Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs

Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs

G Model ARTICLE IN PRESS YPHRS 2761 1–10 Pharmacological Research xxx (2014) xxx–xxx Contents lists available at ScienceDirect Pharmacological Re...

1MB Sizes 0 Downloads 7 Views

G Model

ARTICLE IN PRESS

YPHRS 2761 1–10

Pharmacological Research xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs

Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs

1

2

3

4 5 6 7

Q1

Venkata V.V.R. Marada a,1 , Saskia Flörl b,1 , Annett Kühne b,2 , Judith Müller a,3 , Gerhard Burckhardt a,4 , Yohannes Hagos a,b,∗ a b

Institut für Vegetative Physiologie und Pathophysiologie, Universitätmedizin Göttingen, Humboldtallee 23, 37073 Göttingen, Germany PortaCellTec Biosciences GmbH, Humboldtallee 23, 37073 Goettingen, Germany

8

9 36

a r t i c l e

i n f o

a b s t r a c t

10 11 12 13 14 15

Article history: Received 21 July 2014 Received in revised form 23 October 2014 Accepted 13 November 2014 Available online xxx

16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

Chemical compounds studied in this article: Cyclic GMP (PubChem CID: 24316) Estrone 3-sulfate (PubChem CID: 3001028) Bendamustine (PubChem CID: 65628) Irinotecan (PubChem CID: 60838) Paclitaxel (PubChem CID: 36314) Chlorambucil (PubChem CID: 2708) Etoposide (PubChem CID: 3310) 5 fluorouracil (PubChem CID: 3385) Gemcitabine (PubChem CID: 60750) Vincristine (PubChem CID: 5978) Keywords: Cancer chemotherapy Antineoplastic compounds Uptake transporter proteins Drug transporter interactions Organic anion transporter 2 (OAT2) Sodium taurocholate cotransporting polypeptide (NTCP)

The ability of an antineoplastic drug to exert its cytostatic effect depends largely on the balance between its uptake into and extrusion from the cancer cells. ATP driven efflux transporter proteins drive the export of antineoplastic drugs and play a pivotal role in the development of chemoresistance. As regards uptake transporters, comparably less is known on their impact in drug action. In the current study, we characterized the interactions of two uptake transporter proteins, expressed mainly in the liver; the organic anion transporter 2 (OAT2, encoded by the SLC22A7 gene) and the sodium taurocholate cotransporting polypeptide (NTCP, encoded by the SLC10A1 gene), stably transfected in human embryonic kidney cells, with some antineoplastic agents that are routinely being used in cancer chemotherapy. Whereas NTCP did not show any strong interactions with the cytostatics tested, we observed a very strong inhibition of OAT2 mediated [3 H] cGMP uptake in the presence of bendamustine, irinotecan and paclitaxel. The Ki values of OAT2 for bendamustine, irinotecan and paclitaxel were determined to be 43.3 ± 4.33 ␮M, 26.4 ± 2.34 ␮M and 10.4 ± 0.45 ␮M, respectively. Incubation of bendamustine with OAT2 expressing cells increased the caspase-3 activity, and this increase was inhibited by simultaneous incubation with bendamustine and probenecid, a well-known inhibitor of OATs, suggesting that bendamustine is a substrate of OAT2. A higher accumulation of irinotecan was observed in OAT2 expressing cells compared to control pcDNA cells by HPLC analysis of cell lysates. The accumulation was diminished in the presence of cGMP, the substrate we used to functionally characterize OAT2, suggesting specificity of this uptake and the fact that OAT2 mediates uptake of irinotecan. © 2014 Elsevier Ltd. All rights reserved.

Introduction

37

Q3 ∗ Corresponding author at: Institut für Vegetative Physiologie und Q2 Pathophysiologie, Universitätmedizin Göttingen, Humboldtallee 23, 37073 Göttingen, Germany. Tel.: +49 551395894; fax: +49 551395883. E-mail addresses: [email protected] (V.V.V.R. Marada), fl[email protected] (S. Flörl), [email protected] (A. Kühne), [email protected] (J. Müller), [email protected] (G. Burckhardt), [email protected] (Y. Hagos). 1 Tel.: +49 551395909; fax: +49 551395883. 2 Tel.: +49 551395894; fax: +49 551395883. 3 Tel.: +49 551395903; fax: +49 551395883. 4 Tel.: +49 551395881; fax: +49 551395883.

Liver is the organ concerned with modification and excretion of endogenous as well as exogenous substances including drugs. Hepatic excretion of drugs invariably involves their absorption from the sinusoidal blood into the hepatocytes wherein they are metabolized and converted to a nontoxic or conjugated form which is excreted. The whole process involves the transport of these compounds into the hepatocyte by uptake transporter proteins, and pumping out of these compounds into the bile by efflux transporter proteins. There is a difference between the mechanisms by which these two systems operate; the efflux transporters belonging to the ABC (ATP binding cassette) transporter family of proteins

http://dx.doi.org/10.1016/j.phrs.2014.11.002 1043-6618/© 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

38 39 40 41 42 43 44 45 46 47 48

G Model YPHRS 2761 1–10

V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

2 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105

drive out the drugs using energy generated by the hydrolysis of ATP whereas transport of substrates by the influx transporter proteins does not directly involve the hydrolysis of ATP. The efflux transporter proteins have been a major issue owing to their ability to provide chemo-resistance to cells by flushing out antineoplastic drug molecules entering the cell. However, the role of uptake transport proteins in delivering antineoplastic drugs into the cell has not been looked into in that detail. The uptake transporter proteins belong to a vast superfamily of proteins referred to as the SLC (solute carrier) superfamily which is further classified into 53 families, containing almost 400 genes [1]. The current work deals with two proteins expressed in the sinusoidal membrane of hepatocytes. The organic anion transporter 2 (OAT2), encoded by the gene SLC22A7, is involved in the transport of various organic substances of both endogenous and exogenous origin in a sodium independent manner. It has been shown to be expressed predominantly in liver, and to a lesser extent in kidney, lung and various other tissues in humans [2,3]. Its substrates include many endogenous substances like cGMP, estrone 3-sulfate, dehydroepiandrosterone sulfate, prostaglandin E2, purine analogs, glutamate, orotic acid, uric acid, and exogenous substrates including tetracycline, antiviral compounds like acyclovir, ganciclovir, zidovudine, and paclitaxel among others [4–8]. The sodium taurocholate cotransporting polypeptide (NTCP) encoded by the gene SLC10A1 is exclusively expressed in hepatocytes. NTCP is mainly involved in the sodium dependent uptake of bile acids and thus in the enterohepatic circulation [9]. Other than bile acids, its substrates include thyroid hormones, estrone 3sulfate and drugs like rosuvastatin, pitavastatin [10–12]. A recent report implicated NTCP as the receptor for Hepatitis B and Hepatitis D viruses, undermining its clinical importance, and hence an inhibitor of NTCP is of high clinical relevance [13]. Here we tested several antineoplastic drugs that are routinely used in the treatment of cancer including alkylating agents (melphalan, bendamustine, chlorambucil, cyclophosphamide, trofosfamide, ifosfamide, busulfan, treosulfan and thio TEPA), antimetabolites (methotrexate, cytosinarabinoside, gemcitabine, 5 fluorouracil, flouroadenine, cladribine and fludarabine), intercalating agents (doxorubicin and mitoxantrone), topoisomerase inhibitors (irinotecan and etoposide), mitotic inhibitors (vinblastine, vincristine and paclitaxel) and those having hormone receptors as targets (tamoxifen, prednisone and clodronic acid). Many of these compounds are being used either alone or in combination as front line drugs in chemotherapy of various cancers, such as melphalan in treating multiple myeloma and retinoblastoma [14,15], bendamustine in chronic lymphocytic leukemia and Non-Hodgkin Lymphoma [16], gemcitabine and paclitaxel in various combinations in treating pancreatic cancer [17,18]. The ability of these antineoplastic drugs to inhibit the uptake of a model radiolabeled substrate is used as a criterion for its interaction with the transporter protein. Based on this criterion we selected antineoplastic drugs strongly interacting with the transporter proteins of our interest and, in further experiments, we attempted to ascertain whether the cytostatic in question is a substrate of the corresponding transporter protein.

106

Materials and methods

107

Reagents

108 109 110

ARTICLE IN PRESS

All the antineoplastic drugs were supplied by the pharmacy of the University Medical Center, Goettingen. [3 H] labeled cGMP and [3 H] estrone 3-sulfate were purchased from Perkin Elmer (Rodgau,

Germany). Quantum 286 medium, Hanks balanced salt solution, penicillin, streptomycin and hygromycin B were obtained from PAA (Pasching, Austria), HEPES buffer, trypsin and PBS were obtained from Biochrom (Berlin, Germany). FCS was obtained from Gibco (Eggenstein, Germany). Irinotecan (HPLC grade), methanol and tetra butyl ammonium hydrogen sulfate (TBAHS) were obtained from Sigma–Aldrich (Munich, Germany) and camptothecin was obtained from TCI (Eschborn, Germany).

Cloning and expression of OAT2 and NTCP in human embryonic kidney (HEK 293) cells Human OAT2 (GenBank accession no. NM 153320) pEF5/FRT/V5-DEST expression clone was obtained from Resource Center for Genome Research (RZPD, Berlin, Germany). As this splice variant of hOAT2 is not functional [4], we deleted the six base pair insertion between exon 1 and 2 by QuikChange PCR Site-Directed Mutagenesis (Stratagene) to obtain the functional hOAT2 splice variant with the GenBank accession no. NM 006672. For this purpose, we used the primers hOAT2 del6 for CCTCTACCATTGCAACTGAGTGGGATCTGGTGTGTGAGC and hOAT2 del-6 rev GCTCACACACCAGATCCCACTCAGTTGCAATGGTAGAGG. Human NTCP in the pcDNA5/FRT vector was received from Dr. J. Geyer, Institute of Pharmacology and Toxicology, Justus-Liebig-University, Giessen, Germany. To generate stable human embryonic kidney (HEK) cell lines the Flp-In system (Life Technologies, Darmstadt, Germany) was used as described previously [19]. Flp-In cells were seeded at a density of 6 × 105 cells per well in a six-well tissue culture plate and incubated overnight. The following day cells were transfected with 0.35 ␮g cDNA, 3 ␮g pOG44 and 10 ␮l Lipofectamin 2000 (Life Technologies, Darmstadt, Germany) per well in serum-free media and incubated for five hours. One day after transfection, cells were transferred to a 10-cm culture plate and selected for stable transfectants by addition of hygromycin B (175 ␮g/ml). After two weeks, single colonies were picked and expanded.

Initial characterization of OAT2 and NTCP transporter activity HEK293 cells carrying the vector alone (pcDNA), OAT2 plasmid (OAT2) or NTCP plasmid (NTCP) were seeded at a density of 2 × 105 cells per well in poly-l-lysine coated 24 well plates and grown for 72 h in Quantum 286 medium containing penicillin and streptomycin. In experiments involving NTCP, the protein expression was induced by the addition of tetracycline (1 ␮g/ml) 24 h prior to experiment. After 72 h, the cells were washed thrice with PBS and incubated in Hanks buffer (pH 7.4) containing Hanks balanced salt solution and 20 mM HEPES buffer. Time course experiments for OAT2 mediated uptake of cGMP were performed with Hanks buffer containing 10 nM of [3 H] cGMP mixed with 990 nM of cold cGMP and the uptake was measured over a period of 30 min at 37 ◦ C. Time course experiments for NTCP mediated uptake of estrone 3-sulfate were measured in Hanks buffer containing 20 nM [3 H] estrone 3-sulfate mixed with 980 nM of cold estrone 3-sulfate over a period of 30 min at 37 ◦ C. The uptake was terminated by washing thrice with ice cold PBS followed by complete lysis of cells with 750 ␮l of 1 N NaOH for 1 h. The lysates were transferred to scintillation vials and 2.5 mL of Rotiszint eco plus scintillation solution (Carl Roth, Karlsruhe, Germany) was added and mixed well. The counts were obtained from the liquid scintillation counter TriCarb 2910TR (Perkin Elmer, Rodgau, Germany). Data was analyzed using Microsoft Excel and SigmaPlot 11.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

111 112 113 114 115 116 117 118

119 120

121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144

145

146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170

G Model YPHRS 2761 1–10

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

171 172

Concentration dependent uptake of substrates and the affinity constants

183

To determine the affinity of OAT2 for cGMP the Michaelis–Menten constant (Km ) value was calculated, the transport was performed with Hanks buffer containing 10 nM of [3 H] cGMP mixed with increasing amounts of cold cGMP amounting to a range of final concentrations of cGMP from 1 ␮M to 750 ␮M for 5 min at 37 ◦ C. In case of NTCP mediated uptake of estrone 3-sulfate, a Km value was determined using 20 nM [3 H] estrone 3-sulfate mixed with increasing concentrations of cold estrone 3-sulfate yielding a total concentration in the range of 0.1–500 ␮M for 3 min at 37 ◦ C. The samples were processed as mentioned above.

184

Cis-inhibition of transporter activity by antineoplastic agents

173 174 175 176 177 178 179 180 181 182

203

Cis-inhibition experiments were carried out by measuring the uptake of labeled substrate in the presence of 100 ␮M of antineoplastic drugs. 2 × 105 cells of pcDNA-HEK and OAT2-HEK cells were seeded in 24 well plates and grown for 72 h in Quantum 286 medium (PAA) containing penicillin and streptomycin. After 72 h, the cells were washed thrice with PBS and incubated in Hanks buffer solution. Inhibition of OAT2 mediated cGMP uptake by antineoplastic drugs was measured from the experiment performed with Hanks buffer containing 10 nM of [3 H] cGMP mixed with 990 nM of cold cGMP with or without 100 ␮M of the respective cytostatic for 5 min. Similarly, inhibition potencies of the antineoplastic drugs to inhibit the NTCP mediated uptake of estrone 3-sulfate were determined from uptake experiments in Hanks buffer containing 20 nM [3 H] estrone 3-sulfate mixed with 19.98 ␮M cold estrone 3-sulfate in the presence or absence of any cytostatic for 3 min. Data are represented as percentage of buffer control, where no cytostatic was added. Statistical significance of the uptake was obtained by performing the paired samples Student’s t-test.

204

Dixon plot analysis

185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202

205 206 207 208 209 210 211

212 213

214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229

For Dixon plot analysis, the transport was performed at two different concentrations of cGMP; 1 ␮M (10 nM [3 H] labeled cGMP and 990 nM cold cGMP) and 10 ␮M cGMP (10 nM [3 H] labeled cGMP and 9.99 ␮M cold cGMP) in the presence of increasing concentrations of the respective cytostatic. The concentration range used for bendamustine and irinotecan was 0–130 ␮M, and for paclitaxel in the range of 0–20 ␮M. Apoptosis assay for evaluating OAT2-mediated uptake of bendamustine Apoptosis assay was performed using the EnzChek Caspase 3Assay kit purchased from Life Technologies GmbH (Darmstadt, Germany) as per the manufacturer’s protocol with some modifications. 2 × 105 cells were seeded in 24 well plates and grown for 72 h in medium. They were incubated further with 100 ␮M bendamustine in the culture medium for 12 h alone or in combination with 100 ␮M probenecid, an inhibitor of OAT2. Cells were washed in PBS, trypsinised and pelleted from the spent medium, PBS wash fraction, trypsinized fraction and pooled together to avoid possible loss of any cells. They were lysed in 50 ␮l of lysis buffer and subjected to a freeze thaw cycle with 5 min incubation in liquid nitrogen. After a spin at 5000 rpm for 5 min, the supernatant was collected. 40 ␮l of this supernatant was added to the substrate and incubated for 20 min in a dark place. The remaining 10 ␮l was used for protein concentration determination by the Bradford method. Fluorescence was measured in 80 ␮l of the 1:10 diluted product

3

in a multi-plate reader Mithras LB 940 (Berthold, Bad Wildbad, Germany). The relative fluorescence units (RFU) were normalized to protein concentrations obtained from Bradford estimation and the data is represented as % caspase-3 activity wherein the RFU obtained with untreated pcDNA cells was taken as 100%. HPLC analysis of OAT2-mediated irinotecan uptake 3 × 106 cells were seeded in poly l-lysine coated plates and allowed to grow to confluency. Cells were washed with PBS thrice and incubated with Hanks buffer solution containing 100 ␮M irinotecan or in a mixture of 100 ␮M irinotecan and 100 ␮M cGMP in a 37 ◦ C water bath for 5 min. The transport was terminated by placing the plates in ice cold water and then aspirating the buffer followed by three washes with ice-cold PBS. The cells were scrapped using 1 mL of the mobile phase (40% methanol: 60% 0.1 M ammonium acetate and 0.01 M TBAHS pH 5.5) containing 20 ␮M of the internal standard, camptothecin. The cell suspensions were lysed by sonication. 20 ␮L of the lysates was separated for protein estimation and the rest was centrifuged at 13,000 rpm at 4 ◦ C for 20 min. The supernatants were filtered through 0.2 ␮M syringe filters and subjected to HPLC analysis using a Zorbax Eclipse XDB-C8 column (Agilent technologies, Boeblingen, Germany) with 5 ␮L injections. Irinotecan (CPT-11) and camptothecin (CPT) were detected by fluorescence with excitation maximum of 355 nM and emission maximum of 515 nM in a mobile phase containing 40% methanol: 60% 0.1 M ammonium acetate and 0.01 M TBAHS pH 5.5 as described previously [19]. Standard curves were plotted using increasing concentrations of the pure compounds irinotecan and camptothecin. Software for molecular analysis MarvinSketch (version 14.7.28.0), 2014, from ChemAxon (https://www.chemaxon.com) was used to determine the molecular characteristics for the antineoplastic compounds used in the study. Determination of protein concentration The Bradford assay was used to determine protein concentration in the cells. Briefly, the lysates were diluted 1:20 with distilled water and 20 ␮l of this solution was added to a 96 well plate followed by the addition of 200 ␮l of Bradford reagent. The absorbance was measured at 595 nM in a Multi-plate reader Mithras LB 940 (Berthold, Bad Wildbad, Germany). A standard curve was plotted from absorbance of 0–300 ␮g of BSA and the concentration of each test sample was determined using Microsoft Excel. Statistical analysis Statistical analysis for p values was performed using paired samples Student’s t-test.

230 231 232 233 234

235

236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257

258

259 260 261 262

263

264 265 266 267 268 269 270 271

272

273 274

Results

275

Initial functional characterization of OAT2 and NTCP

276

A time course experiment was performed using 0.1 ␮M of cGMP as substrate and the uptake into OAT-HEK cells was measured over a period of 30 min (Fig. 1A). Uptake increased with time nearly linearly. For further experiments, 5 min uptake was chosen. For determining the Michaelis–Menten constant of OAT2 for cGMP in our system, we measured the uptake of cGMP in a buffer solution containing 10 nM [3 H] labeled cGMP in the presence of increasing

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

277 278 279 280 281 282 283

G Model YPHRS 2761 1–10 4

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

Fig. 1. Initial functional characterization of OAT2 mediated cGMP uptake in OAT2-HEK cells. (A) The uptake of 1 ␮M cyclic GMP containing 10 nM [3 H] cGMP was monitored over a period of 30 min in OAT2 expressing HEK cells and vector transfected HEK cells. The protein amount was determined by the Bradford method. Data is expressed as pmol/mg of protein. (B) The uptake of [3 H] cyclic GMP was monitored in a buffer system containing 10 nM [3 H] cGMP and increasing amounts of cGMP amounting to a final concentration in the range of 1–750 ␮M for 5 min at 37 ◦ C in OAT2 expressing HEK cells and vector transfected HEK cells. Net uptake was calculated by subtracting the uptake of [3 H] cGMP in vector cells from the uptake in OAT2-HEK cells and plotted against the concentration of cold cGMP. Data are represented as means of triplicates ± SEMs. The Km value was calculated from three such experiments. The protein amount was determined by Bradford method and the data is expressed as pmol/min/mg of protein.

284 285 286 287 288 289 290 291 292 293

294 295

296 297 298 299 300 301

concentrations of cold cGMP. The Km value was determined to be 101.4 ± 5.8 ␮M (Fig. 1B). Similar experiments were conducted with NTCP-HEK cells where we measured the uptake of 1 ␮M estrone 3-sulfate over a period of 30 min. From the plot, we chose 3 min as the optimal time as this was in the linear phase of curve (Fig. 2A). For Km value determination, the uptake of 20 nM [3 H] estrone 3-sulfate was measured in the presence of increasing concentrations of cold estrone 3sulfate for 3 min. The Km value was calculated to be 217.4 ± 12.3 ␮M (Fig. 2B). Cis-inhibition of OAT2 mediated uptake of cGMP by antineoplastic drugs The uptake of [3 H] labeled cGMP into OAT2-HEK cells was measured in the presence of 100 ␮M of the above mentioned antineoplastic drugs for 5 min. We observed significant changes in the uptake of [3 H] labeled cGMP into OAT2-HEK cells in the presence of many of the antineoplastic drugs tested (Fig. 3A–D). Among alkylating agents, melphalan inhibited the uptake down to 79.3 ± 1.9%,

bendamustine to 13.3 ± 0.7%, chlorambucil to 61.1 ± 1.2% and busulfan to 78.3 ± 2.1% of its buffer control (Fig. 3A). Similarly, incubation with the antimetabolites methotrexate, gemcitabine and fluoroadenine reduced the uptake to 74.4 ± 2.9%, 90.5 ± 2.3% and 76.9 ± 1.9% of buffer control (Fig. 3B). Apart from these interactions, incubation with vincristine caused a marginal increase of the uptake to 105 ± 1.5% whereas paclitaxel caused a strong inhibition of the uptake to 16.3 ± 0.5% of buffer control (Fig. 3C). The topoisomerase inhibitors irinotecan and etoposide reduced the uptake to 12.2 ± 0.4% and 68 ± 1.2%, respectively. Tamoxifen caused an inhibition of OAT2 mediated uptake of cGMP to 87.3 ± 2.2% of buffer control (Fig. 3D). Cis-inhibition of NTCP mediated uptake of estrone 3-sulfate by antineoplastic drugs The uptake of estrone 3-sulfate into NTCP-HEK cells was measured in the presence of 100 ␮M of the above mentioned antineoplastic drugs for 3 min. Only a few significant changes in the uptake of [3 H] labeled estrone 3-sulfate interactions were

Fig. 2. Initial functional characterization of NTCP mediated estrone 3-sulfate uptake. (A) The uptake of 1 ␮M estrone 3-sulfate containing 20 nM [3 H] estrone 3-sulfate was monitored over a period of 30 min in NTCP expressing HEK cells and vector transfected HEK cells. Data is expressed as pmol/mg of protein. (B) The uptake of [3 H] estrone 3-sulfate was monitored in a buffer system containing 20 nM [3 H] estrone 3-sulfate and increasing amounts of cold estrone-3 sulfate amounting to a final concentration in the range of 100 nM to 500 ␮M for 3 min at 37 ◦ C in NTCP expressing HEK cells and vector transfected HEK cells. Net uptake was calculated by subtracting the uptake of [3 H] estrone 3-sulfate in vector cells from the uptake in NTCP-HEK cells. The data is expressed as pmol/min/mg of protein and plotted against the concentration of cold estrone 3-sulfate. Data are represented as means ± SEMs of triplicates. The Km value was calculated from three such experiments.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

302 303 304 305 306 307 308 309 310 311 312 313

314 315

316 317 318 319

G Model YPHRS 2761 1–10

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

5

Fig. 3. Interaction of OAT2 with antineoplastic drugs. The uptake of [3 H] cyclic GMP was monitored in a buffer system containing 10 nM [3 H] cyclic GMP and 990 nM cGMP in the presence or absence of 100 ␮M of the respective compounds in OAT2 transfected HEK cells and vector transfected HEK cells. (A) Alkylating agents; (B) antimetabolites; (C) intercalating agents and mitotic inhibitors; and (D) topoisomerase inhibitors and those targeting hormone receptors. Data are means ± SEMs of three individual experiments with three repeats each. * Indicates p value < 0.05, ** indicates p value < 0.01, *** indicates p value < 0.001.

320 321 322 323 324 325 326 327 328 329

observed compared to buffer control (Fig. 4A–D). The alkylating agents chlorambucil and busulfan reduced the uptake to 72.2 ± 2.5% and 89.8 ± 1.8%, respectively, whereas a slight increase in the uptake was observed with bendamustine to 120.9 ± 3.9% of buffer control (Fig. 4A). No significant interactions were observed with antimetabolites tested (Fig. 4B). Among the intercalating agents, mitoxantrone reduced the uptake to 89.4 ± 2.4% and the mitotic inhibitors vincristine and paclitaxel caused an inhibition of uptake to 86.3 ± 3% and 46.7 ± 1.9%, respectively (Fig. 4C). The topoisomerase inhibitors or the antineoplastic drugs targeting hormone

receptors did not cause any significant changes to the uptake of estrone 3-sulfate by NTCP-HEK cells (Fig. 4D). Concentration dependent inhibition of OAT2 mediated cGMP uptake by antineoplastic drugs In order to determine the affinity of OAT2 for selected antineoplastic drugs, which inhibited uptake to less than 40% of buffer control, we employed the Dixon plot analysis. Since we did not find any strong inhibitors for NTCP, we calculated the Ki values for OAT2

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

330 331

332 333

334 335 336 337

G Model YPHRS 2761 1–10 6

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

Fig. 4. Interaction of NTCP with antineoplastic drugs. The uptake of [3 H] estrone 3-sulfate was monitored in a buffer system containing 20 nM [3 H] estrone 3-sulfate and 19.98 ␮M estrone 3-sulfate in the presence or absence of 100 ␮M of the respective compounds in NTCP transfected HEK cells and vector transfected HEK cells. (A) Alkylating agents; (B) antimetabolites; (C) intercalating agents and mitotic inhibitors; and (D) topoisomerase inhibitors and those having hormone receptors as targets. Data are means ± SEMs of three individual experiments with three repeats each. **Indicates p value < 0.01, *** indicates p value < 0.001.

338 339 340 341 342 343 344

alone. Measurement of the uptake of [3 H] labeled cGMP at two different concentrations of 1 ␮M and 10 ␮M cGMP was performed in the presence of increasing concentrations of the cytostatic. Plots of the reciprocal of velocity of uptake on Y axis over the concentration of the cytostatic on X axis revealed Ki values of OAT2 for bendamustine, irinotecan and paclitaxel to be 43.3 ± 4.33 ␮M, 26.4 ± 2.34 ␮M and 10.4 ± 0.45 ␮M, respectively (Fig. 5A–C).

Apoptosis assay to evaluate OAT2 mediated uptake of bendamustine To find out whether the antineoplastic drugs are transported by OAT2, we performed an apoptosis assay. Incubation of OAT2 expressing cells with 100 ␮M bendamustine showed an increase in the caspase-3 activity by ∼16% of untreated pcDNA while the

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

345 346

347 348 349 350

G Model YPHRS 2761 1–10

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

7

Fig. 5. Determination of Ki value of OAT2 for selected antineoplastic drugs by Dixon-plot. The uptake of [3 H] cyclic GMP was monitored in a buffer system containing 10 nM [3 H] cGMP and 990 nM or 9.99 ␮M cGMP in the presence of increasing concentration of bendamustine (A); irinotecan (B) from 0 to 130 ␮M, or paclitaxel (C) from 0 to 20 ␮M in OAT2 expressing cells and vector transfected HEK cells. Data are means ± SEMs of three repeats. The Ki value was calculated from three individual experiments.

351 352 353 354

355 356

357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372

activity in control cells did not change significantly. This increase in caspase-3 activity was completely diminished when the bendamustine treatment was performed in combination with 100 ␮M probenecid, an OAT2 inhibitor (Fig. 6).

OAT2 mediated accumulation of irinotecan determined by HPLC analysis The characteristic peaks for each compound were obtained by injections of pure substances in the same conditions of the run. Standard curves were plotted for both irinotecan as well as camptothecin (as internal standard) in the range of 15–500 pmol. The results from three independent runs show that the retention times of irinotecan and camptothecin were ca. 5.7 min and 11.6 min, respectively. From the standard curve, the amount of irinotecan found in lysates of OAT2 expressing cells was calculated to be 86 pmol/mg/5 min, which was regarded as 100%. Accumulation of irinotecan in mock pcDNA cells was 57.4 ± 7.5% of irinotecan found in OAT2 expressing cells (Fig. 7). The uptake of irinotecan was strongly inhibited by 100 ␮M cGMP to 68.6 ± 12.2% in OAT2 expressing cells whereas the irinotecan uptake was not significantly changed in pcDNA treated with 100 ␮M cGMP (49.7 ± 12.1%) confirming the cGMP induced reduction in the accumulation of irinotecan is specific to transport by OAT2.

Time dependent OAT2 mediated uptake of irinotecan The time dependent accumulation of irinotecan was followed by performing HPLC analysis: The amount of irinotecan in the cells was analyzed in pcDNA and OAT2 cells incubated with 100 ␮M irinotecan for increasing periods of time. There was an increase both in the OAT2 dependent as well as nonspecific uptake into the cells, however, the OAT2 mediated uptake was far more pronounced as can be seen from the net uptake plotted against time (Fig. 8). Concentration dependent uptake of irinotecan by pcDNA and OAT2 cells Concentration dependent accumulation of irinotecan was followed by performing HPLC analysis of lysates of cells incubated with increasing amounts of irinotecan in Hanks buffer solution. Similar to time course experiments, with increase in concentration of irinotecan in the transport buffer, an increase in the amount of irinotecan was observed in the lysates. The Km value was calculated to be 42.37 ± 6.4 ␮M from two such experiments (Fig. 9). Q4 Discussion An important step in the elimination of drugs and xenobiotics is the absorption of these molecules from the blood into the

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

373

374 375 376 377 378 379 380

381 382

383 384 385 386 387 388 389

390

391 392

G Model YPHRS 2761 1–10 8

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

Fig. 6. Bendamustine-OAT2 mediated apoptosis. Caspase-3 activity was monitored in OAT2 expressing cells and pcDNA cells incubated with 100 ␮M bendamustine for 12 h alone or in the presence of 100 ␮M probenecid. The relative fluorescence values obtained in the experiment were normalized with protein levels and expressed as % of the value obtained in control pcDNA cells. Data are means ± SEMs of two individual experiments with two technical repeats each. *** Indicates p value < 0.001; ns – not significant.

393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434

hepatocytes. It is not yet known how, many of these antineoplastic agents gain entry into the cells and the objective of our work was to find whether any of the SLC family of transporter proteins is involved in the uptake of these compounds. The present study is focused on two transporter proteins, the organic anion transporter 2 (OAT2) and the sodium taurocholate cotransporting polypeptide (NTCP), both located in the sinusoidal membrane of hepatocytes, and tested for their interaction with antineoplastic compounds. For studying these interactions, we used stably transfected human embryonic kidney cells expressing the corresponding transporter protein. We characterized the expression and function of the transporter proteins and used them as a platform to study the interactions of transporter proteins with antineoplastic agents. The Km values of OAT2 and NTCP for cGMP and estrone 3-sulfate were calculated to be 101.4 ± 5.8 ␮M and 217.4 ± 12.3 ␮M, respectively. We used nearly one tenth of the Km values to perform further experiments to minimize a competition between labeled substrate and the tested antineoplastic drugs. For cis-inhibition experiments, we used 100 ␮M of antineoplastic drugs. Although this concentration exceeds by far the plasma concentration, any interaction with OAT2 and NTCP would become evident in our experiments. We considered, for kinetic analysis, only those interactions which led to an inhibition of the uptake to less than 40% of buffer control. We report, for the first time, a very high affinity of OAT2 for the antineoplastic drugs bendamustine and irinotecan, apart from a very strong interaction with paclitaxel as reported earlier [4]. Dixon plot analysis revealed the Ki values of OAT2 for bendamustine, irinotecan and paclitaxel to be 43.3 ± 4.33 ␮M, 26.4 ± 2.34 ␮M and 10.4 ± 0.45 ␮M, respectively. Bendamustine is increasingly being recognized as the frontline therapy for chronic lymphocytic leukemia (CLL) [20–22] and also in the treatment of other lymphomas [23,24]. Structurally bendamustine contains alkylating and antimetabolite (purine analog) groups. It belongs to the nitrogen mustard group of molecules but its mode of action is predominantly as an alkylating agent, with a considerable difference to other alkylating agents, and the antimetabolite effect of this compound is not evident yet [25]. As far as we know, there is nothing known as to how bendamustine gains entry into the cells. Since we did not observe any interaction of OAT2 with chlorambucil which is very similar in structure to bendamustine or with any of the purine analogs tested, it is not possible with this data to conclude which functional group of bendamustine might be responsible for its interaction with OAT2. Irinotecan,

Fig. 7. OAT2-mediated irinotecan uptake. Irinotecan uptake was monitored by HPLC analysis in pcDNA and OAT2 expressing cells treated with 100 ␮M irinotecan alone or in combination with 100 ␮M cGMP. The amount of irinotecan found was normalized to protein concentration and expressed as uptake per mg protein. Irinotecan uptake in OAT2 expressing cells treated with irinotecan alone is taken as 100% and the other conditions are represented as percentage of that value. Data are means ± SEMs of three individual experiments. *** Indicates p value < 0.001; ns – not significant. Error bar of OAT2 cells treated with irinotecan is of too small magnitude to be seen in the figure.

also referred to as CPT 11, is a water soluble derivative of camptothecin and a well-known topoisomerase inhibitor. It inhibits the topoisomerase I, an enzyme which relaxes DNA supercoils formed during the processes of DNA replication and transcription, leading to breaks in DNA that result in DNA fragmentation [26]. It is a common component of combination chemotherapeutic regimens that are in clinical trials for its efficacy in certain cancers like small cell lung cancer, colorectal cancer and pancreatic cancer [27–29]. There is little information as to how irinotecan is taken up into the cell. The active metabolite of irinotecan, SN-38, but not irinotecan as such, was shown to be a substrate for the transporter protein OATP1B1, how irinotecan enters the cells to be converted into SN-38 is still unknown [30]. In our experiments we found that it interacted strongly with OAT2 but not with NTCP. Paclitaxel acts in a distinct mechanism by stabilizing the microtubule spindle apparatus and thus leads subsequently to either apoptosis or reentry of cell from mitotic phase to G phase [31]. Paclitaxel was found to be effective alone or with other anticancer agents for chemotherapy in the treatment of ovarian cancer and non-small-cell lung cancer, breast cancer and AIDS-related Kaposi’s sarcoma [32,33] and new methods have been employed for improving efficiency of paclitaxel such as nab-paclitaxel [34,35]. Our observation of a strong interaction of OAT2 with paclitaxel is in line with a previous report [4] wherein the authors have measured the uptake of radiolabeled paclitaxel in OAT2 expressing oocytes. However, we did not see any interaction of OAT2 with 5-fluorouracil, as observed in the same report. It is not uncommon to see such differences in the substrate uptakes between those performed in oocytes and those performed in HEK cells or CHO cells. Besides OAT2, paclitaxel is also shown to be transported by the transporter proteins, OATP1B1 and OATP1B3 [36]. The immediate question arises whether these antineoplastic drugs are inhibiting OAT2 or they actually are substrates of OAT2 themselves. To find an answer to this question, we focused on an event that would occur if the antineoplastic drugs use the transporter protein to get into the cells i.e. apoptosis. As paclitaxel has already been shown to be a substrate of OAT2 [4], we concentrated on the other two compounds, bendamustine and irinotecan. For measuring OAT2-mediated apoptosis, we performed the caspase-3 assay wherein the OAT2 expressing cells treated with bendamustine showed an increase in the caspase-3 activity compared to the untreated OAT2 expressing cells and the control cells with or without treatment. The fact that this increase in caspase-3 activity was diminished almost completely in the presence of probenecid demonstrates the specificity of this OAT2-mediated apoptosis.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479

G Model

ARTICLE IN PRESS

YPHRS 2761 1–10

V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

9

Table 1 Possibility of compounds to contribute to the OAT2 mediated drug–drug interactions. Compound

Unbound fractiona

Peak plasma concentrationb

IC50 valuesc

Possibility of drug–drug interactiond

Bendamustine Irinotecan Paclitaxel

0.05 0.51 0.12

14.8 ␮M 2.89 ␮M 0.85 ␮M

16.88 ␮M 7.55 ␮M 1.44 ␮M

No Yes No

a b c d

The fraction of compound unbound to protein was obtained from literature [37] and from BC cancer agency drug manual. The peak plasma concentrations were obtained from Goodman and Gilman’s “The pharmacological basis of therapeutics” 10th edition and literature [38]. IC50 values were calculated from uptake values measured at 1 ␮M cGMP substrate concentration in the presence of increasing concentration of antineoplastic compounds. Possibility of contribution of drug–drug interactions in vivo is calculated from literature [39].

Fig. 8. Irinotecan uptake was monitored in pcDNA and OAT2 cells after incubation with irinotecan for 2, 4, 6, 8 and 10 min. The uptake was normalized to the internal standard and the protein amount and the net uptake was calculated by subtracting the irinotecan values of pcDNA from OAT2 cells and expressed as relative fluorescence units (RFU)/mg protein.

period, we needed a stronger inhibitor of OAT2 than probenecid to see a profound effect, and for this reason, we chose unlabeled cGMP, the specific substrate of OAT2 we used in our initial experiments. A standard curve was developed for irinotecan as well as for the internal standard camptothecin and the observed amounts of irinotecan in the cell lysates were in the linear range of the curve. An interesting point to be noted is that, in our experiments, we did not find any peak for SN38, a hydrolysis product of irinotecan, which is the active metabolite of the compound mostly responsible for its in vivo activity. As can be seen in Fig. 7, a huge increase in the uptake of irinotecan in OAT2 expressing cells was observed compared to the pcDNA cells. Inhibition of the accumulation of irinotecan in the presence of cGMP in OAT2 expressing cells alone confirmed that this increase was transporter specific. This strongly suggests that irinotecan is a substrate of OAT2. To understand the selectivity of OAT2 for some of the antineoplastic drugs, we analyzed the molecular parameters of the compounds using the MarvinSketch software (Sup-Table 1). The obtained parameters logP, logD, polar surface area (psa) and net charge at pH 7.4, did not markedly vary among the compounds which interacted with OAT2 and the compounds which did not interact. Moreover, the net charge at pH 7.4 of bendamustine, irinotecan and paclitaxel was −1, +1 and 0, respectively. Similarly there was no correlation between the compounds with any of the other parameters obtained. The following table summarize the unbound fraction, and the peak plasma concentration of bendamustine, irinotecan and paclitaxel. The IC50 value of OAT2 bendamustine and irinotecan, paclitaxel and calculate the DDI (Table 1). The possibility of a compound interacting with OAT proteins to contribute to drug–drug interactions in vivo was described previously [39]. Applying the same principle (unbound Cmax /IC50 ≥ 0.1) to the three inhibitors of OAT2 observed in our study, we found that irinotecan has the potential to contribute to drug-drug interactions in vivo, while the compounds bendamustine and paclitaxel do not. Conclusion

Fig. 9. Irinotecan uptake was monitored in pcDNA and OAT2 cells after incubation with 20 ␮M, 40 ␮M, 60 ␮M, 80 ␮M, 100 ␮M and 120 ␮M irinotecan for 5 min. The uptake was normalized to the internal standard and the protein amount, and the net uptake was calculated by subtracting the irinotecan values of pcDNA from OAT2 cells and expressed as relative fluorescence units (RFU)/mg protein/5 min. Figure is representative of one of the experiments and the Km value was calculated from two such experiments.

480 481 482 483 484 485 486 487

Similar experiments with irinotecan showed a high increase in apoptosis in pcDNA as well as OAT2 expressing cells with or without inhibitor (data not shown), suggesting strong nonspecific accumulation of the compound in the conditions we used. This led us to believe that a protocol needs to be employed which allows the study with shorter incubation time. We employed HPLC analysis as it is highly sensitive and hence can detect irinotecan uptake even at lower incubation periods. As we were working with shorter time

To conclude, we report novel interactions of OAT2 with the antineoplastic compounds, bendamustine and irinotecan and prove that they are substrates of the transporter protein OAT2. Our study emphasizes the need to study the expression of OAT2 in various tumors before formulating a chemotherapeutic strategy. Given the importance of cGMP in various physiological processes in vivo, it would be interesting to see whether treatment with bendamustine or irinotecan alter the dynamics of this molecule in cells. It also remains to be ascertained whether OAT2 contributes to drug–drug interaction in healthy hepatocytes during treatment of tumors of various origins. Furthermore, as OAT2 is highly expressed in liver and showed potent interactions with these antineoplastic drugs, it would be very interesting to see whether they mediate the uptake of any of the compounds used in the treatment of hepatocellular carcinoma.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523

524

525 526 527 528 529 530 531 532 533 534 535 536 537 538 539

G Model YPHRS 2761 1–10 10 540

541 542 543 544 545 546

547

ARTICLE IN PRESS V.V.V.R. Marada et al. / Pharmacological Research xxx (2014) xxx–xxx

Conflicts of interest No conflict of interest exists. Yohannes Hagos is a professor at the Institute for Vegetative Physiology and Pathophysiology and also the CEO and shareholder of PortaCellTec biosciences GmbH. PortaCellTec has no commercial interest in this study and the cell lines generated are available for free for research groups of University of Göttingen. Acknowledgments

We thank Sören petzke and Andrea Paluschkiwitz for their 549 Q5 skillful assistance. This work was supported by the Deutsche 550 Forschungsgemeinschaft (DFG), graduate college cancer pharma551 cogenomics (GRK 1034). 548

552

553 554

555

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.phrs.2014.11.002. References

[1] Hediger MA, Clemencon B, Burrier RE, Bruford EA. The ABCs of membrane 557 transporters in health and disease (SLC series): introduction. Mol Asp Med 558 2013;34:95–107. 559 [2] Sekine T, Cha SH, Tsuda M, Apiwattanakul N, Nakajima N, Kanai Y, et al. Identi560 fication of multispecific organic anion transporter 2 expressed predominantly 561 in the liver. FEBS Lett 1998;429:179–82. 562 [3] Burckhardt G, Burckhardt BC. In vitro and in vivo evidence of the importance 563 of organic anion transporters (OATs) in drug therapy. Handb Exp Pharmacol Q6 564 2011:29–104. 565 [4] Cropp CD, Komori T, Shima JE, Urban TJ, Yee SW, More SS, et al. Organic anion 566 transporter 2 (SLC22A7) is a facilitative transporter of cGMP. Mol Pharmacol 567 2008;73:1151–8. 568 [5] Kobayashi Y, Ohshiro N, Sakai R, Ohbayashi M, Kohyama N, Yamamoto T. Trans569 port mechanism and substrate specificity of human organic anion transporter 570 2 (hOat2 [SLC22A7]). J Pharm Pharmacol 2005;57:573–8. 571 [6] Fork C, Bauer T, Golz S, Geerts A, Weiland J, Del TD, et al. OAT2 catal572 yses efflux of glutamate and uptake of orotic acid. Biochem J 2011;436: 573 305–12. 574 [7] Sato M, Mamada H, Anzai N, Shirasaka Y, Nakanishi T, Tamai I. Renal secretion of 575 uric acid by organic anion transporter 2 (OAT2/SLC22A7) in human. Biol Pharm 576 Bull 2010;33:498–503. 577 [8] Cheng Y, Vapurcuyan A, Shahidullah M, Aleksunes LM, Pelis RM. Expression of 578 organic anion transporter 2 in the human kidney and its potential role in the 579 tubular secretion of guanine-containing antiviral drugs. Drug Metab Dispos 580 2012;40:617–24. 581 [9] Hagenbuch B, Meier PJ. Molecular cloning, chromosomal localization, and func582 tional characterization of a human liver Na+/bile acid cotransporter. J Clin 583 Invest 1994;93:1326–31. 584 [10] Visser WE, Wong WS, van Mullem AA, Friesema EC, Geyer J, Visser TJ. Study of 585 the transport of thyroid hormone by transporters of the SLC10 family. Mol Cell 586 Endocrinol 2010;315:138–45. 587 [11] Ho RH, Tirona RG, Leake BF, Glaeser H, Lee W, Lemke CJ, et al. Drug and bile acid 588 transporters in rosuvastatin hepatic uptake: function, expression, and pharma589 cogenetics. Gastroenterology 2006;130:1793–806. 590 [12] Fujino H, Saito T, Ogawa S, Kojima J. Transporter-mediated influx and efflux 591 mechanisms of pitavastatin, a new inhibitor of HMG-CoA reductase. J Pharm 592 Pharmacol 2005;57:1305–11. 593 [13] Yan H, Zhong G, Xu G, He W, Jing Z, Gao Z, et al. Sodium taurocholate cotrans594 porting polypeptide is a functional receptor for human hepatitis B and D virus. 595 Elife 2012;1:e00049. 596 [14] Martino M, Olivieri A, Offidani M, Vigna E, Moscato T, Fedele R, et al. 597 Addressing the questions of tomorrow: melphalan and new combinations 598 as conditioning regimens before autologous hematopoietic progenitor cell 599 transplantation in multiple myeloma. Expert Opin Invest Drugs 2013;22: 619–34. 556

[15] Jabbour P, Chalouhi N, Tjoumakaris S, Gonzalez LF, Dumont AS, Chitale R, et al. Pearls and pitfalls of intraarterial chemotherapy for retinoblastoma. J Neurosurg Pediatr 2012;10:175–81. [16] Hus I, Jawniak D, Gorska-Kosicka M, Butrym A, Dzietczenia J, Wrobel T, et al. Bendamustine as monotherapy and in combination regimens for the treatment of chronic lymphocytic leukemia and non-hodgkin lymphoma: a retrospective analysis. Chemotherapy 2014;59:280–9. [17] Yeo D, Huynh N, Beutler JA, Christophi C, Shulkes A, Baldwin GS, et al. Glaucarubinone and gemcitabine synergistically reduce pancreatic cancer growth via down-regulation of P21-activated kinases. Cancer Lett 2014;346:264–72. [18] Chiorean EG, Von Hoff DD. Taxanes: impact on pancreatic cancer. Anticancer Drugs 2014. Q7 [19] de BP, Verweij J, Loos WJ, Nooter K, Stoter G, Sparreboom A. Determination of irinotecan (CPT-11) and its active metabolite SN-38 in human plasma by reversed-phase high-performance liquid chromatography with fluorescence detection. J Chromatogr B Biomed Sci Appl 1997;698:277–85. [20] Knauf WU, Lissichkov T, Aldaoud A, Liberati A, Loscertales J, Herbrecht R, et al. Phase III randomized study of bendamustine compared with chlorambucil in previously untreated patients with chronic lymphocytic leukemia. J Clin Oncol 2009;27:4378–84. [21] Knauf WU, Lissitchkov T, Aldaoud A, Liberati AM, Loscertales J, Herbrecht R, et al. Bendamustine compared with chlorambucil in previously untreated patients with chronic lymphocytic leukaemia: updated results of a randomized phase III trial. Br J Haematol 2012;159:67–77. [22] Masiello D, Tulpule A. Bendamustine therapy in chronic lymphocytic leukemia. Expert Opin Pharmacother 2009;10:1687–98. [23] Rummel MJ, Niederle N, Maschmeyer G, Banat GA, von GU, Losem C, et al. Bendamustine plus rituximab versus CHOP plus rituximab as first-line treatment for patients with indolent and mantle-cell lymphomas: an open-label, multicentre, randomised, phase 3 non-inferiority trial. Lancet 2013;381:1203–10. [24] Cheson BD, Rummel MJ. Bendamustine: rebirth of an old drug. J Clin Oncol 2009;27:1492–501. [25] Gandhi V, Burger JA. Bendamustine in B-cell malignancies: the new 46-year-old kid on the block. Clin Cancer Res 2009;15:7456–61. [26] Pommier Y, Leo E, Zhang H, Marchand C. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem Biol 2010;17:421–33. [27] Crabb SJ, Bradbury J, Nolan L, Selman D, Muthuramalingam SR, Cave J, et al. A phase I clinical trial of irinotecan and carboplatin in patients with extensive stage small cell lung cancer. Chemotherapy 2012;58:257–63. [28] Deng T, Zhang L, Liu XJ, Xu JM, Bai YX, Wang Y, et al. Bevacizumab plus irinotecan, 5-fluorouracil, and leucovorin (FOLFIRI) as the second-line therapy for patients with metastatic colorectal cancer, a multicenter study. Med Oncol 2013;30:752. [29] Zaniboni A, Aitini E, Barni S, Ferrari D, Cascinu S, Catalano V, et al. FOLFIRI as second-line chemotherapy for advanced pancreatic cancer: a GISCAD multicenter phase II study. Cancer Chemother Pharmacol 2012;69:1641–5. [30] Nozawa T, Minami H, Sugiura S, Tsuji A, Tamai I. Role of organic anion transporter OATP1B1 (OATP-C) in hepatic uptake of irinotecan and its active metabolite, 7-ethyl-10-hydroxycamptothecin: in vitro evidence and effect of single nucleotide polymorphisms. Drug Metab Dispos 2005;33:434–9. [31] Milross CG, Mason KA, Hunter NR, Chung WK, Peters LJ, Milas L. Relationship of mitotic arrest and apoptosis to antitumor effect of paclitaxel. J Natl Cancer Inst 1996;88:1308–14. [32] Muggia FM, Braly PS, Brady MF, Sutton G, Niemann TH, Lentz SL, et al. Phase III randomized study of cisplatin versus paclitaxel versus cisplatin and paclitaxel in patients with suboptimal stage III or IV ovarian cancer: a gynecologic oncology group study. J Clin Oncol 2000;18:106–15. [33] Socinski MA. Single-agent paclitaxel in the treatment of advanced non-small cell lung cancer. Oncologist 1999;4:408–16. [34] Yardley DA. nab-Paclitaxel mechanisms of action and delivery. J Control Release 2013;170:365–72. [35] Ma WW, Hidalgo M. The winning formulation: the development of paclitaxel in pancreatic cancer. Clin Cancer Res 2013;19:5572–9. [36] Svoboda M, Wlcek K, Taferner B, Hering S, Stieger B, Tong D, et al. Expression of organic anion-transporting polypeptides 1B1 and 1B3 in ovarian cancer cells: relevance for paclitaxel transport. Biomed Pharmacother 2011;65:417–26. [37] Obach RS, Lombardo F, Waters NJ. Trend analysis of a database of intravenous pharmacokinetic parameters in humans for 670 drug compounds. Drug Metab Dispos 2008;36:1385–405. [38] Dubbelman AC, Rosing H, Darwish M, D’Andrea D, Bond M, Hellriegel E, et al. Pharmacokinetics and excretion of 14C-bendamustine in patients with relapsed or refractory malignancy. Drugs R D 2013;13:17–28. [39] Huang SM, Zhang L, Giacomini KM. The International Transporter Consortium: a collaborative group of scientists from academia, industry, and the FDA. Clin Pharmacol Ther 2010;87:32–6.

Please cite this article in press as: Marada VVVR, et al. Interaction of human organic anion transporter 2 (OAT2) and sodium taurocholate cotransporting polypeptide (NTCP) with antineoplastic drugs. Pharmacol Res (2014), http://dx.doi.org/10.1016/j.phrs.2014.11.002

600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674