08 -9.8942E-08 -2.5205E-05 1.67949E-07 2.09441E-05 1.30687E-07 -6.13609E-05 -2.51645E-05 8.30243E-05 1.61452E-05 1.74357E-06 2.46264E-09 5.88063E-08 5.88063E-08 -2.50939E-06 -4.61576E-05 1.06947E-06 1.0622E-06 -3.06611E-06 5.99031E-06 9.69068E-06 7.69144E-06 -5.4739E-07 2.3978E-05 1.07881E-05 -5.76203E-06 4.15879E-06 8.79573E-07 8.21793E-07 9.05854E-06 -4.19771E-06 1.3281E-06 9.21614E-07 6.1808E-05 1.82145E-06 7.4649E-06 -2.9462E-09 -2.089E-06 7.98927E-07 1.06285E-06 1.03392E-06 1.05789E-06 1.05789E-06 3.41146E-05 8.59698E-08 6.58334E-06 -2.12922E-06 8.64256E-08 1.74174E-06 3.08244E-05 -2.87284E-06 3.26278E-10 2.69099E-05 1.53952E-05 1.51479E-05 -6.98548E-07 -4.22897E-09 -4.01896E-07 1.50255E-08 -3.53979E-08 5.88063E-08 -3.53979E-08

SC

M AN U

3.29828E-07 3.29828E-07 6.44219E-06 -0.000196182 8.16279E-06 1.65713E-05 2.37631E-08 -4.31629E-07 -1.57354E-05 1.24055E-05 2.32804E-05 -1.32741E-06 -4.55777E-06 -0.000112669 -3.22929E-05 1.72741E-06 5.70845E-06 -2.05067E-08 1.1135E-07 1.1135E-07 -3.02221E-05 1.01591E-05 4.02522E-07 3.44158E-07 -3.06579E-06 6.43742E-06 -2.29126E-05 -3.21458E-05 -1.43697E-06 3.97347E-06 -5.12289E-07 -3.59405E-06 -4.73446E-06 3.61462E-07 3.77096E-08 4.6779E-07 -4.84591E-06 -7.71228E-08 1.17444E-07 -1.25285E-06 1.45155E-05 5.45109E-06 3.46999E-08 -8.25219E-06 3.38209E-10 3.57973E-07 1.26272E-06 3.58085E-07 3.58085E-07 -1.82296E-07 -1.80574E-07 5.44251E-06 1.39424E-05 1.19041E-07 -4.84692E-05 4.16107E-05 -6.20581E-06 1.39082E-08 -5.20907E-06 1.31861E-05 1.21324E-05 -1.77952E-06 1.78553E-08 -8.55005E-08 3.6832E-08 -1.1282E-08 1.1135E-07 -1.1282E-08

RI PT

ACCEPTED MANUSCRIPT -1.63931E-05

EP

0.000717749 3.67841E-06 3.67841E-06 0.000613053 0.00278975 9.96454E-06 0.000682405 2.92467E-08 4.98342E-07 0.000513352 1.24553E-05 0.000428276 6.07455E-06 0.0001308 0.000231645 0.001124456 1.65709E-05 0.000679981 7.27283E-08 7.47491E-08 7.47491E-08 0.000731439 0.000683401 3.71819E-06 3.6774E-06 7.89141E-06 1.11852E-05 0.000718778 0.00079 1.68274E-06 6.36509E-05 5.02318E-05 2.18531E-05 1.03012E-05 2.96981E-06 3.48228E-06 1.86122E-05 1.3242E-05 3.72038E-06 3.55932E-06 0.000160384 1.01992E-05 8.17473E-06 4.33553E-08 8.31872E-06 3.37209E-06 3.60331E-06 3.53388E-06 3.6032E-06 3.6032E-06 9.84271E-05 7.36665E-07 9.39587E-06 1.68871E-05 1.50991E-07 0.000691511 0.000110992 1.05588E-05 3.66728E-09 0.00010982 5.93934E-05 6.19486E-05 2.39886E-06 1.91741E-08 7.7635E-07 4.12489E-08 3.23916E-08 7.47491E-08 3.23916E-08

AC C

K03631 K03633 K03632 K01999 K01990 K00869 K00868 K00861 K00862 K00865 K00867 K01191 K01194 K01195 K01198 K00656 K14591 K00651 K14596 K02641 K02640 K03595 K03596 K03597 K03591 K03598 K03599 K01736 K01733 K01731 K01739 K05343 K02427 K05346 K02425 K02424 K03772 K03774 K03776 K03777 K03779 K13979 K09992 K09990 K09991 K09996 K09997 K09994 K09998 K09999 K11712 K06857 K07102 K07101 K07100 K07456 K07458 K07109 K10191 K10192 K10193 K10194 K10195 K01851 K01857 K01856 K08478 K08479 K08476

0.365397995 0.978225001 0.978225001 0.27486941 0.068041662 0.168780103 0.208878483 0.728882448 0.823880733 0.73652069 0.274129235 0.923423127 0.978225001 0.118683087 0.096040145 0.13803801 0.265529927 0.978225001 0.978225001 0.560781892 0.560781892 0.263982692 0.12240934 0.978225001 0.978225001 0.908880987 0.485337124 0.243670754 0.243561059 0.89871753 0.461746458 0.978225001 0.933525284 0.168205019 0.978225001 0.978225001 0.589535667 0.911926243 0.978225001 0.978225001 0.077508226 0.548757803 0.112782461 0.567949137 0.816717446 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.352870379 0.978225001 0.489872043 0.345333582 0.654772306 0.070141477 0.125962411 0.457264181 0.085689113 0.43181012 0.614259296 0.635472226 0.883116695 0.860952258 0.978225001 0.537351255 1 0.560781892 1

TE D

-3.53979E-08 5.49711E-06 -6.34732E-09 4.46128E-09 4.73675E-09 7.73423E-07 -4.09983E-07 1.47518E-06 3.8245E-05 -1.65468E-06 -9.71738E-06 8.84953E-10 -5.72074E-05 8.06387E-07 3.10139E-07 5.20222E-09 -5.99997E-06 -4.12192E-06 9.25482E-07 8.87571E-07 1.15864E-06 7.96568E-07 7.32904E-07 8.16328E-07 1.65154E-06 6.23369E-08 1.0952E-07 2.4648E-05 -4.00978E-06 7.82313E-07 1.16374E-05 5.98759E-06 8.04436E-07 1.10264E-06 1.15888E-05 4.29608E-05 8.16029E-06 1.06849E-06 9.91657E-06 3.40032E-08 6.27725E-08 1.55107E-06 -2.84605E-06 -7.64419E-07 3.52875E-06 1.55249E-09 8.74264E-07 8.13043E-07 2.60519E-08 -6.02477E-05 7.43048E-06 1.77801E-07 6.81595E-06 8.02996E-07 -7.97016E-07 -1.30815E-05 4.34962E-09 -4.27211E-07 -1.57761E-09 -6.29317E-07 5.6604E-09 1.04119E-06 8.59244E-07 1.1724E-05 8.58989E-07 -8.32442E-06 -1.24529E-05 8.07989E-07 -2.34957E-05

SC

M AN U

1.62257E-06 5.79561E-08 3.53475E-09 4.42092E-08 -3.79178E-07 -2.83732E-07 1.03078E-05 2.44987E-05 1.51227E-06 2.3312E-07 2.95783E-10 7.53779E-05 8.34543E-08 -2.95414E-06 3.4424E-08 -3.52349E-06 -3.87765E-06 2.78602E-06 1.36782E-07 -8.93883E-07 1.74472E-08 6.697E-07 6.7491E-08 -2.29341E-07 1.35868E-07 2.15128E-07 1.34422E-05 8.53431E-06 -4.6498E-08 6.48432E-06 6.4356E-06 -1.89928E-08 3.69945E-07 6.43007E-06 3.3553E-05 2.36551E-06 -9.0482E-07 -2.1535E-05 6.71907E-08 1.47037E-07 3.80657E-06 6.7906E-05 -3.39989E-07 5.74343E-06 -1.75389E-08 1.64226E-07 1.90421E-08 6.14272E-08 -0.000130043 -2.39374E-06 3.8272E-07 -1.66609E-06 -2.1577E-08 -7.84431E-07 -5.07411E-07 1.13173E-07 -3.63485E-07 8.59408E-09 -1.35896E-06 6.21839E-08 -8.35401E-07 6.6185E-08 5.53897E-06 6.66957E-08 1.1397E-05 4.48796E-06 -2.02235E-08 -0.000147599

RI PT

ACCEPTED MANUSCRIPT -1.1282E-08

EP

3.23916E-08 9.64731E-06 5.29154E-08 2.85679E-09 4.30164E-08 3.36316E-06 8.83179E-07 1.18105E-05 7.95809E-05 3.59977E-06 1.25284E-05 4.03476E-09 0.001319069 3.56642E-06 8.80099E-06 2.79968E-08 2.13738E-05 2.23217E-05 3.73884E-06 3.53515E-06 2.06047E-06 3.37456E-06 6.20052E-06 3.39086E-06 6.82839E-06 1.50575E-07 1.56114E-07 0.000474095 8.41626E-06 3.52241E-06 1.23624E-05 1.11827E-05 3.44419E-06 3.71153E-06 1.23984E-05 0.000169708 2.10519E-05 2.10751E-06 0.000720411 4.82769E-08 8.15377E-08 1.32586E-06 4.49862E-05 7.86324E-07 7.71661E-06 7.44E-08 3.65313E-06 3.48048E-06 1.90837E-07 0.000954763 1.26712E-05 2.75383E-07 5.30411E-06 3.44391E-06 1.64378E-06 2.17298E-05 1.19434E-07 7.93703E-07 2.76284E-09 2.63085E-06 2.48201E-08 2.26769E-06 3.51706E-06 1.29399E-05 3.51734E-06 9.78098E-06 1.77302E-05 3.44535E-06 0.001194286

AC C

K08475 K00450 K00451 K00452 K00453 K00455 K00457 K00459 K00104 K00105 K00102 K00103 K00100 K00101 K04757 K01504 K04755 K04754 K04753 K04752 K01502 K02364 K12369 K02362 K02363 K12107 K08906 K06223 K06198 K06197 K06192 K06190 K11106 K11107 K11103 K07862 K00662 K00660 K06997 K06992 K06991 K06990 K06999 K05338 K06441 K06443 K06445 K06447 K02655 K00595 K00598 K02657 K07642 K07643 K07396 K07397 K07394 K07395 K04102 K04103 K07716 K07714 K07715 K07712 K07711 K00842 K00841 K00840 K00845

1 0.567789076 0.303711985 0.503793272 0.361519939 0.978225001 0.978225001 0.406565407 0.331051652 0.679680347 0.689750165 0.964696659 0.443187646 0.978225001 0.860952258 0.537095104 0.919259502 0.978225001 0.884473701 0.978225001 0.855441662 0.978225001 0.979384842 0.978225001 0.978225001 0.589587469 0.589400882 0.880631007 0.150079273 0.978225001 0.314728572 0.485337124 0.978225001 0.978225001 0.31575169 0.187157416 0.487021349 0.877991063 0.281965978 0.216555692 0.36140851 0.186019186 0.107130341 0.931862363 0.540767285 0.978225001 0.978225001 0.978225001 0.934365885 0.052809937 0.543060207 0.474643643 0.360826313 0.978225001 0.792884798 0.609086191 0.535611461 0.978225001 0.167944508 0.968395125 0.084901605 0.88894686 0.978225001 0.366943664 0.978225001 0.277206371 0.465397552 0.978225001 0.053292207

TE D

-2.07814E-05 1.14028E-05 -8.26819E-08 2.493E-09 6.3561E-09 5.69365E-09 5.94851E-09 6.26265E-09 5.69365E-09 -3.0838E-05 5.64253E-09 2.68744E-05 -1.14019E-05 7.96032E-07 3.95048E-06 5.12929E-06 6.72191E-06 1.97049E-06 -9.71346E-06 1.07901E-06 5.26723E-08 -1.15354E-06 5.57736E-06 -6.55624E-06 -4.0907E-06 1.3015E-05 -8.34585E-06 7.61782E-07 -6.25269E-06 -8.52133E-06 -3.07247E-06 3.17794E-05 6.47484E-06 -2.00072E-08 2.44654E-08 -1.09241E-05 -9.82449E-06 -2.0543E-07 -7.69492E-07 5.16112E-08 -1.64114E-06 8.64892E-07 7.93664E-07 4.62703E-09 9.46087E-07 8.08906E-07 5.16149E-08 8.05303E-07 5.8831E-08 5.96411E-07 2.05893E-06 1.27239E-05 4.55821E-06 2.30136E-05 1.04726E-06 4.96501E-08 7.9722E-07 -1.68588E-08 -6.70613E-05 -1.4503E-08 -6.38515E-07 -1.45364E-06 -1.99517E-06 7.46617E-05 -6.01483E-05 1.16958E-05 4.86632E-05 6.29241E-06 8.76659E-10

SC

M AN U

6.52967E-06 -8.71226E-08 4.85787E-08 5.59151E-08 4.96121E-08 4.99118E-08 5.02162E-08 4.96121E-08 8.78224E-06 4.98902E-08 5.30435E-05 4.16331E-05 -3.05473E-05 2.90772E-05 -4.7392E-07 6.01679E-07 -3.3022E-06 -7.03271E-06 4.30699E-07 2.51088E-09 3.95073E-06 7.87641E-06 -2.48102E-06 -2.17552E-06 7.43253E-06 -7.85412E-06 1.48421E-06 -2.11926E-06 -7.93202E-06 9.60775E-06 -1.53361E-05 4.74267E-07 -2.86126E-08 1.90948E-07 1.71551E-05 -3.10297E-05 -1.52586E-06 -1.65119E-06 1.25488E-06 -1.14684E-06 3.35483E-07 3.23764E-09 5.00753E-08 2.79174E-07 1.19145E-08 1.23234E-06 -2.22913E-08 1.14485E-07 -9.39437E-07 -3.7588E-06 1.42822E-05 5.25729E-06 1.87114E-06 1.65035E-07 1.16646E-06 4.01031E-09 -1.02301E-08 -1.64855E-05 -1.7129E-08 -8.80898E-07 -3.46753E-05 -8.18842E-06 2.43514E-05 2.97821E-05 8.53597E-06 3.66826E-06 7.24104E-06 6.94454E-08

RI PT

ACCEPTED MANUSCRIPT 6.78003E-05

EP

0.00039687 1.18935E-05 2.86447E-07 3.5934E-08 2.90303E-08 2.85234E-08 2.82603E-08 2.79196E-08 2.85234E-08 0.000683063 3.30735E-08 7.33865E-05 0.000642142 0.000732975 2.2995E-05 6.3074E-06 4.53076E-06 7.27601E-06 1.66813E-05 3.72348E-06 6.3824E-08 7.59072E-06 9.68379E-06 3.6717E-05 1.98943E-05 2.25102E-05 2.85774E-05 2.02299E-06 2.28276E-05 2.86468E-05 7.84608E-06 7.27809E-05 4.33728E-06 3.50842E-08 2.85211E-07 1.36849E-05 3.24381E-05 5.26076E-06 4.24911E-06 1.16881E-06 7.48996E-06 3.59412E-06 3.35141E-06 3.12358E-08 3.59941E-06 3.35998E-06 1.16881E-06 3.446E-06 7.47389E-08 2.27182E-06 4.96066E-06 1.47843E-05 1.25763E-05 0.000752118 3.66978E-06 1.16181E-06 3.36705E-06 2.33849E-08 0.000132012 1.85214E-08 4.93089E-06 5.19793E-05 8.31357E-06 0.000184671 0.000217551 1.21752E-05 0.000100571 1.46122E-05 4.00013E-08

AC C

K00848 K13771 K13770 K13775 K13774 K13777 K13776 K13779 K13778 K02992 K02623 K08281 K02996 K02994 K03578 K03579 K03576 K03577 K03573 K01716 K01718 K03081 K02199 K02198 K02193 K02192 K02197 K02196 K02195 K02194 K03713 K03716 K03717 K03715 K07129 K00045 K13990 K06296 K06297 K11739 K11738 K11733 K11732 K11731 K11737 K11736 K11735 K11734 K06873 K06876 K06877 K06878 K06879 K07478 K07479 K07471 K07470 K07476 K07474 K15039 K15034 K15036 K08738 K00128 K00432 K00433 K00123 K00124 K00126

0.084497594 0.299492862 0.859860221 0.326717245 0.187255133 0.266756068 0.256502843 0.252892403 0.266756068 0.361089909 0.233482753 0.238046809 0.246019566 0.197699759 0.06872378 0.674431789 0.43181012 0.550041659 0.415093984 0.978225001 0.718492884 0.761601442 0.280882142 0.943879206 0.978225001 0.136224307 0.636842811 0.848912695 0.877991063 0.624543332 0.131600088 0.148751421 0.464735798 0.55895016 0.978225001 0.076554948 0.307930005 0.847062542 0.727258534 0.815128945 0.978225001 0.978225001 0.978225001 0.282509439 0.978225001 0.978225001 0.823769934 0.978225001 0.553371553 0.978225001 0.116836268 0.06562615 0.662074072 0.333708829 0.978225001 0.848912695 0.978225001 0.481134896 0.052412614 0.323244639 0.978225001 0.070650904 0.823769934 0.060021059 0.466334677 0.406565407 0.365445208 0.453092422 0.091323687

TE D

7.88891E-06 -2.59999E-06 8.04077E-07 2.82043E-06 5.98984E-06 7.99168E-07 5.7242E-08 -5.99918E-07 9.25471E-07 5.02032E-05 1.3854E-06 -2.25411E-08 9.1802E-09 8.67775E-07 9.05584E-09 1.4572E-08 -9.99552E-09 3.77893E-05 1.10813E-05 1.08165E-07 -4.77936E-07 -4.89162E-07 -1.29983E-08 -1.3348E-07 -3.48434E-08 -2.04366E-08 2.96322E-06 3.72122E-06 1.03519E-05 -1.19696E-06 -3.90682E-07 8.94063E-06 9.5261E-08 4.59541E-06 5.09069E-08 6.23769E-09 -1.33934E-08 5.73705E-07 -2.17855E-05 1.12273E-05 5.31662E-07 -0.000116632 -9.5796E-07 4.05028E-05 1.06915E-06 1.33622E-06 -1.29983E-08 1.02624E-06 6.53107E-07 2.70661E-09 -3.39817E-07 1.54505E-08 -5.14847E-06 -7.39954E-06 1.28843E-08 -1.55058E-08 -4.70246E-06 7.79524E-07 -1.20887E-05 1.10949E-06 -6.438E-06 1.10964E-06 3.00448E-05 -2.50588E-05 -1.40329E-05 2.55021E-06 -1.0306E-07 4.09873E-09 1.08371E-06

SC

M AN U

-8.23558E-06 -1.41644E-08 3.39821E-05 6.44147E-06 -2.66254E-08 1.13198E-07 -1.5069E-05 5.2511E-07 -1.55834E-05 1.58793E-06 3.85104E-06 9.63973E-09 -9.89927E-07 1.91656E-08 4.82525E-08 -7.24909E-09 9.09953E-06 -2.045E-05 2.12847E-07 -1.15683E-06 6.53021E-07 -8.74447E-09 4.73224E-07 9.62219E-08 2.3659E-08 -1.40825E-06 1.9785E-06 -2.99148E-05 -2.23121E-06 -4.34895E-07 8.7169E-06 1.30362E-06 1.66186E-06 1.20437E-06 5.31029E-08 -8.91408E-09 9.29632E-07 -4.05374E-05 1.36102E-05 -3.60279E-05 -2.03803E-05 1.09775E-05 6.24077E-05 3.41061E-07 1.00027E-06 -8.74447E-09 2.18674E-07 -9.14829E-07 3.18912E-08 -6.87769E-07 3.97902E-08 -2.95309E-05 -2.46546E-05 2.93652E-07 4.909E-08 -4.18373E-06 -3.63406E-07 3.62532E-06 6.17287E-07 -1.27115E-05 4.40559E-07 6.09203E-05 -9.21301E-07 4.56151E-06 1.79286E-06 1.59356E-06 1.74775E-07 3.90119E-07

RI PT

ACCEPTED MANUSCRIPT 1.36899E-05

EP

2.28329E-05 8.68746E-06 3.44067E-06 2.10341E-05 1.11857E-05 3.45033E-06 7.632E-08 2.76691E-05 3.19692E-06 9.44501E-05 4.74822E-06 1.30347E-06 5.74166E-09 2.26721E-06 9.24202E-09 4.60095E-08 1.70136E-08 9.04468E-05 5.7607E-05 1.56061E-07 5.41519E-06 1.95117E-06 2.07861E-08 2.10863E-07 8.66072E-08 3.51433E-08 2.00015E-05 9.66552E-06 4.60012E-05 3.21493E-06 6.78453E-07 1.13592E-05 1.29406E-06 3.65421E-06 1.19649E-06 3.12404E-08 2.19069E-08 1.71452E-06 0.000715066 2.04299E-05 0.000737539 0.000467841 1.14175E-05 6.96251E-05 3.67753E-06 3.10084E-06 2.07861E-08 2.99886E-06 2.41984E-06 3.0053E-08 9.76927E-07 9.06056E-08 0.00072601 0.000741798 3.96792E-06 7.42733E-08 6.07088E-06 3.38265E-06 0.000695015 3.75589E-06 0.000671034 3.75597E-06 0.000731001 2.57918E-05 0.000676123 1.75391E-05 1.74824E-06 1.19693E-08 3.71764E-06

AC C

K00127 K08973 K14348 K08972 K01525 K01521 K08977 K03969 K02386 K02385 K02380 K02381 K13522 K13529 K03384 K03381 K03380 K03382 K03388 K05356 K02430 K05351 K11695 K11693 K03433 K03432 K06606 K06605 K06603 K05358 K06609 K03923 K11472 K11473 K11474 K11475 K11476 K11477 K00600 K03746 K00604 K03741 K03740 K03743 K03214 K07803 K07800 K07806 K10255 K10253 K10918 K01959 K01956 K01952 K07733 K07734 K07739 K02609 K03551 K03554 K03555 K03557 K01778 K01771 K01776 K08159 K08152 K12809 K03732

0.485600936 0.79064856 0.978225001 0.059184218 0.485337124 0.978225001 0.560781892 0.239611593 0.978225001 0.100709591 0.974355418 0.307930005 0.472899891 0.920245786 0.365399464 0.344968018 0.603986222 0.171047529 0.225640681 0.593994105 0.982266627 0.915918765 0.487021349 0.125743815 0.241408608 0.487255115 0.978225001 0.833048257 0.086198367 0.89871753 0.973966439 0.326600163 0.813345243 0.680110934 0.839747643 0.184779904 0.466458354 0.973307853 0.308518085 0.421724389 0.140197176 0.052831301 0.099956793 0.07830612 0.978225001 0.892925185 0.487021349 0.978225001 0.992818913 0.576382408 0.801994404 0.905245942 0.215241504 0.485337124 0.997085995 0.483857176 0.712258046 0.978225001 0.945877497 0.978225001 0.964172849 0.978225001 0.099534691 0.066547121 0.895770914 0.978225001 0.89871753 0.150079273 0.978225001

TE D

3.34689E-06 -7.77468E-07 -8.65935E-07 5.64184E-07 -9.00816E-08 8.27191E-08 1.27532E-09 4.45922E-09 -1.26463E-07 7.84429E-07 -2.06562E-06 -1.97954E-06 3.84683E-09 2.21237E-06 6.19587E-06 1.12583E-07 -8.43389E-09 2.91706E-08 -1.26769E-05 1.46243E-05 3.08898E-09 -7.27672E-08 -1.37704E-07 8.02786E-07 2.2672E-06 -5.55324E-05 4.96501E-08 3.11831E-05 5.49157E-07 8.47304E-08 -1.74444E-09 8.02381E-07 1.62062E-06 1.07042E-06 8.10361E-05 2.48859E-08 1.23402E-06 1.46886E-05 4.59979E-09 5.88063E-08 -1.05769E-05 1.00794E-06 -3.19619E-08 -3.26717E-08 -3.20746E-08 5.87554E-06 3.54262E-06 1.06028E-06 7.07843E-10 -3.91032E-06 -2.39593E-05 -1.51992E-06 -2.17507E-06 -5.0891E-06 4.40221E-07 5.98279E-06 -3.06835E-05 1.0834E-06 4.43853E-06 4.54805E-07 1.0599E-06 1.2012E-05 2.12381E-05 1.6176E-05 4.76015E-06 1.18936E-05 -2.04479E-06 9.83357E-07 7.80014E-07

SC

M AN U

1.16602E-05 1.20338E-06 9.5872E-07 -6.28402E-07 1.12443E-07 1.88008E-08 3.24579E-08 -2.75123E-07 -3.84473E-07 -8.16429E-06 -8.14924E-06 6.48131E-08 -3.38014E-06 -7.71013E-06 1.29038E-06 1.84649E-07 7.70282E-08 0.000115673 1.78966E-05 -2.21764E-09 -1.34991E-06 -4.12506E-07 1.46141E-07 -4.26335E-05 -2.41487E-05 1.16646E-06 -8.11474E-06 7.18368E-07 5.27226E-08 5.15109E-08 -2.39871E-08 1.52304E-06 3.74228E-07 6.71963E-05 7.92654E-08 1.91468E-07 -3.57412E-05 3.64024E-08 1.1135E-07 4.43744E-05 -3.46485E-07 -2.19494E-08 -1.76221E-08 -2.30633E-08 1.51269E-06 -4.68053E-06 3.29828E-07 3.78652E-09 -1.43014E-06 2.99966E-05 -2.42865E-06 -4.70769E-06 8.56923E-06 5.55709E-06 -2.65591E-05 -1.49621E-05 -8.64598E-07 -2.42634E-05 1.51091E-06 4.37457E-07 9.31903E-06 3.21093E-05 1.24864E-05 -8.42717E-06 1.23552E-05 6.63689E-06 8.11317E-08 8.86692E-08

RI PT

ACCEPTED MANUSCRIPT 5.98058E-06

EP

1.09841E-05 1.18627E-05 2.21582E-06 1.68598E-06 1.19305E-06 7.67492E-08 3.83141E-09 2.83773E-08 8.39153E-07 3.39439E-06 8.47618E-06 8.46012E-06 3.27973E-08 4.18895E-06 1.61409E-05 1.2613E-06 5.06805E-08 3.9087E-08 0.001617363 1.52688E-05 2.9635E-09 1.76502E-06 1.22559E-06 3.43435E-06 8.70259E-05 0.000648834 1.16181E-06 0.000102601 1.67572E-06 4.25866E-08 3.26215E-08 3.45101E-06 4.81959E-06 3.77585E-06 0.000260148 1.12393E-07 4.04477E-06 0.000149888 2.90251E-08 7.47491E-08 0.000744791 1.42976E-05 2.42877E-07 2.48467E-07 2.42783E-07 1.83848E-06 1.68734E-05 3.67841E-06 1.5058E-09 1.19797E-05 3.27306E-05 5.65498E-06 7.57355E-06 9.8075E-06 0.000704187 0.000727051 0.00071539 2.09729E-06 0.000723955 2.37676E-06 3.61362E-06 9.52158E-06 2.92504E-05 0.000687166 0.000740167 2.39619E-05 4.92307E-06 3.94179E-06 3.39496E-06

AC C

K03738 K03739 K06994 K12660 K12661 K08715 K08714 K11311 K11312 K00146 K00411 K00412 K00148 K14091 K14090 K02848 K01545 K04719 K02015 K01608 K13815 K13816 K13819 K06222 K00627 K00625 K02550 K02556 K02554 K07280 K07281 K07283 K07285 K07286 K08217 K07288 K07289 K07533 K07823 K08699 K00088 K00082 K10233 K10232 K10234 K01974 K01975 K07751 K13786 K08352 K07115 K07445 K00641 K01281 K02954 K02952 K02950 K00155 K02959 K00885 K00884 K00883 K00881 K00053 K01756 K01750 K01758 K08173 K08172

0.580832452 0.073780155 0.860952258 0.96401381 0.952479647 0.513334155 0.401765519 0.570717249 0.920245786 0.978225001 0.822297292 0.825464275 0.104058062 0.135413333 0.126727491 0.816532142 0.206173574 0.102862264 0.052977135 0.060734414 0.411858662 0.830662712 0.978225001 0.978378683 0.084255821 0.083875848 0.848912695 0.173784946 0.978225001 0.214073105 0.808819541 0.978225001 0.978225001 0.978225001 0.064695495 0.630183515 0.978225001 0.360953158 0.488391228 0.560781892 0.153254567 0.985498413 0.978225001 0.978225001 0.978225001 0.307930005 0.530458705 0.978225001 0.303066475 0.965767778 0.051845285 0.613567443 0.379839449 0.211989019 0.978225001 0.318885302 0.44520479 0.877739844 0.448143477 0.87307182 0.978225001 0.079517878 0.133980042 0.877739844 0.908243925 0.442039389 0.059348724 0.978225001 0.978897042

TE D

4.94136E-05 1.18107E-06 1.07896E-09 -3.07793E-06 6.90542E-08 -4.4105E-09 4.91538E-08 -1.56542E-07 -2.38267E-05 -4.21685E-06 9.96485E-08 -2.47461E-06 2.90426E-08 -8.23531E-05 -2.41504E-05 -3.81676E-06 2.85781E-08 2.63241E-08 1.77492E-05 -6.98668E-07 1.4117E-05 -1.30334E-07 4.09873E-09 -7.82015E-05 4.09873E-09 1.10848E-08 4.96501E-08 1.10978E-07 7.39157E-06 1.114E-08 -3.96755E-07 -3.96755E-07 -3.95938E-07 -3.96755E-07 1.1261E-06 -1.69443E-08 9.23036E-07 -2.20935E-07 4.96501E-08 5.88063E-08 -5.81084E-06 -2.18932E-07 -2.18932E-07 5.98985E-07 -1.30651E-06 1.09888E-06 8.73397E-07 5.95704E-06 7.82251E-07 8.95088E-07 3.84221E-05 7.21276E-06 1.32657E-06 3.84047E-05 6.5848E-08 2.54157E-08 -2.92778E-06 1.0727E-06 1.89295E-08 8.15879E-07 9.00896E-07 8.13121E-07 1.81487E-07 5.24384E-09 -0.000133522 7.46956E-05 -1.27523E-05 1.06538E-05 -3.12537E-05

SC

M AN U

-8.40446E-07 6.6931E-10 -8.49954E-06 6.15447E-08 -4.69844E-09 1.12912E-06 5.11586E-06 2.16534E-05 -3.56758E-05 1.57524E-07 -2.24101E-06 7.19495E-08 -6.14236E-06 -6.80145E-05 3.43028E-05 7.16597E-08 8.21301E-08 -1.06919E-05 -1.78593E-06 -1.49499E-05 -6.38334E-08 1.74775E-07 -3.79453E-05 1.74775E-07 2.76317E-08 1.16646E-06 1.53996E-06 1.1879E-05 1.46542E-07 -3.67551E-07 -3.67551E-07 -3.66634E-07 -3.67551E-07 -8.50354E-07 -1.01496E-08 1.63794E-07 8.88352E-06 1.16646E-06 1.1135E-07 -9.80874E-06 2.36354E-06 2.36492E-06 -3.74634E-05 -4.11033E-05 7.60084E-07 -4.44157E-07 6.45933E-06 -9.1695E-09 1.54485E-07 1.85834E-05 1.20956E-05 3.69142E-07 1.85609E-05 1.1959E-07 4.80339E-08 1.69892E-05 -9.19226E-07 2.28524E-08 -1.70475E-07 6.98955E-08 2.98842E-07 2.15877E-09 4.76412E-08 -5.03405E-05 7.629E-06 -1.09385E-05 -2.55199E-05 -1.08712E-05

RI PT

ACCEPTED MANUSCRIPT 1.64276E-05

EP

0.000113813 2.17274E-06 1.77903E-09 8.87956E-06 8.17053E-08 8.60417E-09 1.31087E-06 5.22314E-06 0.000656111 0.000724214 5.9554E-07 1.41166E-05 3.40004E-08 0.001074271 0.000598198 4.50077E-05 3.49195E-08 6.08311E-08 4.69356E-05 2.39503E-06 1.95277E-05 1.25783E-06 1.19693E-08 0.000595787 1.19693E-08 3.86158E-08 1.16181E-06 1.21422E-06 1.57234E-05 1.90862E-08 6.85265E-07 6.85265E-07 6.84348E-07 6.85265E-07 2.13031E-06 2.36535E-08 3.61693E-06 4.88925E-06 1.16181E-06 7.47491E-08 1.61028E-05 1.35764E-07 1.35764E-07 8.84199E-05 8.76111E-05 3.8923E-06 4.52102E-06 1.11197E-05 3.36436E-06 3.55801E-06 8.93166E-05 1.14226E-05 4.26866E-06 8.92891E-05 7.88741E-08 2.66081E-08 1.77654E-05 2.07501E-06 8.74561E-08 2.7607E-06 2.02814E-06 2.81279E-06 4.88873E-07 3.20564E-08 0.000898171 0.000629814 3.27786E-05 0.000735118 0.000720626

AC C

K02483 K02482 K02486 K02488 K08178 K14136 K03532 K03533 K03531 K03536 K03537 K03535 K02225 K02224 K02227 K02221 K02229 K02228 K00441 K03288 K03289 K03285 K03280 K03282 K12790 K12686 K12687 K12684 K12685 K12680 K11084 K11081 K11083 K11082 K11089 K06347 K09823 K09820 K10939 K11332 K00164 K00166 K00167 K00161 K00162 K00163 K10680 K04082 K04081 K04080 K04087 K04085 K04084 K04088 K01563 K01561 K01567 K01565 K01564 K13654 K13655 K13650 K13651 K05550 K12308 K03073 K03071 K03070 K03076

0.256132984 0.858823208 0.978225001 0.744642655 0.686377148 0.641382498 0.864937093 0.266403173 0.544710239 0.142822047 0.978225001 0.978225001 0.107340461 0.415682499 0.068385698 0.140197176 0.10116362 0.306109784 0.290098702 0.881923217 0.46347057 0.989921929 0.150079273 0.058981522 0.150079273 0.772970086 0.848912695 0.683582901 0.507694988 0.220397466 0.978225001 0.978225001 0.978225001 0.978225001 0.869269461 0.474123295 0.978225001 0.305049708 0.848912695 0.560781892 0.746583056 0.206968605 0.206692563 0.148923152 0.092430613 0.978225001 0.978225001 0.485337124 0.978225001 0.978225001 0.236550852 0.099221754 0.978225001 0.236655381 0.516730139 0.283313701 0.58151885 0.877739844 0.978225001 0.978225001 0.829869711 0.978225001 0.978225001 0.274129235 0.099129702 0.074286002 0.621560686 0.220167944 0.474421748

TE D

1.99938E-05 -1.32735E-06 -3.89389E-07 -3.04335E-07 -6.03832E-10 -2.1061E-06 2.95943E-06 -3.14463E-07 8.01654E-07 -1.02805E-06 7.03302E-08 -2.51424E-05 4.33428E-08 1.0727E-06 6.12019E-08 1.10327E-05 3.18721E-07 8.6023E-07 -1.35933E-08 1.77713E-05 -2.04628E-05 -6.80504E-07 -4.40367E-07 8.55578E-07 3.69478E-08 1.06028E-06 4.83743E-06 7.18344E-09 4.09873E-09 1.07749E-06 -2.03875E-05 3.73153E-06 7.79798E-07 7.81901E-07 -2.33038E-09 -9.68493E-10 -1.18373E-09 -9.68493E-10 2.73149E-06 -2.44269E-08 -4.07818E-07 1.397E-06 -1.67272E-06 8.79902E-07 1.35796E-08 8.23588E-07 -5.17152E-05 -1.01863E-09 -1.33187E-06 2.51832E-06 -2.45785E-08 -1.44942E-07 -1.44942E-07 -1.44942E-07 5.27127E-08 2.71131E-06 1.06122E-06 5.24967E-05 1.0636E-06 5.97789E-06 -1.85682E-06 -2.62438E-06 2.35831E-08 -8.39447E-07 7.1961E-06 3.1724E-06 -5.62717E-09 5.81419E-08 5.88063E-08

SC

M AN U

-2.86257E-06 -4.33453E-07 -6.34314E-07 3.23595E-08 -8.21666E-06 -7.73803E-07 -6.45389E-07 -4.29503E-08 -3.12774E-05 1.83823E-07 -7.43145E-06 7.99197E-08 -9.19226E-07 2.05693E-07 -2.51973E-06 3.00558E-06 6.07879E-08 1.13201E-09 1.92998E-05 3.4479E-05 -1.2754E-06 2.48948E-05 6.38244E-08 9.89784E-07 3.29828E-07 1.23552E-05 1.5381E-08 1.74775E-07 3.72133E-07 3.76272E-05 -2.7689E-05 -3.14771E-05 -3.05623E-05 2.60211E-08 3.6533E-09 5.79106E-09 3.6533E-09 -3.66833E-05 3.12078E-07 -3.18199E-07 -2.59691E-06 -2.2799E-06 3.53984E-06 1.56803E-09 2.71033E-07 -3.79533E-05 1.93854E-08 1.11488E-06 9.52287E-06 -1.89113E-08 1.3236E-07 1.3236E-07 1.3236E-07 1.91625E-07 8.68696E-07 3.30998E-07 -2.48573E-05 3.73565E-07 6.41898E-06 -1.31898E-05 -2.46573E-05 1.33117E-08 -9.83508E-07 -1.8341E-07 1.26964E-06 1.35111E-07 1.11373E-07 1.1135E-07

RI PT

ACCEPTED MANUSCRIPT 4.69012E-05

EP

9.9824E-05 5.13552E-06 6.77011E-07 1.00465E-06 2.19666E-08 8.36856E-06 2.45656E-06 1.01963E-06 3.47177E-06 0.000732123 9.34876E-08 0.000708343 6.644E-08 2.07501E-06 1.3995E-07 1.48262E-05 1.22099E-06 3.51579E-06 1.50113E-08 2.87378E-05 4.70607E-05 2.59559E-06 1.37487E-05 3.51188E-06 1.15523E-06 3.67841E-06 1.2185E-05 9.3144E-09 1.19693E-08 3.71497E-06 0.000649175 0.000730101 0.000732481 0.000732972 2.05778E-08 2.48599E-09 2.73067E-09 2.48599E-09 0.000742874 1.11925E-07 4.04218E-07 4.81812E-06 3.99532E-06 4.75161E-06 4.68567E-09 2.90912E-06 0.000521785 2.03154E-08 1.61008E-06 3.4878E-05 4.2085E-08 1.38834E-07 1.38834E-07 1.38834E-07 1.27466E-07 1.0908E-05 3.67703E-06 0.000266454 3.67966E-06 1.11732E-05 1.73894E-05 3.30157E-05 4.98E-08 1.51073E-06 1.1981E-05 8.36466E-06 2.40645E-08 7.47168E-08 7.47491E-08

AC C

K03074 K08967 K13874 K06139 K06135 K06134 K06137 K06136 K06132 K02600 K07389 K01516 K09977 K07512 K07516 K10212 K10218 K10748 K01913 K01910 K01919 K07774 K07776 K07771 K07772 K07773 K07778 K04340 K12986 K04691 K02931 K02933 K02935 K02939 K00207 K00201 K00200 K00202 K01000 K01004 K14446 K14445 K08195 K08194 K08196 K03516 K03517 K02205 K02204 K02200 K13714 K12518 K12519 K12517 K07182 K07180 K07186 K07185 K07184 K09801 K09802 K09803 K09804 K09805 K09806 K09809 K10917 K11355 K11356

0.363458144 0.950898268 0.973984306 0.850884438 0.588398481 0.817880434 0.74355144 0.848452218 0.978225001 0.197636978 0.224607885 0.560781892 0.167944508 0.877739844 0.141902835 0.181328903 0.144593116 0.978225001 0.568316498 0.068089323 0.071829703 0.978225001 0.053010668 0.978225001 0.89871753 0.978225001 0.159407252 0.560781892 0.150079273 0.978225001 0.210540144 0.243908367 0.180905231 0.197699759 0.651258368 0.455177981 0.258007799 0.455177981 0.092189509 0.150079273 0.330631221 0.940464916 0.950355991 0.89174869 0.133817998 0.978225001 0.13559511 0.853344199 0.87307182 0.978225001 0.668863573 0.135968794 0.135968794 0.135968794 0.208141726 0.949761932 0.978225001 0.246387569 0.978225001 0.486378906 0.803473015 0.11049471 0.994851461 0.645711071 0.641983604 0.891139221 0.147641456 0.560781892 0.560781892

TE D

9.78839E-07 8.13224E-07 1.06155E-06 -1.98371E-05 6.76649E-06 -1.71395E-07 -5.7156E-06 -5.71628E-06 5.76467E-06 -5.71628E-06 5.76467E-06 5.99826E-06 1.05789E-06 5.98007E-06 4.90848E-06 7.4273E-07 8.62387E-07 4.8658E-06 -3.2374E-08 3.29853E-08 5.6711E-09 8.14424E-08 2.85055E-08 9.38019E-09 7.92178E-07 7.92178E-07 -1.75412E-07 7.92187E-07 -1.40557E-08 -1.40557E-08 8.59584E-07 8.85163E-07 -1.12076E-08 -8.35642E-09 2.45574E-05 -1.50907E-09 3.94838E-10 3.44543E-08 -3.9944E-07 -4.44586E-09 -8.24516E-06 -7.43378E-07 -4.03991E-06 -3.57081E-07 -3.86437E-06 -6.18646E-05 5.57394E-08 -1.27432E-08 -1.27432E-08 1.7075E-07 1.29397E-07 8.65849E-06 -2.25846E-06 -2.29026E-08 2.37889E-07 2.11867E-07 6.60289E-06 7.38617E-08 5.99339E-06 -3.50315E-07 3.65162E-06 -7.32199E-07 -3.5697E-07 -8.88694E-06 5.28557E-06 -9.21564E-06 6.59208E-06 6.12214E-07 4.96501E-08

SC

M AN U

1.16805E-08 3.44697E-07 -4.80806E-06 1.28538E-06 -6.54775E-07 2.07088E-05 2.07105E-05 6.10713E-06 2.07105E-05 6.10713E-06 6.54552E-06 3.58085E-07 6.63178E-06 2.68207E-05 8.61699E-09 9.04444E-08 3.98115E-06 1.19238E-08 3.24331E-08 4.76751E-08 9.43006E-08 2.68707E-08 7.00194E-08 2.28897E-08 2.28897E-08 -1.11138E-06 4.30445E-08 2.27695E-08 2.27695E-08 -1.56012E-07 3.77393E-07 2.32127E-08 3.20407E-08 -3.92048E-05 1.92902E-07 1.1092E-08 9.84543E-07 -1.15185E-06 2.01386E-08 2.35915E-05 -1.682E-06 9.16298E-06 7.33941E-09 -5.57494E-06 4.67389E-05 1.11654E-07 -9.6035E-09 -9.6035E-09 -7.28165E-07 1.91458E-06 1.30196E-05 -2.22361E-06 1.10247E-07 -4.0454E-09 -1.29203E-08 7.90142E-07 1.15027E-07 6.4393E-06 -6.43779E-07 -2.06695E-06 -3.179E-05 1.82105E-09 1.9226E-05 -3.80733E-06 2.61645E-05 5.45392E-07 1.79559E-07 1.16646E-06

RI PT

ACCEPTED MANUSCRIPT 8.23847E-08

EP

3.61101E-06 3.45903E-06 3.70199E-06 0.00069847 5.03249E-06 2.86974E-06 1.62111E-05 1.62114E-05 1.09888E-05 1.62114E-05 1.09888E-05 1.04785E-05 3.6032E-06 1.05803E-05 2.47197E-05 3.59286E-06 3.43466E-06 2.26649E-06 5.67038E-08 5.34027E-09 2.81387E-08 7.55106E-08 5.38126E-09 3.45884E-08 2.87658E-06 2.87658E-06 4.0138E-06 2.87658E-06 4.45774E-08 4.45774E-08 2.84086E-06 2.9804E-06 2.97937E-08 2.42301E-08 0.000125336 2.4893E-08 3.38226E-09 1.15356E-06 2.68268E-06 1.86677E-08 2.54523E-05 4.16939E-06 8.5891E-06 5.35156E-07 1.09153E-05 0.000347256 7.76292E-08 2.31064E-08 2.31064E-08 1.06219E-06 6.15175E-07 1.63619E-05 0.00015635 6.48263E-08 5.10755E-07 5.6923E-07 4.46804E-06 8.07395E-08 1.11833E-05 1.05552E-06 0.000709737 0.000732818 5.348E-07 1.08265E-05 0.000698226 3.18852E-05 4.37027E-06 3.06267E-06 1.16181E-06

AC C

K04065 K04064 K04067 K04066 K04063 K04062 K10006 K10007 K10004 K10005 K10002 K10003 K10000 K10001 K10008 K10009 K14588 K13678 K13671 K13583 K13580 K13581 K13584 K05559 K03895 K03894 K03897 K03896 K03891 K03890 K03893 K02423 K05342 K12988 K02420 K12981 K12980 K12985 K12984 K12987 K03098 K13853 K03095 K05344 K03090 K03092 K06118 K11632 K11630 K11631 K11635 K07570 K07571 K07577 K11180 K11181 K11183 K10764 K10763 K10762 K01938 K01937 K01930 K01932 K01933 K07798 K07799 K07796 K07797

0.978225001 0.978225001 0.978225001 0.613511875 0.480277552 0.978225001 0.093699136 0.093692556 0.525480448 0.093692556 0.525480448 0.453256862 0.978225001 0.451066651 0.121240529 0.979384842 0.978225001 0.100467892 0.633497896 0.072377711 0.27649832 0.483857176 0.104557866 0.097301853 0.978225001 0.978225001 0.978225001 0.978225001 0.815516307 0.815516307 0.978225001 0.978225001 0.758407547 0.555431017 0.107184914 0.115765171 0.073266362 0.89871753 0.978225001 0.809316248 0.325323904 0.721971596 0.137044452 0.599046135 0.613948067 0.051800002 0.565562269 0.49333943 0.49333943 0.594809368 0.477420097 0.096040145 0.993256855 0.112161054 0.945877497 0.977908719 0.451607596 0.050031316 0.485337124 0.84495968 0.978225001 0.175297334 0.600584421 0.092136987 0.978225001 0.175939383 0.457312728 0.979384842 0.848912695

TE D

3.5713E-06 9.10072E-05 7.56006E-09 -2.47134E-05 -5.24496E-09 -1.29983E-08 -1.29983E-08 -4.49284E-05 1.75136E-05 -9.40416E-06 3.50687E-06 1.13374E-05 5.95116E-07 -1.22887E-06 1.25212E-05 1.67575E-05 7.18344E-09 3.00753E-09 1.66777E-06 -3.85756E-07 -1.66525E-06 6.01366E-07 -3.18986E-11 -1.10815E-08 -5.35061E-08 -5.35061E-08 -1.96523E-09 1.3781E-09 6.29834E-06 9.69071E-07 1.14693E-06 2.62638E-07 3.30016E-08 4.36637E-06 -1.4428E-07 4.1134E-08 4.96501E-08 -4.32154E-09 4.9139E-08 1.48641E-09 6.00868E-06 -1.30861E-08 -3.79376E-05 1.11369E-08 -7.2096E-08 8.90296E-07 1.79492E-05 5.95772E-06 5.9822E-08 5.88063E-08 5.88063E-08 5.88063E-08 1.09582E-07 7.46505E-09 5.69564E-09 5.47411E-09 4.96855E-09 4.96855E-09 4.96517E-09 -1.15774E-06 9.91582E-06 2.54585E-06 8.61633E-07 6.29481E-07 3.17233E-07 5.53934E-07 5.26508E-07 -2.21862E-07 1.14796E-08

SC

M AN U

4.30684E-05 -2.40134E-08 1.20376E-05 -4.19958E-09 -8.74447E-09 -8.74447E-09 -4.94842E-05 -4.84765E-05 -1.01135E-05 5.72859E-06 1.48794E-05 -1.74457E-05 6.24036E-07 2.05382E-06 -5.37495E-06 1.5381E-08 6.62983E-09 -3.79079E-05 -1.54107E-07 -3.41517E-06 -9.38496E-07 3.31365E-08 8.85403E-08 8.23501E-08 8.23501E-08 2.6708E-08 2.78436E-08 6.53632E-06 -8.53224E-07 1.36603E-06 1.08042E-07 1.49689E-07 1.36967E-06 1.5718E-06 1.46552E-06 1.16646E-06 -2.58066E-07 1.17017E-06 -1.23563E-09 6.46756E-06 -2.4792E-09 5.48944E-05 8.22129E-08 -8.28806E-09 1.7795E-07 -2.14117E-06 6.45932E-06 1.17774E-07 1.1135E-07 1.1135E-07 1.1135E-07 2.13551E-07 8.03811E-08 7.03595E-08 1.14217E-07 6.46994E-08 6.46994E-08 6.3872E-08 -1.13057E-06 1.51357E-05 1.71791E-06 6.31564E-08 -2.31407E-06 -2.58473E-06 -1.02147E-06 -2.97897E-07 1.67376E-06 3.18895E-08

RI PT

ACCEPTED MANUSCRIPT 4.76767E-07

EP

1.55311E-05 0.000244308 7.61289E-08 2.94668E-05 5.28477E-09 2.07861E-08 2.07861E-08 0.000693586 0.000686787 1.43527E-05 7.78781E-06 1.53373E-05 0.000147861 1.66649E-06 7.12994E-06 1.13917E-05 9.3144E-09 3.05228E-09 9.54642E-05 9.46424E-07 5.01668E-06 2.27268E-06 4.9806E-08 1.13218E-07 6.52196E-08 6.52196E-08 5.06358E-08 4.72253E-08 1.16956E-05 2.23769E-06 2.51726E-06 5.58684E-07 1.64034E-07 9.92506E-06 1.7645E-06 1.21139E-06 1.16181E-06 5.79677E-07 1.16232E-06 2.78364E-09 1.11854E-05 4.79911E-08 0.000573919 3.72869E-08 1.52837E-07 3.48084E-06 5.2167E-05 1.11197E-05 7.52839E-08 7.47491E-08 7.47491E-08 7.47491E-08 1.55377E-07 1.59133E-08 8.54322E-09 5.86543E-08 2.76964E-08 2.76964E-08 2.76966E-08 1.67705E-06 2.53619E-05 1.54305E-05 3.51635E-06 3.71524E-06 5.0315E-06 2.78778E-06 4.05069E-06 4.13027E-07 3.68702E-08

AC C

K07794 K07793 K07790 K00968 K06377 K09814 K09813 K01243 K02914 K00228 K00224 K01799 K01069 K01062 K01061 K01797 K02266 K03793 K03790 K03791 K03796 K03795 K12538 K12530 K12531 K12532 K12536 K12537 K09791 K09792 K09794 K09795 K09796 K09798 K09799 K10972 K10973 K10977 K10975 K06308 K09862 K09860 K09861 K06307 K06305 K04046 K04045 K04044 K04040 K02700 K02707 K02704 K02705 K10020 K10021 K10022 K10023 K10024 K10025 K10027 K05794 K05796 K05790 K05791 K05792 K05793 K05798 K01474 K01477

0.973984306 0.112635758 0.978225001 0.084549018 0.606220927 0.487021349 0.487021349 0.131600088 0.060918339 0.532266532 0.543532969 0.156069187 0.878464178 0.841249383 0.393505956 0.142771203 0.560781892 0.397371419 0.351598219 0.978225001 0.800973833 0.978225001 0.608491941 0.659584498 0.137044452 0.137044452 0.765413264 0.751356735 0.469401759 0.902698311 0.826703997 0.891779703 0.313252178 0.881923217 0.89871753 0.740535612 0.848912695 0.800973833 0.848912695 0.816532142 0.483857176 0.978225001 0.068446604 0.192507478 0.935287645 0.978225001 0.497002163 0.485337124 0.537095104 0.560781892 0.560781892 0.560781892 0.592871843 0.216895935 0.310341597 0.18958241 0.146882749 0.146882749 0.155719502 0.827182632 0.474421748 0.978225001 0.978225001 0.848912695 0.886288523 0.978225001 0.988938244 0.112118621 0.626656946

TE D

-3.17526E-05 -2.84924E-05 -2.34664E-07 1.46126E-06 -1.57769E-05 5.41909E-06 2.39174E-06 5.88063E-08 5.88063E-08 1.10378E-06 5.883E-08 4.0826E-06 -6.1659E-06 3.86099E-06 1.22106E-06 -0.000141893 4.71005E-10 -1.12063E-08 1.09591E-06 1.08044E-06 3.55507E-09 5.88063E-08 8.13121E-07 -2.50854E-06 3.52193E-06 -3.92216E-07 -2.71643E-06 5.81419E-08 3.4507E-07 6.77375E-07 -2.65448E-05 -3.96488E-05 -3.16621E-07 7.91662E-07 8.66135E-07 -1.60423E-06 3.7683E-05 8.66246E-07 5.98371E-07 -2.57613E-07 -6.30947E-07 -1.56982E-06 3.40646E-08 8.10927E-07 -3.86398E-05 3.03147E-06 5.02249E-09 6.5776E-06 3.07524E-06 2.45754E-05 2.12837E-07 -2.81767E-07 -8.82432E-06 -2.64249E-08 -7.68296E-06 -2.15748E-07 8.16486E-06 -5.55388E-05 -1.00963E-06 -5.04292E-08 1.08752E-05 7.98221E-07 8.59692E-07 5.98295E-08 7.98293E-07 1.11089E-06 -9.91524E-06 -8.23579E-08 -2.02956E-07

SC

M AN U

1.06179E-05 1.68849E-06 8.90211E-06 3.22018E-07 9.41728E-06 2.51682E-07 1.1135E-07 1.1135E-07 1.07332E-06 1.13671E-07 1.04336E-06 3.60378E-05 5.73053E-06 2.65397E-07 9.34325E-06 2.33024E-08 2.4114E-08 3.56434E-07 4.62796E-07 4.39629E-10 1.1135E-07 2.98842E-07 4.86337E-06 5.74216E-06 -3.65938E-07 9.41807E-06 1.11373E-07 -5.48467E-08 -3.05302E-05 3.43282E-05 6.11565E-05 -9.95914E-07 -3.0548E-05 8.5217E-08 1.16826E-05 -1.38183E-05 1.67841E-07 -5.28747E-07 2.93336E-06 -1.14983E-06 -1.80322E-06 9.84154E-07 -3.9068E-07 6.00472E-06 1.48861E-06 6.37667E-09 -3.99682E-06 2.01023E-05 3.23249E-05 9.39526E-06 4.72286E-06 -8.54982E-06 3.09583E-06 -3.38278E-05 1.6419E-06 8.54091E-06 1.20698E-06 7.92568E-06 3.01216E-06 -9.08186E-06 -3.81785E-07 5.98743E-08 1.19513E-07 6.63697E-09 -4.91478E-07 1.9228E-05 -5.87133E-08 2.39319E-07

RI PT

ACCEPTED MANUSCRIPT 3.21373E-05

EP

3.18773E-05 0.000374045 4.2282E-07 7.17846E-06 2.6973E-05 1.08676E-05 1.9333E-05 7.47491E-08 7.47491E-08 1.87829E-06 7.47404E-08 8.25984E-06 8.71151E-05 8.78274E-06 4.03371E-06 0.000834493 1.6071E-08 2.97894E-08 3.71178E-06 3.82927E-06 1.54498E-09 7.47491E-08 2.81279E-06 1.16032E-05 7.72493E-06 7.00279E-07 7.21033E-06 7.47168E-08 5.57826E-07 0.000732938 0.000613961 0.000287254 1.52757E-06 0.000732977 3.54193E-06 1.83695E-05 2.78222E-05 3.63691E-06 7.35989E-07 5.24133E-06 2.54709E-06 3.34511E-06 1.15395E-06 3.39049E-06 0.000104254 3.7838E-06 9.87117E-09 4.28189E-05 9.90942E-06 5.1778E-05 5.46729E-06 1.67849E-07 2.1167E-05 3.28085E-05 6.80554E-05 4.91113E-07 1.13887E-05 0.000535528 8.5145E-06 2.21717E-07 5.80878E-05 3.38535E-06 3.51583E-06 7.58853E-08 3.36579E-06 5.17992E-06 1.36508E-05 1.60508E-07 4.4109E-07

AC C

K01476 K01470 K01473 K01479 K01478 K05570 K05571 K05572 K05573 K02079 K05576 K02076 K02077 K03309 K03304 K03307 K03301 K03302 K06175 K06176 K07680 K03867 K03838 K11618 K11614 K11616 K11617 K11960 K11961 K02836 K02837 K10563 K10562 K02838 K06858 K02839 K07559 K07229 K07226 K07224 K07225 K07222 K10708 K05984 K08659 K05982 K07453 K07455 K07454 K09707 K07104 K00028 K00799 K00795 K00020 K00023 K09017 K09013 K01261 K01263 K01266 K09018 K08227 K08226 K08225 K08224 K08222 K08221 K00249

0.077563375 0.739803849 0.104103027 0.431786966 0.653038632 0.055507042 0.978225001 0.560781892 0.560781892 0.89871753 0.559363104 0.801215883 0.474963303 0.556325745 0.978225001 0.298609972 0.706863051 0.743204209 0.978225001 0.978225001 0.662603909 0.560781892 0.978225001 0.591359278 0.541362312 0.978225001 0.119099258 0.560781892 0.767410178 0.197699759 0.20208194 0.126462084 0.907281793 0.197699759 0.978225001 0.627301994 0.532699806 0.978225001 0.657700746 0.877739844 0.978225001 0.895572176 0.89871753 0.978225001 0.550266187 0.810985881 0.823880733 0.843511715 0.06018574 0.052257309 0.306109784 0.187255133 0.867260072 0.982872798 0.27486941 0.134487963 0.289562588 0.253930401 0.201697829 0.117605182 0.527970543 0.978225001 0.978225001 0.530870573 0.978225001 0.978225001 0.071888148 0.660409218 0.424149292

TE D

-2.31725E-05 -8.60079E-06 6.24426E-06 0.000157192 1.05574E-06 6.25238E-06 2.45788E-07 2.09728E-05 5.0092E-05 -9.52697E-08 1.70292E-06 -2.06388E-05 1.77373E-05 1.09493E-06 -1.33506E-06 -3.73453E-06 -3.93834E-06 -3.59359E-06 -4.95423E-06 -3.89678E-06 -9.88613E-09 8.93165E-07 8.69424E-07 -1.12905E-05 8.36369E-07 -1.94651E-08 -1.29983E-08 -1.29983E-08 -3.03207E-06 -8.17034E-06 -7.86257E-07 -2.29691E-05 -8.58214E-06 -9.22319E-09 1.60828E-06 8.04432E-07 -5.14306E-06 1.91436E-06 1.27417E-10 7.94579E-09 -1.66189E-08 -1.19318E-07 7.60333E-07 7.60333E-07 5.64184E-07 5.64184E-07 2.12275E-06 1.22603E-05 -1.49839E-08 1.53386E-05 -1.45652E-06 1.07784E-06 -1.60495E-05 4.10225E-05 -1.05049E-06 1.16024E-06 8.81413E-07 1.09208E-06 8.10832E-07 -2.03591E-06 7.79751E-07 7.86848E-07 8.04432E-07 4.88941E-07 -2.02715E-06 4.16491E-05 7.85164E-07 7.85161E-07 1.10952E-06

SC

M AN U

-9.34583E-06 7.41996E-06 0.000212063 3.60776E-07 6.3831E-06 1.58108E-06 1.65158E-05 1.59244E-05 3.61984E-07 -1.06421E-05 -9.17582E-06 7.02247E-06 3.65476E-07 9.93598E-06 5.38399E-06 5.81136E-06 -3.17838E-06 1.54269E-05 6.01695E-06 -1.42735E-08 -3.054E-05 1.023E-07 -2.00607E-05 -3.48008E-08 -9.79587E-09 -8.74447E-09 -8.74447E-09 8.94565E-06 1.81728E-05 -8.35771E-07 5.24624E-05 -4.93272E-06 1.26179E-08 1.38677E-06 -2.04844E-08 -4.36939E-06 1.08423E-06 3.82085E-09 5.354E-08 -1.13099E-08 2.46791E-06 9.32082E-07 9.32082E-07 9.5872E-07 9.5872E-07 1.2751E-06 1.13244E-05 6.93301E-08 4.39279E-06 1.90275E-05 -9.15228E-07 -2.71069E-06 3.0787E-05 -2.82032E-05 1.51633E-06 -5.54812E-07 4.37667E-07 -1.74639E-08 -1.94335E-06 -1.11737E-06 -4.26921E-09 -2.04844E-08 -3.9445E-07 -1.4606E-07 -4.28035E-05 -3.35225E-09 -4.72655E-09 4.29913E-07

RI PT

ACCEPTED MANUSCRIPT 4.26857E-05

EP

0.000552349 1.31799E-05 1.21571E-05 0.000449346 3.59842E-06 1.1572E-05 3.75957E-07 4.04941E-05 8.84869E-05 9.68628E-08 1.10714E-05 0.00071915 1.08299E-05 3.68877E-06 1.12939E-05 6.90043E-06 8.34594E-06 2.49624E-05 2.98386E-05 8.31537E-06 1.78616E-08 0.000732871 3.54613E-06 5.14194E-05 3.5502E-06 2.72569E-08 2.07861E-08 2.07861E-08 7.60834E-06 1.72466E-05 1.4386E-06 0.000205332 0.000222951 2.40693E-08 4.86754E-06 3.44419E-06 9.89208E-06 3.0735E-06 1.5563E-09 2.74905E-08 2.48092E-08 2.15189E-07 2.15202E-06 2.15202E-06 1.68598E-06 1.68598E-06 2.58982E-06 1.50444E-05 5.23281E-08 7.91645E-06 5.49158E-06 2.07441E-06 0.000569376 0.000101224 3.63608E-05 3.62582E-06 4.3124E-06 3.74857E-06 3.46064E-06 3.2409E-06 4.4675E-06 3.35946E-06 3.44419E-06 4.06034E-06 5.58731E-06 0.000176594 3.36129E-06 3.36129E-06 3.74682E-06

AC C

K00243 K00242 K00245 K00244 K00247 K00246 K02799 K02798 K02791 K02790 K04566 K04567 K01040 K04568 K02242 K02531 K02246 K02533 K02532 K02248 K13421 K03110 K03112 K03117 K03119 K12552 K12553 K12551 K12556 K12555 K06892 K06890 K06897 K10954 K06899 K11391 K11392 K00494 K00495 K00496 K00491 K00492 K04021 K04020 K04022 K04025 K04027 K04026 K07055 K07054 K07057 K07051 K07058 K10040 K04794 K13638 K13639 K13634 K13635 K13636 K13637 K13630 K13631 K13632 K13633 K02042 K05778 K05779 K05541

0.235215623 0.571302105 0.419205738 0.478148945 0.978225001 0.482826719 0.096886627 0.184025543 0.214391011 0.056930561 0.819075973 0.501009834 0.08217001 0.978225001 0.2216672 0.22264505 0.256980457 0.978225001 0.566560222 0.243762493 0.910150586 0.197699759 0.978225001 0.31343782 0.978225001 0.392630417 0.487021349 0.487021349 0.138088192 0.138270599 0.978225001 0.266928796 0.978225001 0.913367345 0.978225001 0.978225001 0.849657883 0.891779703 0.467941574 0.413979415 0.474963303 0.140616663 0.948728466 0.948728466 0.96401381 0.96401381 0.63757378 0.279355265 0.455900978 0.148029837 0.188499366 0.877739844 0.978225001 0.149698627 0.055507042 0.978225001 0.978225001 0.978225001 0.978225001 0.825464275 0.978225001 0.978225001 0.978225001 0.988328535 0.971236719 0.198958886 0.978225001 0.978225001 0.978225001

TE D

9.73149E-07 8.06581E-07 3.77539E-07 3.78114E-07 2.20107E-06 3.23701E-06 8.12866E-07 -5.26363E-09 -1.08983E-06 1.08601E-05 -1.11868E-05 -5.14528E-07 -2.65707E-05 8.01658E-07 7.95952E-07 7.85026E-07 -8.72331E-05 -9.40777E-09 6.1639E-06 2.31612E-05 2.31612E-05 8.65004E-07 8.6204E-07 8.6204E-07 8.85942E-07 8.20902E-07 2.78069E-07 2.78069E-07 4.09873E-09 8.63152E-07 -1.27121E-05 -4.72262E-05 -6.3074E-08 1.69802E-08 8.63168E-07 8.06731E-07 1.52182E-09 -5.16338E-06 1.92593E-05 7.54869E-07 -6.32981E-09 5.73918E-08 5.73918E-08 5.88063E-08 9.51584E-07 -3.88082E-07 -5.48931E-06 6.9415E-06 -1.49839E-08 -9.33792E-07 -3.47432E-06 -7.0589E-05 0.000108512 6.24917E-08 6.62579E-06 -2.88953E-05 5.14587E-05 7.64657E-07 -5.98301E-06 -1.49839E-08 -2.1124E-06 3.44543E-08 1.26951E-08 -2.30965E-09 4.27736E-06 8.41486E-06 5.88063E-08 5.883E-08 -7.41467E-08

SC

M AN U

9.01746E-09 -2.96125E-07 -3.04522E-07 1.25639E-05 -2.31906E-06 -1.2892E-06 5.13309E-08 -1.0064E-06 -3.79784E-05 -4.45494E-05 -1.16107E-07 -3.47559E-05 -2.3477E-08 3.12773E-07 -3.38529E-09 3.83285E-05 2.76212E-07 9.30005E-08 4.69794E-06 4.69794E-06 1.52997E-07 1.06205E-07 1.06205E-07 2.36549E-07 -1.79868E-08 3.21096E-08 3.21096E-08 1.74775E-07 9.17973E-08 1.10176E-05 -4.92788E-06 3.95E-08 1.43398E-08 8.62058E-08 -1.18668E-08 -1.70811E-09 6.64442E-06 -1.13452E-05 -1.2527E-06 -9.21283E-09 1.10651E-07 1.10651E-07 1.1135E-07 -8.15189E-07 4.24885E-08 -2.95784E-05 -2.86175E-06 6.93301E-08 -9.25246E-06 -1.13819E-05 -0.000135411 9.51182E-06 2.18359E-07 -2.30261E-05 -1.01943E-05 1.75381E-05 -4.03877E-07 -1.65089E-05 6.93301E-08 -3.15942E-05 9.84543E-07 2.79587E-08 1.67834E-08 2.45832E-05 9.3341E-06 1.1135E-07 1.13671E-07 2.88566E-06

RI PT

ACCEPTED MANUSCRIPT -1.6027E-10

EP

3.94557E-06 3.4445E-06 8.94453E-07 8.93834E-07 0.000161316 4.38291E-06 3.60124E-06 3.80017E-08 1.32361E-06 0.000174895 0.000126675 1.96822E-06 0.000674676 3.44718E-06 2.5099E-06 3.38303E-06 0.000243624 1.23532E-07 5.1031E-06 5.93893E-05 5.93893E-05 3.57989E-06 3.55146E-06 3.55146E-06 3.57701E-06 3.50494E-06 5.95543E-07 5.95543E-07 1.19693E-08 3.43468E-06 2.20728E-05 0.000166535 1.00467E-07 2.13404E-08 3.52252E-06 3.44831E-06 1.15141E-08 5.5808E-06 4.8287E-05 1.11208E-05 1.8057E-08 7.54291E-08 7.54291E-08 7.47491E-08 4.68844E-06 7.39842E-07 0.000224387 4.64543E-05 5.23281E-08 1.08682E-05 1.2715E-05 0.002661547 0.000412046 1.0157E-07 0.000714453 0.000705856 0.000622159 3.33166E-06 3.38996E-05 5.23281E-08 0.000736347 1.15356E-06 1.06636E-08 2.80673E-08 2.39975E-05 3.89179E-06 7.47491E-08 7.47404E-08 1.99602E-07

AC C

K05774 K05775 K05772 K05773 K05540 K01457 K01455 K01453 K01452 K01451 K08070 K08077 K05515 K12945 K12944 K12943 K12942 K14727 K00108 K13890 K13891 K13893 K13894 K13895 K13896 K06159 K06152 K06151 K06157 K06156 K06155 K03325 K01505 K04756 K11940 K11941 K11942 K01506 K01501 K01500 K10810 K11522 K11523 K11521 K10544 K00007 K00001 K00009 K10725 K00263 K00260 K00266 K01207 K01208 K00919 K02519 K02518 K02511 K03179 K03170 K03177 K11008 K11004 K11003 K08296 K08297 K02634 K02635 K07693

0.978225001 0.978225001 0.789196901 0.780407994 0.978225001 0.738677692 1 0.446953139 0.89871753 0.519173253 0.085006703 0.952479647 0.548757803 0.978225001 0.978225001 0.978225001 0.051493661 0.346746644 0.587897892 0.432465543 0.432465543 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.903038209 0.903038209 0.150079273 0.978225001 0.349029629 0.288136158 0.574260915 0.635216773 0.978225001 0.978225001 0.987991864 0.486893642 0.232416139 0.978225001 0.748771086 0.567210575 0.567210575 0.560781892 0.978225001 0.978225001 0.803841587 0.902532144 0.455900978 0.820848331 0.605381378 0.133879362 0.091317261 0.145899157 0.309872598 0.507694988 0.361089909 0.978225001 0.655734267 0.455900978 0.191905212 0.89871753 0.159897671 0.958007779 0.150079273 0.057907677 0.560781892 0.559363104 0.129257966

TE D

8.49133E-10 5.33496E-08 3.83698E-07 -5.96583E-09 -8.79538E-07 8.78795E-07 3.00623E-09 -1.29424E-08 2.28904E-05 6.03464E-06 9.36542E-07 1.02098E-06 8.57834E-07 7.97055E-07 9.72845E-07 8.7176E-07 3.39728E-09 -2.73392E-06 6.30712E-06 5.63052E-07 8.22523E-07 8.02155E-07 -2.66922E-07 -5.12734E-07 -6.10431E-07 -5.029E-06 1.07795E-06 -3.76552E-07 8.48698E-07 4.69505E-08 -4.79924E-06 8.57834E-07 -5.30473E-06 8.58146E-07 5.91144E-06 1.0079E-06 2.70385E-07 -1.0471E-06 1.0097E-06 2.51257E-07 1.26693E-07 8.57834E-07 -1.29983E-08 -1.3043E-06 -1.4133E-06 2.49387E-06 1.61004E-06 -1.41199E-07 -1.32932E-09 1.28205E-07 -3.46513E-07 3.07801E-06 4.6955E-05 2.19166E-08 1.07013E-06 8.80841E-06 7.31168E-08 -5.0171E-08 6.58547E-06 -7.86583E-06 -1.16716E-08 3.4599E-05 -8.67398E-08 -8.69642E-10 -8.69642E-10 8.79912E-07 -2.01744E-05 -3.03621E-05 9.54217E-07

SC

M AN U

1.5645E-06 -1.18682E-06 3.33634E-09 -5.4119E-05 1.01084E-07 -5.16329E-10 -1.09178E-08 -1.46047E-05 6.56839E-06 4.0309E-07 2.17778E-07 5.73595E-08 -3.05399E-07 7.22023E-07 5.54973E-08 3.49035E-08 8.15976E-06 1.21157E-05 8.92872E-07 2.78613E-07 3.83027E-09 2.70249E-06 2.73263E-06 3.04744E-06 -2.8587E-06 4.41916E-07 -1.09632E-06 5.1331E-08 1.06429E-06 1.88963E-05 5.73595E-08 -4.2968E-06 8.5409E-08 6.34832E-06 2.78173E-07 1.22847E-07 -2.12276E-06 3.07525E-07 1.16376E-07 2.2149E-07 5.73595E-08 -8.74447E-09 -1.21343E-06 9.63444E-07 -3.24726E-06 3.20257E-05 1.22967E-07 5.79287E-09 2.2156E-07 7.80354E-07 1.89573E-06 1.00709E-05 4.56271E-08 -8.59022E-07 -1.34474E-05 7.07178E-09 -9.28812E-08 6.73785E-07 1.25233E-05 2.37631E-08 -1.76706E-05 -9.52277E-07 -1.85386E-09 -1.85386E-09 -3.05189E-05 -3.30459E-05 -1.47999E-05 -3.05664E-05

RI PT

ACCEPTED MANUSCRIPT -1.47968E-09

EP

3.06262E-09 1.41025E-06 1.0708E-05 2.44259E-08 0.000131266 3.55214E-06 3.75711E-09 1.14572E-08 5.46836E-05 1.1218E-05 2.57961E-06 3.00505E-06 3.51748E-06 3.31085E-06 3.03883E-06 3.54542E-06 1.43829E-08 9.26211E-06 1.21214E-05 1.67896E-06 2.90154E-06 3.3686E-06 2.74765E-07 1.63994E-06 1.73288E-06 1.03036E-05 3.74662E-06 4.26001E-06 3.53558E-06 1.16479E-06 8.03465E-06 3.51748E-06 1.20448E-05 3.43969E-06 1.11184E-05 3.6168E-06 4.86784E-07 4.12744E-06 3.03104E-06 4.82679E-07 1.81652E-07 3.51748E-06 2.07861E-08 1.51698E-06 4.25056E-06 9.67338E-06 2.86711E-05 1.3719E-07 3.05395E-08 1.85037E-07 5.78637E-07 5.78572E-06 0.000123611 1.74097E-08 2.10854E-06 5.10923E-05 3.60649E-09 1.83944E-07 4.63268E-06 0.000739427 2.92467E-08 0.000100708 1.73381E-06 4.07196E-09 4.07196E-09 0.000732909 0.000730063 0.000136607 0.000733386

AC C

K07691 K07690 K07696 K07077 K07076 K07070 K09190 K08589 K01430 K05539 K12963 K12962 K12961 K02972 K14744 K02167 K02164 K03342 K03346 K12299 K12291 K12290 K12292 K12295 K12294 K12297 K12368 K11922 K11923 K11920 K11921 K11926 K11924 K11925 K07262 K07261 K07266 K07267 K07264 K07265 K07268 K07269 K04478 K07487 K07485 K07482 K07480 K07489 K11210 K11211 K11212 K11216 K00065 K00064 K00066 K00068 K08261 K08260 K00285 K00286 K00280 K00283 K08088 K14199 K14194 K01883 K01887 K01224 K01889

0.776593254 0.727685238 0.978225001 0.978225001 0.060392245 0.978225001 0.811745175 0.099981946 0.147870701 0.474421748 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.058017826 0.344259573 0.106652919 0.978225001 0.978225001 0.978225001 0.143334679 0.442748885 0.373895353 0.903421018 0.978225001 0.978225001 0.978225001 0.878464178 0.167944508 0.978225001 0.894813658 0.978225001 0.49333943 0.978225001 0.90854858 0.96401381 0.978225001 0.933966255 0.318627299 0.978225001 0.487021349 0.838006421 0.823880733 0.869401475 0.786135578 0.169332591 0.978225001 0.318091545 0.243908367 0.789654455 0.071829703 0.238302604 0.879917385 0.347407847 0.201369158 0.932221366 0.460813855 0.887107241 0.728882448 0.102803992 0.949761932 0.978225001 0.978225001 0.19789644 0.06702887 0.641382498 0.197699759

TE D

3.76224E-06 1.21771E-06 4.00705E-07 9.75693E-06 9.87835E-07 1.41998E-06 -4.09973E-06 1.07195E-06 8.00545E-07 -6.87273E-06 -8.38276E-07 2.88202E-06 -6.74108E-07 4.50927E-07 5.83904E-06 2.8098E-07 1.39346E-06 1.11247E-05 8.61377E-07 7.65035E-07 5.88063E-08 1.09496E-07 1.09582E-07 1.09582E-07 -2.34947E-06 3.53574E-06 3.42095E-06 5.88063E-08 5.88063E-08 6.62578E-06 4.4004E-08 -2.02991E-05 -4.73987E-06 6.29958E-06 -6.64682E-07 -4.69988E-06 -1.88817E-06 5.292E-08 6.60768E-07 7.23439E-09 5.25274E-07 6.35089E-06 8.59693E-07 -4.91731E-07 5.78158E-06 1.20296E-05 -1.94903E-06 -1.41001E-06 -1.572E-05 1.36501E-05 -2.28458E-06 9.75147E-06 1.27784E-06 -2.2904E-07 5.31257E-06 5.54134E-07 3.81336E-07 1.08931E-06 5.88063E-08 1.17236E-05 5.88063E-08 3.31884E-05 -2.8208E-06 6.26538E-06 5.92688E-06 5.88307E-09 -3.56189E-05 -1.09062E-05 5.77665E-05

SC

M AN U

3.48198E-06 2.69572E-06 9.79728E-07 -5.76324E-07 -3.09268E-05 9.08922E-06 -9.22443E-07 3.82152E-07 -1.4459E-05 -8.63168E-07 2.54382E-07 -4.88792E-09 2.4546E-06 8.55565E-06 1.53256E-06 7.79536E-07 6.95356E-06 -1.65837E-07 7.70319E-08 1.1135E-07 2.128E-07 2.13551E-07 2.13551E-07 -6.25036E-06 5.76239E-06 5.76604E-06 1.1135E-07 1.1135E-07 -3.11345E-05 1.997E-07 -1.3084E-05 -3.67957E-05 6.4475E-06 -1.42095E-06 -9.33672E-06 -8.21921E-06 1.55724E-06 -1.81909E-07 1.67513E-08 -2.57324E-07 6.56457E-06 5.90027E-08 9.14736E-07 6.15278E-06 5.74014E-06 -8.13777E-06 4.4061E-06 1.21752E-05 6.27322E-06 1.80302E-05 1.00363E-06 2.19379E-06 -4.3797E-07 7.28041E-06 1.35084E-06 3.88148E-06 -7.28987E-07 1.1135E-07 4.62192E-06 1.1135E-07 2.3671E-05 -8.3327E-06 6.46712E-06 -2.60871E-05 9.14468E-08 -4.8641E-07 -5.76619E-06 -1.57029E-05

RI PT

ACCEPTED MANUSCRIPT -3.53271E-07

EP

2.58833E-05 4.38286E-06 3.66498E-06 2.64879E-05 3.95476E-06 0.000733392 8.72066E-06 2.18452E-06 2.84043E-06 0.000707057 1.16062E-06 3.75457E-06 3.95593E-06 3.56305E-06 1.13853E-05 1.4543E-06 4.57162E-06 4.21506E-05 3.60399E-06 3.39409E-06 7.47491E-08 1.56125E-07 1.55377E-07 1.55377E-07 2.44098E-05 7.72573E-06 7.80093E-06 7.47491E-08 7.47491E-08 0.000727464 2.64857E-07 0.000543772 0.000724847 1.16575E-05 2.56771E-06 1.0332E-05 8.26293E-06 1.41196E-06 3.70292E-06 9.3016E-09 4.19868E-06 1.03857E-05 3.51583E-06 2.05616E-06 1.09303E-05 1.32528E-05 8.38851E-06 4.86268E-06 2.62167E-05 8.4388E-05 2.54998E-05 9.27625E-06 1.67808E-05 1.18703E-06 8.46774E-06 1.76453E-06 2.15725E-06 2.09981E-06 7.47491E-08 6.2713E-06 7.47491E-08 7.37171E-05 8.63683E-06 1.17143E-05 0.000137287 5.25328E-08 0.000707756 2.8677E-05 0.000861277

AC C

K01220 K02755 K02756 K02750 K02753 K00939 K00938 K00934 K00932 K00931 K01083 K01085 K01087 K02570 K02573 K02572 K03482 K03483 K03487 K03485 K02287 K02286 K02285 K02284 K02282 K02281 K02280 K02289 K02288 K03625 K03153 K03628 K03629 K09889 K09880 K09882 K09883 K07679 K07678 K11021 K07675 K07674 K07676 K07670 K07673 K07019 K07018 K07013 K07014 K07016 K08372 K05884 K05885 K05886 K05887 K05880 K05881 K05882 K08902 K05739 K08903 K00549 K01412 K01147 K01417 K00038 K01142 K01419 K00789

0.978225001 0.56972093 0.709656893 0.603986222 0.978225001 0.188234068 0.138513742 0.877739844 0.978225001 0.813870218 0.909879859 0.849657883 0.978225001 0.560781892 0.23693732 0.706463761 0.978225001 0.767650392 0.978225001 0.979010779 0.560781892 0.593994105 0.592871843 0.592871843 0.920642585 0.538267762 0.545020342 0.560781892 0.560781892 0.181216126 0.458492259 0.85625514 0.126462084 0.474963303 0.952600859 0.570854196 0.825464275 0.730937211 0.979802948 0.497041036 0.989619614 0.402111508 0.978225001 0.841249383 0.519494142 0.344040248 0.827182632 0.530946749 0.131767268 0.893360809 0.330620372 0.057008232 0.978225001 0.978225001 0.327671247 0.881351744 0.450057436 0.883365762 0.560781892 0.123675851 0.560781892 0.201369158 0.770779867 0.478148945 0.523623033 0.145834343 0.379791618 0.812810052 0.329503177

TE D

8.02244E-07 6.51565E-06 8.0559E-07 -1.64104E-06 3.40048E-05 3.33584E-06 8.79675E-08 2.25741E-07 5.67595E-07 -4.2571E-07 6.79633E-07 2.64471E-07 2.58791E-07 5.5373E-08 1.0043E-07 -3.874E-07 6.81375E-07 2.83131E-05 -8.71037E-05 -7.3241E-07 5.88063E-08 1.94592E-06 8.00443E-07 -3.93727E-07 2.18895E-08 3.55659E-09 7.62825E-06 2.74375E-08 -1.99051E-06 2.86604E-08 -7.93868E-08 3.04007E-09 -1.93568E-08 -1.29983E-08 -1.09115E-05 -2.9115E-06 -3.06428E-05 8.12744E-07 2.76871E-06 -5.68343E-05 2.69334E-07 3.54541E-06 -2.75743E-07 2.83947E-06 5.45241E-06 6.46007E-07 4.71538E-06 5.14835E-05 4.51341E-05 -1.08132E-06 1.80128E-05 5.60834E-08 3.60991E-05 -5.20521E-06 9.26596E-07 1.49422E-05 2.55302E-05 3.60327E-05 7.59771E-06 -6.65734E-07 -1.61555E-06 5.9894E-06 3.63551E-06 3.54534E-07 1.06098E-06 7.10175E-06 1.05923E-06 8.59663E-07 -5.75803E-06

SC

M AN U

5.19358E-07 1.48655E-08 -3.10083E-07 1.83095E-05 7.06164E-06 1.07022E-06 1.70976E-06 -7.79382E-07 -2.04095E-06 -9.88964E-07 -1.66322E-06 -1.67363E-06 -1.23026E-06 -3.63174E-06 -4.09733E-07 -5.32177E-07 1.51568E-05 -6.02833E-05 -1.729E-06 1.1135E-07 2.70217E-05 -4.00447E-07 -3.63648E-07 9.01674E-09 6.5458E-08 4.27061E-06 4.98974E-08 2.76871E-05 5.88874E-08 4.08228E-08 7.01721E-08 -9.98908E-09 -8.74447E-09 -5.76708E-06 -1.07739E-06 4.17577E-05 -2.43659E-08 4.2091E-06 -5.16754E-05 1.2884E-06 5.81371E-06 -9.75358E-08 -1.06427E-06 -1.22426E-05 -3.34764E-05 4.93898E-07 1.07143E-06 2.48496E-05 -1.26542E-06 4.93565E-05 1.16255E-07 5.10209E-05 1.10368E-05 2.11566E-07 9.65822E-06 -4.29132E-05 3.22203E-05 1.1841E-05 1.48104E-06 -6.69397E-07 6.43786E-06 -2.77302E-05 1.12241E-06 3.27992E-07 7.2703E-06 3.35475E-07 5.77404E-08 -3.18453E-05

RI PT

ACCEPTED MANUSCRIPT -2.42917E-08

EP

3.448E-06 4.38738E-06 3.35652E-06 1.18354E-05 0.000628407 1.06992E-05 1.22507E-06 1.47664E-06 4.03013E-06 5.96339E-06 4.48762E-06 5.68868E-06 5.69634E-06 2.21756E-06 9.58539E-06 6.80506E-07 4.53673E-06 3.42811E-05 0.001419485 2.4287E-06 7.47491E-08 2.18972E-05 3.3814E-06 7.98676E-07 5.00241E-08 3.45126E-08 5.10305E-06 3.89213E-08 1.72322E-05 1.27622E-07 2.42537E-07 3.8417E-08 2.42328E-08 2.07861E-08 2.86779E-05 1.58637E-05 0.000460451 3.45281E-06 4.27203E-06 0.000619181 3.19227E-07 7.74974E-06 5.01039E-07 5.02206E-06 2.06246E-05 0.000733455 8.00143E-06 0.000201597 0.000177961 4.68246E-06 0.000558267 7.9891E-08 0.0001622 0.000512288 3.93103E-06 1.79495E-05 0.000269767 7.03614E-05 2.45913E-05 3.69043E-06 3.49362E-06 1.11847E-05 0.000729986 0.000690209 3.67728E-06 9.54279E-06 3.67952E-06 3.52064E-06 0.00073176

AC C

K14762 K06195 K03819 K03817 K03816 K03813 K11909 K11904 K11905 K11906 K11907 K11900 K11901 K11902 K11903 K13796 K07245 K07246 K07240 K07241 K07242 K07243 K09016 K09945 K09944 K09947 K09946 K09941 K09940 K09943 K09942 K09948 K10851 K10850 K03667 K03196 K00048 K10857 K00043 K00046 K06011 K01075 K00958 K00952 K00955 K00954 K00590 K02774 K02773 K02778 K01607 K01602 K03750 K01609 K02553 K02806 K02557 K02800 K02558 K02809 K02808 K03600 K03601 K03602 K03603 K03605 K03607 K06078 K09710

0.978225001 0.461746458 0.978225001 0.979010779 0.304957931 0.452279193 0.883365762 0.681163514 0.978225001 0.978225001 0.978225001 0.978225001 0.978225001 0.865943585 0.978225001 0.978225001 0.978225001 0.168751704 0.593994105 0.89174869 0.560781892 0.098624674 0.978225001 0.978225001 1 0.106219352 0.495760433 0.26277184 0.485561659 0.891779703 0.87379077 0.105594145 0.680190597 0.487021349 0.812663097 0.978225001 0.149042889 0.978225001 0.05616978 0.182813477 0.207432987 0.532699806 0.560781892 0.284835596 0.458492259 0.138270599 0.744642655 0.53098335 0.456645054 0.978225001 0.330815815 0.554219803 0.196770679 0.978225001 0.978225001 0.222249701 0.367506905 0.082566426 0.732242864 0.866354432 0.883116695 0.485337124 0.243544696 1 0.978225001 0.26113199 0.978225001 0.978225001 0.19974692

TE D

9.95166E-08 2.76222E-07 8.55306E-07 8.55306E-07 1.6436E-07 1.24585E-06 1.14856E-05 -4.91376E-07 -1.53346E-08 -1.48052E-08 -6.07419E-06 1.06156E-05 -1.67382E-08 -2.75015E-08 2.78742E-09 -4.48513E-06 3.87934E-06 -4.55542E-07 1.25303E-05 7.89387E-06 5.62385E-06 2.29832E-05 9.35795E-06 4.85538E-06 -3.80086E-06 -5.72576E-06 3.06996E-09 4.66026E-06 -8.14247E-06 -8.65563E-10 6.28409E-07 5.44005E-07 7.50128E-07 3.36112E-08 5.48953E-07 5.46918E-07 8.29362E-06 2.41674E-05 -8.40517E-06 1.15223E-06 1.14914E-07 8.05773E-07 -1.11022E-08 -3.71507E-07 -7.92413E-07 5.88063E-08 5.88063E-08 1.2663E-05 6.31659E-05 -5.45642E-08 7.91497E-07 4.68492E-08 -2.71919E-07 1.10465E-05 3.76656E-05 3.63438E-05 7.04058E-07 4.41567E-08 1.04887E-06 1.42608E-06 6.68053E-06 -7.36387E-05 -1.7408E-05 4.13927E-06 4.67298E-09 5.71918E-09 -3.07873E-05 4.52069E-09 -5.77047E-10

SC

M AN U

5.43984E-07 6.15421E-08 6.15421E-08 -1.37161E-06 4.2963E-07 6.35158E-06 9.16464E-07 2.43074E-08 -1.03147E-08 -3.91953E-06 1.60188E-05 -9.33253E-09 6.92582E-08 -9.77942E-10 1.21333E-05 -6.44851E-06 -1.53683E-06 1.38789E-05 8.11597E-06 6.04736E-06 1.25622E-06 -5.13461E-07 -7.37999E-07 1.52289E-05 1.27584E-05 -4.5323E-09 5.36407E-06 -9.01203E-06 2.4028E-09 -1.08471E-06 7.17044E-07 -2.60067E-07 9.86498E-07 7.39866E-07 7.14715E-07 1.46252E-05 7.17189E-05 -8.65788E-06 -8.58892E-07 3.85514E-07 -4.13881E-10 3.15137E-08 -1.23409E-06 -6.67523E-07 1.1135E-07 1.1135E-07 1.25186E-05 5.82239E-06 -4.45799E-08 4.29E-10 6.34354E-08 8.41133E-06 -5.25172E-06 2.11013E-06 -1.7496E-06 1.33856E-05 1.20269E-06 3.12676E-07 8.82152E-07 6.96158E-07 9.71951E-06 6.43514E-05 2.49475E-05 5.13895E-08 1.04017E-07 -4.04866E-05 8.42995E-08 5.41502E-08

RI PT

ACCEPTED MANUSCRIPT 1.56974E-07

EP

5.96089E-07 2.82825E-06 3.51329E-06 3.51329E-06 8.30336E-06 4.21505E-06 1.26214E-05 2.05578E-06 3.57391E-08 2.49288E-08 2.11253E-05 1.87438E-05 3.07163E-08 8.94883E-08 3.83436E-09 7.55026E-06 1.30731E-05 1.89782E-06 1.80934E-05 1.15306E-05 1.10867E-05 2.28054E-05 6.98987E-06 6.04671E-06 1.31459E-05 1.19553E-05 4.5323E-09 1.25292E-05 1.32676E-05 2.36208E-09 2.84653E-06 1.67353E-06 2.96022E-06 1.1544E-06 1.68076E-06 1.67041E-06 2.17217E-05 0.000584949 1.61662E-05 2.10577E-06 5.41999E-07 3.35799E-06 3.09275E-08 2.91431E-06 1.70076E-06 7.47491E-08 7.47491E-08 4.14922E-05 8.29011E-05 1.47395E-07 3.37139E-06 1.96657E-08 0.000577097 0.000585608 0.000547612 0.000596055 6.61127E-06 1.24819E-06 4.85953E-06 3.91602E-06 4.53675E-06 0.001236744 5.8876E-05 1.59639E-05 2.7878E-08 5.88036E-08 0.000554416 3.52393E-08 4.88735E-08

AC C

K09711 K09712 K06073 K06074 K06075 K06077 K07657 K07654 K07653 K07651 K07659 K11041 K11040 K11045 K11046 K11049 K06927 K06922 K06928 K07032 K07039 K07038 K00380 K00381 K00383 K00389 K01387 K09158 K09159 K09154 K09151 K05714 K05710 K05711 K05712 K05713 K00564 K00567 K00568 K00569 K05575 K01169 K01167 K05577 K01160 K05578 K05579 K08093 K08094 K08097 K02255 K00114 K02123 K02120 K02121 K02124 K03837 K03836 K03835 K03834 K03831 K13038 K13787 K13788 K12255 K12254 K12257 K12256 K12252

0.978225001 0.979384842 0.978225001 0.978225001 0.978225001 0.978225001 0.334640538 0.840563972 0.609262352 0.633052924 0.909276643 0.170967323 0.827182632 0.814165775 0.576181416 0.474421748 0.248448997 0.894305951 0.344968018 0.373384876 0.548277737 0.066059961 0.530870573 0.6755049 0.241270712 0.43639045 0.305049708 0.646389569 0.607674834 0.592871843 0.978225001 0.978225001 0.978225001 0.89871753 0.978225001 0.978225001 0.272420967 0.099129702 0.766006614 0.860375382 0.872342019 0.978225001 0.606220927 1 0.823310078 0.560781892 0.560781892 0.581403732 0.073250959 0.877739844 0.978225001 0.272528713 0.978225001 0.978225001 0.734402067 0.638147845 0.099835184 0.837796589 0.978225001 0.978225001 0.437479176 0.251759238 0.1147837 0.091530999 0.228297998 0.229492884 0.336299506 0.077970387 0.642469694

TE D

8.01379E-07 3.53961E-06 6.1388E-07 2.67295E-08 8.03142E-07 1.04867E-06 5.81419E-08 5.88063E-08 7.8161E-07 4.09873E-09 4.09873E-09 4.09873E-09 -3.57502E-07 5.67599E-06 8.99525E-08 6.40987E-07 1.06702E-06 -4.08952E-06 -2.60321E-06 -5.40989E-06 -5.10626E-06 5.20335E-06 1.06303E-06 -3.95133E-06 8.57483E-06 5.49481E-07 -7.25439E-05 -4.51469E-07 -0.000102602 2.91019E-05 -6.49314E-06 -1.6492E-06 -3.67941E-06 6.90705E-06 2.73745E-06 2.66567E-05 5.88063E-08 5.81419E-08 5.88063E-08 5.88063E-08 5.81419E-08 5.88063E-08 5.88063E-08 1.09582E-07 5.88063E-08 6.83328E-06 -3.14985E-06 7.97691E-07 -3.61647E-05 4.84032E-06 -1.29569E-08 -2.38538E-05 -1.26968E-08 -1.18621E-08 -1.64658E-08 -1.18621E-08 7.23131E-05 -3.97565E-06 3.93886E-06 -5.93844E-06 3.00707E-06 6.43671E-06 2.28879E-05 1.79098E-05 -4.14694E-07 -2.88906E-06 3.01824E-07 2.86342E-06 1.3363E-05

SC

M AN U

5.76534E-06 -9.60157E-07 9.61187E-07 1.0771E-07 7.25015E-08 1.11373E-07 1.1135E-07 -4.83524E-07 1.74775E-07 1.74775E-07 1.74775E-07 7.73536E-07 7.09022E-06 -3.70182E-07 -9.48836E-07 -9.12787E-07 -3.08892E-06 6.11983E-06 -7.42922E-06 -6.70195E-06 5.30566E-06 3.25775E-07 -2.7593E-05 -1.62852E-06 9.69923E-07 2.23015E-05 -1.54492E-06 -1.62481E-05 -2.41153E-05 8.16279E-06 2.72766E-05 1.34284E-05 -4.72227E-06 7.06639E-06 5.16293E-05 1.1135E-07 1.11373E-07 1.1135E-07 1.1135E-07 1.11373E-07 1.1135E-07 1.1135E-07 2.13551E-07 1.1135E-07 6.51791E-06 9.13373E-06 -1.43222E-06 -4.7153E-05 9.75942E-06 7.214E-08 -5.72852E-05 -8.29981E-09 -9.41701E-09 -9.34493E-09 -9.41701E-09 -8.83206E-06 -2.21964E-05 5.69854E-06 -9.63368E-06 -1.19248E-07 3.83786E-07 -1.46105E-05 -8.33156E-06 -1.64596E-07 -1.10997E-06 -3.18502E-05 5.38278E-06 4.71701E-06

RI PT

ACCEPTED MANUSCRIPT 4.04236E-08

EP

3.36794E-06 7.72044E-06 2.26154E-06 1.2475E-06 3.51838E-06 4.01614E-06 7.47168E-08 7.47491E-08 3.30281E-06 1.19693E-08 1.19693E-08 1.19693E-08 5.81535E-07 9.45275E-06 4.09153E-07 2.26584E-06 2.0984E-06 4.18517E-06 8.04444E-06 8.33407E-06 7.38954E-06 1.17537E-05 3.6795E-06 4.50402E-05 6.04848E-06 1.70989E-06 0.000202945 1.89465E-06 0.000386905 3.62811E-05 9.96454E-06 3.07655E-05 1.15722E-05 0.000741173 8.20487E-06 0.000484578 7.47491E-08 7.47168E-08 7.47491E-08 7.47491E-08 7.47168E-08 7.47491E-08 7.47491E-08 1.55377E-07 7.47491E-08 2.72676E-05 2.1066E-05 6.38377E-06 0.00056356 8.95469E-06 5.3217E-08 0.001232415 2.292E-08 2.40476E-08 2.3963E-08 2.40476E-08 0.00045757 0.000711648 8.34377E-06 2.44749E-05 1.74225E-05 4.27711E-06 5.46819E-05 4.67293E-05 8.3137E-07 1.57985E-05 0.000732652 9.25142E-06 2.02519E-05

AC C

K13255 K12071 K12073 K12072 K09912 K09914 K11780 K11781 K11530 K12787 K12785 K12784 K06718 K09969 K09968 K09966 K09965 K09964 K09962 K09961 K09960 K11250 K11258 K00712 K10783 K10124 K00978 K14956 K06178 K01596 K01597 K01595 K01590 K01591 K01598 K01599 K02711 K02710 K02713 K02712 K02714 K02717 K02716 K02719 K02718 K03449 K03446 K03445 K01620 K01621 K01622 K01625 K02829 K02828 K02827 K02826 K02824 K02823 K03198 K03199 K03668 K03669 K03190 K03191 K03194 K03195 K03664 K03197 K06013

0.978225001 0.537671899 0.978225001 0.909283212 0.978378683 0.978225001 0.560781892 0.560781892 0.978225001 0.150079273 0.150079273 0.150079273 0.237927629 0.348457232 0.530458705 0.978225001 0.877991063 0.65604039 0.347562506 0.309872598 0.370121957 0.677222576 0.978225001 0.399742015 0.157649073 0.96401381 0.120087476 0.893688489 0.056228418 0.295108286 0.168780103 0.177980344 0.466334677 0.978225001 0.493952419 0.544710239 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.560781892 0.592871843 0.560781892 0.839747643 0.850664628 0.978225001 0.137044452 0.247952572 0.43639045 0.424640455 0.517330081 0.560781892 0.49333943 0.560781892 0.140923763 0.560781892 0.555087186 0.659584498 0.978225001 0.465294764 0.147870701 0.339189413 0.978225001 0.978225001 0.177980344 0.640058177 0.5218685

EP

-2.87023E-07 -5.19371E-08 5.97652E-06 5.2447E-05 -7.55878E-07 9.26348E-06 -4.97352E-09 8.73399E-07 -6.4381E-07 -6.07195E-06 6.84819E-06 2.26206E-07 8.46045E-08 6.18716E-06 -7.49405E-07 -7.43361E-07 6.33647E-06 7.74217E-07 2.2451E-05 -9.0131E-07 3.3244E-09 -2.62081E-06 2.00654E-09 1.55851E-07 5.88063E-08 1.07603E-06 5.44623E-07 166.3131996

SC

M AN U

-3.50626E-08 6.25356E-06 -2.40091E-06 -7.51485E-07 1.37085E-05 -1.71899E-06 1.07701E-07 -1.22366E-06 -3.88924E-06 -1.29314E-05 2.90753E-07 -1.16295E-06 -3.40484E-05 -4.21788E-05 -7.94063E-06 -7.80958E-06 -2.91642E-05 1.14656E-05 -9.62161E-07 2.9699E-08 -4.65273E-07 8.40332E-08 2.92628E-07 1.1135E-07 -9.14076E-07 -1.65449E-06 2.925467024

RI PT

ACCEPTED MANUSCRIPT -4.22297E-05

TE D

5.50121E-05 1.35772E-07 1.21303E-05 0.000181735 1.50095E-06 1.37428E-05 3.5716E-06 3.54669E-06 2.58083E-06 2.11642E-05 0.000612437 1.1533E-06 4.82679E-06 0.000179764 0.000118228 7.71136E-05 0.000137892 0.000113434 1.7202E-05 1.23658E-06 2.91856E-08 9.90025E-06 6.30178E-08 2.58519E-07 7.47491E-08 2.07651E-06 6.22692E-06 188.3769472

AC C

K09770 K09776 K09774 K09775 K02624 K02240 K08282 K07637 K07639 K07638 K11068 K11063 K11066 K06902 K06903 K06905 K06907 K06908 K06909 K05905 K05900 K05903 K01406 K00368 K00367 K00365 K00362 K00363

0.055269763 0.71657857 0.507006063 0.199633174 0.978225001 0.050920281 0.978225001 0.978225001 0.978225001 0.910103102 0.923718258 0.978225001 0.978225001 0.487021349 0.184710198 0.978225001 0.978225001 0.483857176 0.138611146 0.884473701 0.630183515 0.786135578 0.358127228 0.197699759 0.560781892 0.877739844 0.978225001 0.840563972

ACCEPTED MANUSCRIPT

Supplementary Table S3b - KEGG L3 pathway differences between clusters

beta C3

qvalue cluster 0.001750212 0.0026475 0.001009181 0.000710888 0.000960161 0.000251012 0.000509746 0.000177645 0.000623273 0.000148617 0.000160843 0.000358952 0.000961088 0.003150988 7.0282E-05 0.000514101 0.000490759 0.000262782 0.000475876 0.000359205 0.000191697 0.000130283 0.000340635 0.000381615 0.000105132 0.000140435 3.62999E-05 4.61331E-05 0.00013967 0.000100048 0.000185281 0.000161684 6.19031E-05 1.20596E-05 8.27611E-06 -0.001228044 -0.00010468 -0.000453615 -0.001049675 -0.000630143 -0.00123524 -0.000368973 -0.000784666 -0.000316043 -9.76282E-05 -3.28551E-06 -0.000394609 -8.67937E-05 -0.000345772 -0.000638968 -0.000431468 -0.000337979 -7.60557E-05 -0.000468391 -0.000214708 -0.001067224 -5.394E-05 -0.000270853 -7.54576E-05 -0.000231186 -2.01328E-05 -2.01328E-05 -0.000196324 -0.000833317 -0.000154597 -0.000166412 -0.000143194 -0.000304852 -0.000203595 -0.000662541 -0.000121422 -0.000250368 -0.000101357 -0.000399049 -8.68926E-05 -0.000286148 -0.001518126 -0.000289804 -0.001065771 -0.001008445 -0.000573324 -0.000635297 -0.000597612 -0.000242787 -0.00011149 -0.001653479

RI PT

-0.002286872 -0.001687269 -0.001128925 -0.001100255 -0.000607639 -0.000587739 -0.000479091 -0.000451338 -0.000416589 -0.000394544 -0.000392338 -0.00037534 -0.000346079 -0.000276511 -0.000270116 -0.000255802 -0.000255524 -0.00024919 -0.00024361 -0.000209649 -0.000199809 -0.000180947 -0.00017739 -0.000174975 -0.000171464 -0.00016186 -7.26523E-05 -4.44415E-05 -3.85973E-05 -2.17054E-05 -1.76794E-05 -1.493E-05 -1.25289E-05 -4.40745E-06 -3.49851E-06 -0.000883547 -0.000778959 -0.0007594 -0.00054464 -0.000483002 -0.000454797 -0.00045035 -0.000401739 -0.000339815 -0.000275153 -0.000259083 -0.000254226 -0.000238288 -0.000215718 -0.000210676 -0.000195552 -0.000190811 -0.000166227 -0.000159129 -0.000130991 -0.000126492 -0.000103983 -9.5085E-05 -7.60961E-05 -7.17639E-05 -5.93573E-05 -5.93573E-05 -5.89804E-05 -5.64974E-05 -4.33805E-05 -2.45377E-05 -2.44362E-05 -2.10905E-05 -2.07378E-05 -2.00427E-05 -1.65726E-05 -1.57403E-05 -1.45554E-05 -1.29047E-05 -9.3392E-06 -3.13499E-06 0.001020674 0.000975796 0.000935013 0.000799098 0.000754516 0.000659269 0.000610849 0.000441257 0.000417854 0.000407593

M AN U

TE D

EP

AC C

beta C2 0.007145367 0.007666143 0.00402001 0.00282159 0.013686146 0.004012 0.013568755 0.007988422 0.007371863 0.004268183 0.004290979 0.005453323 0.009965107 0.016520512 0.001645789 0.004551834 0.012821982 0.006187483 0.007594163 0.008663578 0.001356857 0.001358393 0.002911482 0.008617102 0.001473424 0.002540332 0.000905629 0.000293962 0.000359795 0.000519475 0.002031753 0.001041033 0.000139063 1.83625E-05 1.33083E-05 0.010969878 0.015557055 0.012980786 0.010236643 0.009003876 0.011639702 0.018997714 0.002284988 0.010658286 0.004952599 0.006481264 0.005933374 0.005196944 0.006335123 0.003555696 0.002368999 0.002454354 0.001553691 0.006663301 0.001224589 0.03655882 0.001113327 0.001197354 0.000494952 0.000732098 0.000432525 0.000432525 0.002034125 0.010189023 0.001532747 0.000887723 0.000704718 0.000762498 0.001127161 0.006507102 0.000245502 0.00553645 0.000558434 0.004742488 0.000559414 0.000477944 0.003407169 0.011682489 0.00213763 0.013767872 0.021698418 0.007319851 0.00143706 0.006119797 0.001589146 0.015838046

SC

X.Intercept. Bacterial.motility.proteins Sporulation Bacterial.chemotaxis Flagellar.assembly Two.component.system Cytoskeleton.proteins Ribosome.Biogenesis Peptidoglycan.biosynthesis Replication..recombination.and.repair.proteins Photosynthesis Photosynthesis.proteins Glycerophospholipid.metabolism Secretion.system Transcription.factors Plant.pathogen.interaction Signal.transduction.mechanisms Methane.metabolism Butanoate.metabolism Valine..leucine.and.isoleucine.biosynthesis Lysine.biosynthesis RNA.transport Lipid.metabolism Protein.kinases Translation.proteins Tetracycline.biosynthesis Sulfur.relay.system Epithelial.cell.signaling.in.Helicobacter.pylori.infection Synthesis.and.degradation.of.ketone.bodies Germination Xylene.degradation Benzoate.degradation Biosynthesis.of.unsaturated.fatty.acids Atrazine.degradation Flavonoid.biosynthesis RIG.I.like.receptor.signaling.pathway Transcription.machinery Chromosome Arginine.and.proline.metabolism Chaperones.and.folding.catalysts Energy.metabolism Alanine..aspartate.and.glutamate.metabolism Peptidases Restriction.enzyme Pyruvate.metabolism Fatty.acid.biosynthesis Pantothenate.and.CoA.biosynthesis Lipid.biosynthesis.proteins Thiamine.metabolism One.carbon.pool.by.folate Streptomycin.biosynthesis Polyketide.sugar.unit.biosynthesis Riboflavin.metabolism Tuberculosis Histidine.metabolism Glutamatergic.synapse General.function.prediction.only Polycyclic.aromatic.hydrocarbon.degradation PPAR.signaling.pathway NOD.like.receptor.signaling.pathway Protein.processing.in.endoplasmic.reticulum Antigen.processing.and.presentation Progesterone.mediated.oocyte.maturation Vitamin.B6.metabolism Carbon.fixation.pathways.in.prokaryotes D.Glutamine.and.D.glutamate.metabolism Phosphatidylinositol.signaling.system Biosynthesis.of.vancomycin.group.antibiotics Adipocytokine.signaling.pathway Taurine.and.hypotaurine.metabolism Pentose.and.glucuronate.interconversions Proximal.tubule.bicarbonate.reclamation Glyoxylate.and.dicarboxylate.metabolism Type.I.diabetes.mellitus RNA.degradation Zeatin.biosynthesis Cellular.antigens Lipopolysaccharide.biosynthesis.proteins Function.unknown Lipopolysaccharide.biosynthesis Other.ion.coupled.transporters Purine.metabolism Nitrogen.metabolism Ubiquinone.and.other.terpenoid.quinone.biosynthesis Protein.folding.and.associated.processing Cell.motility.and.secretion Amino.sugar.and.nucleotide.sugar.metabolism

0.001323579 3.40306E-08 0.000170136 0.002642419 0.010413423 5.73795E-07 0.001738142 0.000102203 0.000285649 0.000904036 0.000827507 4.14375E-05 0.002849663 4.4643E-07 1.07381E-05 7.91316E-06 0.019240837 0.049637785 0.000392733 0.000270734 1.99094E-06 3.40306E-08 7.96548E-05 0.000480692 0.00443384 0.002764657 0.000794265 0.023388135 1.59571E-05 0.045072131 0.01723943 0.00016167 0.017517158 0.005541134 0.024229992 1.33568E-05 0.00138032 1.57308E-05 1.27455E-06 2.91487E-05 2.27928E-07 0.01972479 3.1995E-06 0.013188818 0.035812112 0.005289311 0.001359849 0.038869467 0.005169679 9.1714E-07 1.02117E-05 0.00029448 1.07664E-06 0.00351429 4.39444E-07 0.002958104 0.006740783 7.3582E-06 2.35641E-05 7.24659E-06 0.002411206 0.002411206 0.002152032 0.007218117 7.99258E-06 3.04817E-06 9.24936E-06 3.22137E-06 3.40306E-08 0.00592425 0.00029448 0.007121195 3.4058E-08 9.1714E-07 5.23113E-05 7.91316E-06 1.33481E-07 1.55931E-06 5.73795E-07 4.24672E-05 7.50309E-05 3.85601E-10 3.40306E-08 0.000375411 9.46931E-07 1.76346E-05

AC C

TE D

-0.000832067 -0.001913646 -0.001671469 -0.000301524 -0.000189774 -0.001092204 -0.000205916 -0.000146406 -0.000123966 -0.00029147 -0.002212337 -0.000378043 -8.99666E-05 -0.000861179 -0.001173775 -0.000181586 -7.86472E-05 -0.000167109 -5.98245E-05 -0.000652339 -0.000493255 -0.000157823 -0.000373969 -0.000239376 -0.000101913 -4.83965E-05 -0.001276736 -0.000270132 -0.000224185 -1.31257E-05 -4.7076E-05 -0.000150952 -0.000150668 -0.000682976 -0.00039584 -5.74187E-05 -8.22039E-05 -0.00039418 -7.47279E-05 -0.000101884 -0.000230606 -7.92529E-05 -0.000124824 -0.000110177 0.013710872 0.007324431 0.002309475 0.000171431 8.63749E-05 0.000168036 0.0001299 0.000103 0.000319449 1.07543E-05 4.56568E-05 0.000335637 0.000576761 1.54669E-05 7.46132E-05 1.61873E-05 2.28751E-05 2.1129E-06 0.000143562 3.61484E-05 4.66328E-05 2.07711E-05 4.20298E-05 9.38967E-05 0.000298713 4.00487E-06 2.51313E-05 7.3922E-09 -92.68359954 0.000154151 -0.00054846 -0.000322918 -0.000208383 0.000389133 0.000166948 -8.10176E-05 -0.000240216 -0.00013932 -5.18839E-05 -7.9889E-06 4.20077E-05 2.11031E-05 -0.000375926 -2.74069E-05 -0.000102856

SC

0.000368875 0.000336146 0.000284671 0.000263641 0.000201772 0.000192929 0.000188054 0.000182574 0.00018178 0.000166346 0.000158912 0.000139384 0.000132229 0.000120581 0.00011585 0.000109342 0.000101767 9.67876E-05 9.33944E-05 8.88652E-05 8.67007E-05 8.56408E-05 7.00697E-05 6.44043E-05 6.4391E-05 6.17779E-05 5.92332E-05 5.27075E-05 5.15905E-05 4.72682E-05 4.32794E-05 3.84989E-05 3.58726E-05 3.21947E-05 2.96311E-05 2.88418E-05 2.42334E-05 2.39372E-05 1.89419E-05 1.75958E-05 1.31516E-05 9.6974E-06 7.19086E-06 0.003587914 0.002469852 0.001752104 0.00059275 0.00033753 0.000287401 0.000181595 0.000125783 0.000115785 9.56341E-05 8.8578E-05 8.45302E-05 8.22142E-05 6.85958E-05 6.72289E-05 6.59336E-05 6.09979E-05 5.60724E-05 5.28582E-05 4.2351E-05 4.10611E-05 3.43038E-05 2.95123E-05 2.21881E-05 1.6502E-05 1.63776E-05 8.33704E-06 2.59582E-07 -381.0450869 -0.000477916 -0.00042236 -0.000297233 -0.000285926 -0.00025262 -0.000193953 -0.000174866 -0.000167202 -0.000138229 -0.000129295 -0.000106768 -0.000104569 -0.000100537 -7.28281E-05 -6.64136E-05 -6.26775E-05

M AN U

0.005640659 0.003813827 0.003670506 0.001869011 0.001687582 0.00202841 0.001555976 0.001282693 0.001972863 0.004530781 0.003315775 0.003645046 0.001149924 0.009115126 0.000260279 0.000507675 0.000324519 0.00023128 0.000811569 0.003269591 0.000311568 0.001798891 0.000294731 0.000288131 0.00021807 0.003286227 0.003056095 0.001937037 0.000109693 0.000205783 0.000665105 0.000972099 0.001543905 0.001843082 0.000233122 0.000801937 0.003003163 0.000102014 0.000463559 0.000306283 0.000591386 0.001799915 0.000457026 0.066052635 0.031867147 0.004146239 0.000990889 0.009570025 0.002046073 0.000373508 0.001060384 0.000821926 8.681E-05 8.29574E-05 0.001632621 0.003755832 3.17002E-05 0.000135188 2.93366E-05 0.000457665 0.00030046 0.001264747 3.14829E-05 3.72806E-05 2.89814E-05 7.60063E-05 0.000160359 0.00325092 9.47307E-06 1.78917E-05 3.29907E-08 387.1607158 0.022584556 0.0113985 0.012340238 0.014695922 0.011155221 0.011312446 0.005735433 0.018275107 0.0091776 0.004201792 0.000933919 0.002075579 0.004813607 0.011408295 0.000749838 0.005367936

RI PT

ACCEPTED MANUSCRIPT 0.005997865 0.000397167

EP

Citrate.cycle..TCA.cycle. Membrane.and.intracellular.structural.molecules Pores.ion.channels Folate.biosynthesis Inorganic.ion.transport.and.metabolism Lysosome Valine..leucine.and.isoleucine.degradation Biotin.metabolism Bacterial.toxins Phenylpropanoid.biosynthesis Other.glycan.degradation Cyanoamino.acid.metabolism Selenocompound.metabolism Glycosaminoglycan.degradation Galactose.metabolism Pertussis MAPK.signaling.pathway...yeast Lipoic.acid.metabolism Huntington.s.disease Glycosphingolipid.biosynthesis...ganglio.series Glycosyltransferases Geraniol.degradation Peroxisome Steroid.hormone.biosynthesis Penicillin.and.cephalosporin.biosynthesis N.Glycan.biosynthesis Sphingolipid.metabolism Prenyltransferases Phenylalanine.metabolism Ion.channels Biosynthesis.of.siderophore.group.nonribosomal.peptides Phosphonate.and.phosphinate.metabolism Inositol.phosphate.metabolism Glycosphingolipid.biosynthesis...globo.series Glutathione.metabolism Glycan.biosynthesis.and.metabolism Cell.division Sulfur.metabolism Ubiquitin.system Primary.bile.acid.biosynthesis Protein.digestion.and.absorption Isoquinoline.alkaloid.biosynthesis beta.Alanine.metabolism Secondary.bile.acid.biosynthesis Transporters ABC.transporters Phosphotransferase.system..PTS. Ascorbate.and.aldarate.metabolism Cysteine.and.methionine.metabolism Amino.acid.metabolism Nucleotide.metabolism Tryptophan.metabolism Nitrotoluene.degradation Amyotrophic.lateral.sclerosis..ALS. Caprolactam.degradation Chloroalkane.and.chloroalkene.degradation Glycerolipid.metabolism Renal.cell.carcinoma Electron.transfer.carriers D.Arginine.and.D.ornithine.metabolism Primary.immunodeficiency beta.Lactam.resistance Biosynthesis.of.ansamycins Prion.diseases Non.homologous.end.joining Transcription.related.proteins Chlorocyclohexane.and.chlorobenzene.degradation Styrene.degradation C5.Branched.dibasic.acid.metabolism Chagas.disease..American.trypanosomiasis. Ether.lipid.metabolism Shigellosis p53.signaling.pathway Ribosome Starch.and.sucrose.metabolism DNA.replication.proteins Amino.acid.related.enzymes Aminoacyl.tRNA.biosynthesis Glycolysis...Gluconeogenesis Terpenoid.backbone.biosynthesis Pyrimidine.metabolism Homologous.recombination Nicotinate.and.nicotinamide.metabolism Insulin.signaling.pathway Fatty.acid.metabolism Propanoate.metabolism Oxidative.phosphorylation Butirosin.and.neomycin.biosynthesis Bacterial.secretion.system

0.000827507 1.04252E-06 1.33481E-07 3.32124E-05 0.000269388 3.0341E-06 0.000517357 7.3582E-06 1.04252E-06 0.029449935 1.69195E-06 0.014843807 0.004490412 7.7969E-06 1.04252E-06 1.02868E-07 6.71292E-06 7.91316E-06 0.002907619 3.22137E-06 3.19552E-05 1.78233E-06 1.09459E-05 1.99094E-06 0.000115224 1.73499E-05 1.78233E-06 0.000426609 0.000677338 0.007218117 0.007899004 7.91316E-06 0.000930278 1.59902E-05 3.31308E-06 0.029426826 0.007218117 2.22135E-06 1.74061E-06 0.000375411 5.73795E-07 0.007504555 0.045320532 0.000145579 3.05004E-06 2.79477E-06 7.99258E-06 3.40306E-08 0.030406235 0.00624151 2.29055E-05 0.037992947 0.000164238 2.74811E-06 3.41324E-05 0.000434194 3.12364E-05 6.71603E-06 0.010158668 6.59514E-10 0.01972479 0.02014087 0.024229992 9.30472E-07 0.000923266 0.019972449 0.002939902 0.00011797 0.000164238 0.049151957 0.001998825 0.049151957 0.62330077 0.451398564 0.123748175 0.128165659 0.157168692 0.071242697 0.113566915 0.152654916 0.466563046 0.451398564 0.098265705 0.0752042 0.127732248 0.451398564 0.44613973 0.157168692 0.691451133

EP

AC C

3.04873E-05 -4.19918E-05 6.09903E-05 -6.11833E-07 -8.37887E-05 -1.90597E-05 -9.88966E-05 -3.79823E-05 2.1265E-05 -4.56208E-06 -5.05618E-05 -3.56249E-06 4.38212E-05 4.97886E-06 -9.95198E-06 -2.48996E-05 -1.17968E-06 -1.17968E-06 -1.17968E-06 -1.17968E-06 -1.17968E-06 1.48644E-05 -3.55389E-06 -3.66898E-05 2.04121E-06 1.4643E-06 -2.54922E-06 6.58724E-07 6.60563E-07 6.56243E-07 -5.00957E-07 6.91383E-07 -1.76451E-05 -1.10522E-08 -4.57146E-08 6.97652E-09 6.35262E-09 6.35262E-09 -3.23845E-09 4.34088E-09 3.87474E-09 -2.43143E-08 -4.05697E-09 -1.08397E-08 3.57948E-08 5.46608E-07 2.16831E-06 1.24881E-08 7.43618E-06 5.88106E-07 -6.15778E-07 2.1708E-06 6.88394E-06 8.26086E-06 1.29579E-05 6.03282E-06 9.92635E-08 -0.000214031 3.32912E-05 -0.000120665 1.38761E-05 -1.21069E-05 -6.24754E-05 4.67872E-06 2.17009E-06 5.63073E-05 -5.79614E-05 8.64983E-05 1.92296E-05 -1.71049E-05 -3.2834E-05 1.01682E-05 -2.94077E-05 2.83179E-05 9.06071E-05 0.000154418 7.93242E-05 -0.000186452 1.91973E-05 -0.00012872 0.000100307 4.33336E-05 -0.000110967 -6.49069E-05 -9.92127E-05 0.000466543 0.00025018 1.26484E-05 0.000346377

SC

-4.01795E-05 -3.94454E-05 -3.21809E-05 -3.13165E-05 -2.86422E-05 -2.66982E-05 -2.56852E-05 -2.31927E-05 -1.92917E-05 -1.56389E-05 -1.44662E-05 -1.1415E-05 -1.00768E-05 -7.47505E-06 -6.7959E-06 -4.84344E-06 -4.84344E-06 -4.84344E-06 -4.84344E-06 -4.84344E-06 -3.66404E-06 -2.86201E-06 -2.83595E-06 -2.02427E-06 -1.71949E-06 -1.41136E-06 -5.61574E-07 -5.59714E-07 -5.53812E-07 -5.5209E-07 -5.20702E-07 -3.35588E-07 -1.07765E-08 -5.45091E-09 2.42889E-12 1.54056E-11 1.54056E-11 6.43531E-10 9.30704E-09 1.09338E-08 3.61084E-08 3.83822E-08 6.2391E-08 6.70307E-08 2.40655E-07 4.96115E-07 5.24601E-07 8.6988E-07 1.11653E-06 1.90351E-06 3.45493E-06 4.21094E-06 5.44905E-06 5.78748E-06 6.17074E-06 6.39292E-06 6.89943E-06 7.71605E-06 8.63247E-06 1.06479E-05 1.08328E-05 1.22061E-05 1.69626E-05 1.79653E-05 2.12978E-05 3.15305E-05 3.21058E-05 3.33558E-05 3.34918E-05 4.03216E-05 4.03883E-05 4.49851E-05 4.50205E-05 4.85593E-05 5.31022E-05 5.44821E-05 5.62496E-05 6.43963E-05 7.25749E-05 9.68815E-05 0.000112211 0.000125915 0.000140726 0.000198578 0.000224516 0.000367713 0.000398342 0.000541185

M AN U

0.000458433 0.003127437 0.000466624 0.005186291 0.000445137 0.002788868 0.00022548 0.000680594 1.99398E-05 0.000379833 1.50371E-05 0.001009396 0.000163187 1.37373E-05 0.000181149 4.91857E-06 4.91857E-06 4.91857E-06 4.91857E-06 4.91857E-06 0.000164169 3.56501E-06 7.87391E-05 2.90973E-06 4.06262E-06 0.001359025 1.25759E-06 1.25892E-06 1.27712E-06 6.09204E-07 1.29079E-06 0.000473844 7.06265E-08 9.12121E-08 2.85673E-09 2.84354E-09 2.84354E-09 4.64357E-09 5.63364E-09 7.26593E-09 1.18309E-07 4.29142E-08 2.17802E-08 4.50821E-08 2.18284E-06 5.21055E-06 3.61592E-08 5.25471E-06 7.81456E-07 4.07257E-06 4.68098E-06 9.81998E-05 1.58766E-05 0.000452293 0.001236149 1.58526E-05 0.006886919 0.001519058 0.00338159 2.79789E-05 0.000467922 0.000670879 1.1727E-05 1.42543E-05 0.003777363 0.001199604 0.000548091 0.004948853 8.14791E-05 0.00104839 3.97046E-05 0.000794416 0.001131892 0.007994861 0.008536479 0.000651938 0.008390552 0.000918221 0.005860932 0.004134244 0.000980061 0.00639077 0.002025485 0.000937295 0.01029675 0.009418068 0.009080648 0.010574289

RI PT

ACCEPTED MANUSCRIPT 0.02752318 -4.0183E-05

TE D

DNA.repair.and.recombination.proteins Prostate.cancer Tyrosine.metabolism Alzheimer.s.disease Translation.factors Proteasome Other.transporters Retinol.metabolism Vibrio.cholerae.pathogenic.cycle Parkinson.s.disease Ethylbenzene.degradation Cardiac.muscle.contraction D.Alanine.metabolism Metabolism.of.xenobiotics.by.cytochrome.P450 Apoptosis Arachidonic.acid.metabolism Colorectal.cancer Influenza.A Small.cell.lung.cancer Toxoplasmosis Viral.myocarditis Drug.metabolism...cytochrome.P450 Glycosphingolipid.biosynthesis...lacto.and.neolacto.series Flavone.and.flavonol.biosynthesis Basal.transcription.factors Steroid.biosynthesis Novobiocin.biosynthesis Fatty.acid.elongation.in.mitochondria Caffeine.metabolism Circadian.rhythm...plant Bile.secretion Systemic.lupus.erythematosus Pathways.in.cancer Vasopressin.regulated.water.reabsorption G.protein.coupled.receptors Fc.gamma.R.mediated.phagocytosis Endocytosis GnRH.signaling.pathway Renin.angiotensin.system Melanogenesis Betalain.biosynthesis Various.types.of.N.glycan.biosynthesis Biosynthesis.of.type.II.polyketide.products Vibrio.cholerae.infection Calcium.signaling.pathway Bladder.cancer Stilbenoid..diarylheptanoid.and.gingerol.biosynthesis Pathogenic.Escherichia.coli.infection Fluorobenzoate.degradation Photosynthesis...antenna.proteins Bacterial.invasion.of.epithelial.cells X1.1.1.Trichloro.2.2.bis.4.chlorophenyl.ethane..DDT..degradation Carbohydrate.digestion.and.absorption Carotenoid.biosynthesis Ribosome.biogenesis.in.eukaryotes Naphthalene.degradation alpha.Linolenic.acid.metabolism Carbon.fixation.in.photosynthetic.organisms RNA.polymerase Drug.metabolism...other.enzymes Mineral.absorption Type.II.diabetes.mellitus Biosynthesis.and.biodegradation.of.secondary.metabolites African.trypanosomiasis Meiosis...yeast Nucleotide.excision.repair Tropane..piperidine.and.pyridine.alkaloid.biosynthesis Dioxin.degradation Cell.cycle...Caulobacter Amoebiasis Aminobenzoate.degradation Staphylococcus.aureus.infection Linoleic.acid.metabolism Lysine.degradation Mismatch.repair Phenylalanine..tyrosine.and.tryptophan.biosynthesis Limonene.and.pinene.degradation Glycine..serine.and.threonine.metabolism Bisphenol.degradation Protein.export Base.excision.repair Metabolism.of.cofactors.and.vitamins DNA.replication Carbohydrate.metabolism Toluene.degradation Porphyrin.and.chlorophyll.metabolism Pentose.phosphate.pathway Others Fructose.and.mannose.metabolism

0.989844879 0.127310086 0.451398564 0.520654949 0.589717473 0.131841213 0.112804874 0.347046895 0.090633048 0.672713791 0.152654916 0.671508254 0.075527367 0.857412013 0.127310086 0.718971494 0.671508254 0.671508254 0.671508254 0.671508254 0.671508254 0.774646829 0.2648262 0.077289069 0.266633031 0.807599184 0.993144112 0.720069575 0.720069575 0.720407107 0.451398564 0.716203785 0.684290099 0.915767509 0.774646829 0.125696592 0.167161933 0.167161933 0.691451133 0.439696269 0.366123665 0.80612544 0.660654613 0.157168692 0.44613973 0.961945556 0.718271012 0.098265705 0.397131345 0.451398564 0.62330077 0.412973855 0.957000005 0.366872076 0.372924408 0.992679255 0.766209778 0.054108794 0.602622048 0.19557642 0.395877684 0.44613973 0.152674969 0.053617126 0.129986136 0.589717473 0.050476733 0.134999957 0.914316829 0.108605233 0.451879066 0.051558849 0.366872076 0.581127286 0.757744203 0.659993147 0.056003538 0.125696592 0.387673487 0.202035008 0.053179124 0.075142638 0.247080688 0.108605233 0.129295621 0.430590305 0.054601747 0.081320347 0.24196556

MANUSCRIPT Supplementary Table S3c - KEGG L2 ACCEPTED pathway differences between clusters

M AN U

SC

RI PT

X.Intercept. beta C2 beta C3 q value 0.015208983 0.000381667 -0.001499446 7.33864E-09 0.029478982 -0.001135971 0.002336736 1.56256E-08 0.001904206 0.000228796 -0.000458228 3.30303E-08 0.001243662 -0.000132454 -0.000216688 2.44018E-07 0.025403024 0.002183045 -0.007287016 2.78476E-07 0.11911991 0.007702044 0.024876359 1.57946E-06 0.003541999 0.000292655 -0.001470026 1.57946E-06 0.025050681 -0.000723487 -0.001783383 3.18591E-06 0.010249531 0.000114617 -0.001241893 4.77364E-06 0.001671784 -0.000273185 7.69098E-05 6.62256E-06 0.00337705 -0.000285578 -0.000648556 9.04982E-06 0.0489898 0.000895787 -0.001432366 1.14051E-05 0.001042894 -2.90384E-06 -0.000115378 2.34357E-05 0.016600765 -0.000262098 -0.000869565 4.81141E-05 0.00095509 -0.000140413 -8.74798E-05 8.05871E-05 0.00024944 -1.67854E-05 -0.000123193 0.000251433 0.018271564 -0.005164139 0.003783128 0.00026798 0.00043966 3.39112E-05 -0.000217048 0.00026798 0.022249225 -0.000624629 -7.53794E-06 0.001175013 0.00361935 -6.80293E-05 -0.000208613 0.001175013 0.044962301 0.000240303 -0.001945746 0.001216355 0.114479373 0.001057146 -0.004654115 0.002434096 0.099599199 -0.001317945 -0.001996449 0.00308529 0.043692729 0.000234599 -0.001766484 0.003276056 0.029461188 -0.000781794 -0.001015886 0.004898732 0.000465574 6.23478E-05 2.6627E-05 0.012233161 0.06113373 -0.000464449 -0.00166641 0.019967234 0.040595777 0.000618768 -0.000779529 0.019967234 1319705.848 108806.3836 602547.3678 0.021128707 0.015316387 -0.000524799 0.00075324 0.032087465 0.055132221 -0.001411149 0.001304322 0.043829303 0.000995568 1.49584E-05 -5.90879E-05 0.420673931 4.99544E-06 -4.9166E-06 -1.2048E-06 0.643396479 0.005057189 4.19513E-05 2.57673E-05 0.858366078 1.52623E-05 -1.46823E-05 -3.61556E-06 0.643396479 0.026007633 -0.000435254 0.00020385 0.196802399 0.024975604 0.000565193 -0.000459369 0.073141178 0.000816434 0.000216265 1.39018E-05 0.056388195 0.088250225 -0.000859124 -8.30837E-05 0.712440619

AC C

EP

TE D

Metabolism.of.Other.Amino.Acids Transcription Signaling.Molecules.and.Interaction Nervous.System Glycan.Biosynthesis.and.Metabolism Membrane.Transport Transport.and.Catabolism Folding..Sorting.and.Degradation Biosynthesis.of.Other.Secondary.Metabolites Environmental.Adaptation Endocrine.System Poorly.Characterized Metabolic.Diseases Metabolism.of.Terpenoids.and.Polyketides Immune.System Excretory.System Cell.Motility Digestive.System Enzyme.Families Infectious.Diseases Metabolism.of.Cofactors.and.Vitamins Carbohydrate.Metabolism Amino.Acid.Metabolism Cellular.Processes.and.Signaling Lipid.Metabolism Immune.System.Diseases Energy.Metabolism Nucleotide.Metabolism Xenobiotics.Biodegradation.and.Metabolism Signal.Transduction Translation Cancers Cardiovascular.Diseases Cell.Growth.and.Death Circulatory.System Genetic.Information.Processing Metabolism Neurodegenerative.Diseases Replication.and.Repair

MANUSCRIPT Supplementary Table S3d - KEGG L1 ACCEPTED pathway differences between clusters X.Intercept. 0.030770482 0.155985698 0.007986211 0.566806317 0.002239169 0.009119837 0.226471216 12169784.97

beta C2 beta C3 qvalue -0.005545818 0.002454007 0.001024065 0.008629563 0.027659487 1.48643E-06 0.000228428 -0.00051083 0.0038345 0.002922469 -0.026470165 1.37251E-07 -0.000235836 0.000237315 1.22929E-07 -0.000955654 -0.001457619 3.56791E-07 -0.004478343 0.000752355 0.082109107 614420.3152 4083625.161 0.082109107

AC C

EP

TE D

M AN U

SC

RI PT

Cellular.Processes Environmental.Information.Processing Human.Diseases Metabolism None Organismal.Systems Genetic.Information.Processing Unclassified