Mapping, cloning, and DNA sequencing of pepB which encodes peptidase B of Escherichia coli K-12

Mapping, cloning, and DNA sequencing of pepB which encodes peptidase B of Escherichia coli K-12

JOURNAL OF FERMENTATION AND BIOENOINEERIIW Vol. 82, No. 4, 392-397. 1996 NOTES Mapping, Cloning, and DNA Sequencing of pepB Which Encodes Peptidase B...

776KB Sizes 0 Downloads 11 Views

JOURNAL OF FERMENTATION AND BIOENOINEERIIW Vol. 82, No. 4, 392-397. 1996

NOTES Mapping, Cloning, and DNA Sequencing of pepB Which Encodes Peptidase B of Escherichia coli K-12 HIDEYUKI

SUZUKI, * EUN-SO0

KIM, + NAG1 YAMAMOTO, WATARU AND HIDEHIKO KUMAGAI

HASHIMOTO,*

KENJI YAMAMOTO,

Department of Food Science and Technology, Faculty of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku,

Kyoto 606-01, Japan Received 13 May 1996/Accepted 8 July 1996 pepB gene which encodes peptidase B was mapped at 54 min on the Escherichia coli K-12 linkage map. pepB was cloned and its nucleotide sequence was determined. pepB gene has an open reading frame which encodes a protein of 420 amino acid residues the molecular weight of which is estimated to be 45,666. Peptidase B was suggested to be a homohexamer. The deduced amino acid sequence of peptidase B has an absolutely conserved octapeptide, NTDAKGKL, known as a zinc/manganese binding site and a so-called cytosol aminopeptidase signature in its central region. Peptidase B was suggested to belong to the peptidase family M17. [Key words: sequence]

aminopeptidase, peptidase, Escherichiacoli, cloning, metallopeptidase, metal binding site, DNA

Aminopeptidase is an exopeptidase which cleaves individual amino acids from the N-terminal of peptides. In Escherichia coli and Salmonella typhimurium various kinds of aminopeptidases and dipeptidases with different substrate specificities are known to exist (1, 2). Several aminopeptidases (peptidase A, B, and N) and a dipeptidase (peptidase D) are known to have broad substrate specificities (1, 2) and participate in protein degradation to recycle amino acids for protein synthesis (2, 3). Genes coding for peptidase A, N, and D of E. coli K-12 were cloned and their nucleotide sequences were determined, and the peptidases were purified and characterized (4-9). Only the gene coding for peptidase B, pepB, was not cloned and peptidase B was not purified. In this study, we have cloned pepB of E. coli K-12 and determined its nucleotide sequence. All strains used were E. coli K-12 derivatives and are listed in Table 1. All pep mutants were grown with LB medium (10) supplemented with 0.05 mM thymine and 0.3 mM thiamin at 37°C. For minimal medium, M9 glucose medium (10) supplemented with 0.05 mM leucine, 0.3 mM methionine, 0.3 mM proline, 0.05 mM thymine, and 0.3 mM thiamin was used. When necessary, antibiotics were added as indicated. Mapping of pepB to a 20min interval on the E. coli K-12 linkage map was performed using Hfr strains which contain TnZO insertions approximately 20 min from their points of origin (11, 12). A spontaneous streptomycin resistant derivative of CM86, KES2, was mated with these Hfr::TnlO strains and TetR StrR exconjugants were selected, followed by screening for the valylvaline-sensitive phenotype. Mapping using Plvir-mediated transductions were performed by the standard method (10) and co-transduction frequencies of pepB and TnlO markers were measured.

DNA was manipulated by standard methods (13). DNA sequencing was performed according to the chain termination method (14) using the ABI PRISM Dye Primer Cycle Sequencing Ready Reaction Kit (Perkin-Elmer, Foster City, CA, USA) and an Applied 373A DNA Sequencer (Applied Biosystems Japan, Tokyo). Sequence data were compiled using the software “Analysis” (Applied Biosystems Japan) and assembled using the software “AutoAssembler n (Applied Biosystems Japan). Mapping and cloning of pepB gene E. coli K-12 is growth-inhibited by valine, that is, valine sensitive (15). However, the pepABDN mutant is valylvaline resistant, because it lacks all peptidases that can cleave the peptide linkage in valylvaline and valine is not released (1). If the pepB+ allele is transferred from Hfr::TnlO strains to the pepABDN mutant and undergoes recombination, exconjugants become valylvaline sensitive. Therefore, exconjugants were plated on M9 minimal plates (10) supplemented with and without 0.5 mM valylvaline to test whether they were valylvaline sensitive/resistant, in other words pepB+/-. The pepABDN mutant, CM86, isolated by Miller and Schwartz (1) was used to map pepB gene on the E. coli K-12 linkage map. It should be noted that A(pro-lac) represents deletion of the pepD gene (1). A spontaneous streptomycin resistant derivative of CM86, KES2, was mated with CAG5055. Among 45 TetR StrR exconjugants isolated, 14 exconjugants were valylvaline sensitive. KES2 was also mated with CAG5054. None of 40 TetR StrR exconjugants was valylvaline sensitive. Considering that neither pepA + (4), pepD+ (19 nor pepNt (17, 18) locus was transferred due to these conjugations, these results show that pepB gene is located between 46 and 62min on the E. coli K-12 linkage map. Further mapping was carried out via a series of Pl vir-mediated transductions by checking co-transduction frequencies of pepB and TnlO markers located in this region. CM86 was transduced by Pl vir phage grown on CAG18470 and CAG18481, and 11 out of 40 and 33 out of 40 TetR StrR transductants, respectively, were valylvaline sensi-

* Corresponding author. Present address: +Byakka Co., Shouryudou, Gunnzann, Zennhoku, Korea and *Research Institute for Food Science, Kyoto University, Gokasho, Uji, Kyoto 611, Japan. 392

NOTES

VOL. 82, 1996

393

TABLE 1. E. coli K-12 strains used in this study Strain

Source and/or reference

Description

CAG5054 CAG5055 CAG18470 CAGl8481 CM48 CM86 KES2

Hfr PO44 reIA1 thi-I trp::TnlO Hfr PO45 relA1 thi-1 zed::TnlO F- purC80-TnlO F- Fg-208-TnlO F- pepAl pepN102 A(pro-lac) leu-9 met thyA F- pepAl peps1 pepNlO2 A(pro-lac) leu-9 met thyA F- pepAl pepB1 pepNlO2 A(pro-lac) leu-9 met thyA rpsL

pLC7-48/JA200 pLCl6-44/JA200 pLCl7-30/JA200 pLC20-46/JA200 pLC28-3 1/JA200 pLC30-l/JA200 pLC32-4S/JA200 pLC35-l/JA200 pLC37-ll/JA200 pLC41-7/JA200 SH949

pLC7-48/F+/AtrpE5

recA1 thr leuB6 lacy

pNS421CM86

These results show that pepB gene is located between 53.25 and 54.75min on the linkage map. This result correlates well with the locus of the Salmonella typhimurium pepB gene which is located at 53 min on the S. typhimurium linkage map (19, 20). Strains of the Clarke-Carbon colony bank harboring pLC plasmids (21) known to carry genomic DNA located around 54 min on the E. co/i K-12 linkage map (22) were checked to determine whether these pLC plasmids carry pepB. Cell-free extracts of these strains were subjected to native PAGE (23) and the gel was subjected to peptidase activity staining using L-leucylglycine as a substrate (24). Among strains harboring pLC7-48, 17-30, 28-31, 30-1, 32-45, 37-11, or 41-7, only the strain harboring pLC3711 over-produced peptidase B and gave two very thick reddish-brown peptidase B bands upon staining of the gel (Fig. 1). Miller and Schwartz also observed that peptidase B sometimes gave two bands on a native polyacrylamide gel following peptidase activity staining, but the reason was not known (1). Moreover, peptidase A does not migrate into the gel under this condition (1). Therefore, although JA200 is PepA+, we observed no band representing peptidase A on this gel. Strains harboring pLC plasmids carrying genomic DNA fragments shorter than but overlapping with that carried on pLC37-11 were checked to determine whether they overproduce peptidase B. Apart from the strain harboring pLC37-11, the strain harboring pLC20-46 over-produces peptidase B and the strain harboring pLC16-44 might also over-produce peptidase B (data not shown). These results suggest that pepB gene is located at about 2,660 kb coordinate on the E. coli K-12 chromosome (22, 25). Subcloning of pepS gene from pLC20-46 We subcloned pepB gene from pLC20-46. pLC20-46 was digested with Mu1 and the 4.5-kb NruI fragment was ligated into the Scai site of pACYC184 (26). CM86 was transformed with this ligation mixture and tetracycline resistant transformants were selected on an LB plate supplemented with 10 pug/ml tetracycline. Tetracycline resistant transformants were screened for valylvaline sensitivity and a valylvaline sensitive transformant (SH949) was saved and the plasmid harbored by this transformant was designated pNS42. A sample of the cell-free tive.

C. A. Gross (12) C. A. Gross (12) C. A. Gross (12) C. A. Gross (12) C. G. Miller (1) C. G. Miller (1) Spontaneous StrR of CM86, this work A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) A. Nishimura (21) This work

extract of SH949 was loaded on a native polyacrylamide gel (23) followed by activity staining (24) and it was shown that SH949 over-produced peptidase B (data not shown). Therefore, the 4.5-kb NruI fragment carried by pNS42 contains pepB. A restriction map of pNS42 was constructed according to standard methods (Fig. 2A). Purification of peptidase B and its properties Peptidase B was purified from an 18-1 culture of SH949. Briefly, a 30-40% ammonium sulfate-saturated fraction of the cell-free extracts was applied to a DEAE-cellulose column followed by application onto a Sephadex G-200 column. The purified peptidase B gave only one major protein band on a native polyacrylamide gel (23) and the corresponding band was stained by peptidase activity staining (24) (Fig. 2B). Therefore, we concluded that this major band represents peptidase B. The molecular weight of the subunit was estimated to be 44,000 from the result of SDS-PAGE and that of native peptidase B was calculated, from the results of native gradient PAGE (27) and gel filtration by HPLC equipped with a TSK-gel 3,000 SW column (TOSO, Tokyo), to be 275,000 or 300,000, respectively. This indicates that the peptidase B of E. co/i K-12 is a homohexamer. Purified peptidase B was subjected to SDS-PAGE and electroblotted onto a PVDF membrane (Nihon Millipore Kogyo, Tokyo) and stained with Coomassie blue R-250 as 1

2

3

4

5

6

7

8

FIG. 1. Screening of pLC plasmids for pepB gene. Samples of ceil-free extracts of each strain (40 pg protein) were loaded on a native polyacrylamide gel followed by activity staining. Lane 1, pLC417/JA200; lane 2, pLC37-ll/JA200; lane 3, pLC32-451JA200; lane 4, pLC30-l/JA200; lane 5, pLC28-311JA200; lane 6, pLCl7-30/JA200; lane 7, pLC7-48/JA200; lane 8, CM48 (1) as a PepA- B+D-N- control. On the gel two bands representing peptidase B were detected. The third and fourth bands from the top of the gel represented peptidase D and peptidase N, respectively, according to ref. 1.

394

SUZUKI

ET AL.

J.

FERMENT. BIOENG.,

B

A Clal

peptidase l3

kb

FIG. was

EcoRV 1.7

2. (A) Restriction map of pNS42. (B) Native PAGE of purified peptidase B. Ten ,~g of purified protein was loaded. Lane stained by Coomassie blue R-250; lane 2, gel was stained by peptidase activity staining using L-leucylglycine as a substrate (24).

described (28). The major band was cut out of the membrane and the N-terminal amino acid sequence was determined using a Protein Sequencing System Model 437A (Applied Biosystems Japan) to be MTEAMKITLSTQPA DARWGE. By using the Blast program (29) we found that this 20 amino acid residue sequence exactly matched the first 20 amino acids of the fdx 3’ region (fragment) of the E. co/i hypothetical protein YfhI in SwissProt (P37095) which was deduced from DNA sequence U01827 in GenBank. The gene suggested to encode this hypothetical protein is located 3’ downstream and next to the gene encoding the heat shock protein, hscA, which is located at 54.5 min on the E. coli K-12 linkage map (30). This coincides well with our mapping data. Therefore, we speculated that this hypothetical protein was peptidase B. Taking advantage DNA sequencing of pepB gene of the known 5’ extending DNA sequence of pepB in DNA sequence U01827 in GenBank, restriction recognition sites present in this region were deduced, and we predicted that pepB gene is located within approximately 2-kb NsiI-EcoRV-StuI-EcoRV region of pNS42 (Fig. 2A). NsiI-StuI and EcoRV-EcoRV fragments from this region of pNS42 were subcloned into pUC18 and 19, and deletion sets of these subcloned DNA were made using the Kilo-Sequence Deletion Kit (Takara Shuzo, Kyoto). Through use of deletion sets of DNA as templates, the DNA sequence of pepB gene was determined (Fig. 3). The DNA sequence in Fig. 3 has been deposited in the DDBJ data base under accession number D84499. Starting from the NsiI site, 1,790 nucleotides of this region were determined using both strands. When the first A of the NsiI site is numbered 1, the Shine-Dalgarno sequence (31) is located at nucleotide position 273, the initiation codon is at position 285, the stop codon is at position 1,545 and the possible terminator is at position 1,576. A possible promoter was searched for using the computer program “Genetyx” (Software Development, Tokyo) and a -35 region starts from position 209

1, Gel

and a - 10 region starts from position 232. Peptidase B consists of 420 amino acid residues and the first 40 amino acids but not the 41st exactly matched the fdx 3’ region (fragment) of the E. coli hypothetical protein YfhI. The discrepancy at the 41st amino acid is because the nucleotide sequence we determined and that in the GenBank (U01827) differ at nucleotide position 406. There are also several differences in the nucleotide sequences in the overlapping region of our sequence and U01827. We checked our sequence data carefully and concluded that the sequence presented in Fig. 3 is correct. The molecular weight of the peptidase B subunit was calculated to be 45,666 from sequence data which coincides well with that estimated from SDS-PAGE data. Homology search By using the Blast program we found that the peptidase B amino acid sequence gave high scores with those of aminopeptidase As (EC 3.4.11.1) from Haemophilus injluenzae and E. coli K-12, and those of cytosol aminopeptidases formerly called leutine aminopeptidases (EC 3.4.11.1) or proline aminopeptidases (EC 3.4.11.5) from bovine, potato (Solanum tuberosum), and mouse-ear cress (Arabidopsis thaliana). The amino acid sequences of peptidase D (EC 3.4.13.3), peptidase M (EC 3.4.11.18), peptidase N (EC 3.4.11.2), peptidase P (EC 3.4.11.9), and peptidase T of E. coli K12 have no significant similarity with that of peptidase B. Amino acid sequence alignments of peptidases giving high scores by Blast analysis were performed using the Genetyx and the Blast programs (Fig. 4). The amino acid sequence of the central region of these aminopeptidase As and cytosol aminopeptidases showed strong similarity with that of the central region of peptidase B of E. coli K-12. Using the Motif program we found that peptidase B has an absolutely conserved octapeptide sequence, NTDAEGRL (Fig. 4), known as a zinc/manganese binding site and a so-called cytosol aminopeptidase signature (32-34) in the central region. This suggests that peptidase B belongs to peptidase family Ml7

NOTES

VOL. 82, 1996

395

NsiI

1 81 161 241

ATGCATCAGTGGATTTGCGATCTGGAAGATTTCGATTTCGACGACGACCCG~G~TCC~C~G~TCCTCG~~GATTTTG TTAGTCTGGCTGGACGAGGCCGAATAATTTCCGCGTCATGCTTCACGCCGCAGATGCGTTGGCTGCGCTCGTTCACCCCA GTCACATAGTTATCTATGCTCCTGGGGCTTCACTCACTTGCCGCCTTC~CGCGAATCATTTAGCGGBBBBBTCCT -35 -10 GGGGCTGCCAACTGGCGGCCCTTTTACAAAG~TAACTATGACAGAAGCGATGAAGATTACCCTCTCTACCCAA SD

(1) 321 (13) 401 (40) 481

MTEAMKITLSTO

CCTGCCGACGCGCGCTGGGGAGAAAAAGCAACTTACAGCATTAATAATGACGGCATTACCCTGCATTTGAACGGGGCAGA PADARWGEKATYSINNDGITLHLNGAD CGATCTGGGGCTGATCCAGCGTGCGGCGCGCAAGATTGACGGTCTGGGCATCAAGCATGTTCAGTTAAGCGGTGAAGGCT LLALIQRAARK IDGLGIKHVQLSGEG GGGATGCGGATCGCTGCTGGGCATTCTGGCAAGGTTACAAAGCCCCGAAAGGCACGCGTAAAGTGGTGGTGTGGCCGGATCTG YKAPKGTRKVVWPDL

(66) WDADRCWAFWQG 561 (93) 641 (120) 721 (146) 801 (173) 881 (200)

GACGATGCCCAGCGCCAGGAACTGGATAACCGCCTGATGATCATCGACTGGGTGCGTGACACCATCAACGCACCGGCAGA DDAQRQELDNRLMIIDWVRDTINAPAE AGAATTGGGACCATCGCAACTGGCACAGCGTGCTGTTGATCTGATCAGCAACGTCGCGGGCGATCGTGTGACTTATCGGA ELGPSQLAQRAVDLI SNVAGDRVTYR TCACCAAAGGCGAAGATCTGCGTGAGCCAGGTTATATGGGGCTGCACACAGTCGGACGCGGTTCA~CGTTCTCCGGTA I TKGEDLREPGYMGLHT VGRGSERSPV TTGCTGGCGCTGGATTACAACCCAACTGGCGATAG~GCGCCAGTGTACGCGTGCCTGGTAGGTAAAGGTATCACTTT LLALDYNPTGDKEAPVYACLVGKGITF TGACTCCGGCGGCTACAGCATCAAACAGACTGCGTTTATGGACTCGATGAAGTCGGACATGGGCGGCGCGGCAACGGTTA DSGGYSIKQTAFMDSMKSDMGGAATV

CCGGGGCGCTGGCATTTGCCATTACGCGCGGACTGAACAAGCGCGTGAAGCTGTTCCTCTGCTGTGCGGATAACCTGATT 961 TRGLNKRVKLFLCCADNLI (226) TGALAFAI EcoRV

AGCGGCAATGCGTTCAAGCTGGGCGATAT~ATCACCTATCGCAACGGT UGTTGAAGTGATGAACACTGATGCCGA SGNAFKLGDI ITYRNGKKVEVMNTDAE (253)

1041

(280)

AGGGCGTCTGGTGCTTGCCGATGGTCTGATTGATGCCAGTGCGCAGAAACCGGAAACCCTCA GRLVLADGLIDASAQKPEMI IDAATL

1201

CCGGGGCGGCGAAAACTGCGCTGGGTAATGATTATCACGCGCTGTTCAGTTTTGACGATGCGCTGGCCGGTCGCTTGCTG

1121

(306) TGAAKTALGNDYHALFSFDDALAGRLL

PVUII GCGAGTGCCGCGCAGGAGAACGAACCGTTCTGGCGTTCTGGCGTCTGCCGCTGGCGGAGTTCCACCGCAGC~CCGTCT~CTT ASAAQENEPFWRLP LAEFHRSQLP S N F (333)

1281

(360)

TGCCGAACTGAACAATACCGGAAGCGCGCGGCGTATCCGGCAGGCGCGACACGGCGGCGGGCTTCCTGTCGCACTTTGTTGA AELNNTGSAAYPAGATRRRASCRTLL

1441

GAACTATCAGCAAGGCTGGCTGCATATCGACTGCTCGGCGACTTACCGTAAAGCGCCGGTTGAACAGTGGTCTGCGGGCG

1361

(386) RTISKAGCISTARRLTVKRRLNSGLRA 1521 (413)

CTACGGGACTTGGTGTGCGCACGATAGCTAATCTGTTAACTAT

GCCGGATGCGGCGTAAACGCCT

LRDLVCAR* stu1

1601

~CGGCCTACAAATTCTGCAAATTCAACAAATTGCGAATCCCTTGT~GATAAGCGTAGCGCATCAGGCATTTGCGC

1681

CCCGAACGTTGAATGAATTGTGGTTCTTATGTCCGAAACAAAAAA CGAACTTGAAGACCTGCTGGAAAAAGCAGCAACTG AACCGGCGCACCGCCCGGCCTTTTTCCGTA

1761

FIG. 3. Nucleotide sequence of E. co/ipepB and the deduced amino acid sequence. Nucleotide residues are numbered in the 5’-to-3’direction, beginning with the S-end residue A of the NsiI site. The deduced amino acid sequence is given below the nucleotide sequence. The double line below the amino acid sequence shows the amino acid sequence matched with that obtained by protein sequencing. The single line shows the extent of amino acid sequence matching with the hypothetical protein YfhI in SwissProt (P37095). The boxed amino acid sequence is the sequence which exactly matches the cytosol aminopeptidase signature (34). The nucleotide sequences corresponding to a possible promoter, the Shine-Dalgarno sequence (31), and a possible terminator are shown by double lines below the sequence. The single lines below the nucleotide sequence indicate the recognition sites for the restriction endonucleases noted.

396

SUZUKI ET AL.

J.

* AMPB_ECOLI AMPA ECOLI AMPA-HAEIN AMPL-BOVIN AMPL-SOLTU AMPLARATH -

181 257 250 231 309 275

AMPB_ECOLI AMPA_ECOLI AMPA_HAEIN AMPL BOVIN AMPL-SOLTU AMPLARATH -

248 323 316 303 379 344

*

TGDKEAPVYA NASEDARP IV APDKNAKPIV SPNASEPPLV TNSRERKT PNGSVKTK

*

FERMENT.BIOENG.,

*

AI -VSAAKL LGEIKPRGV IGEIKPPGV DY HI HN GA sv SM

FIG. 4. Sequence alignment to determine sequence similarity among E. co/i peptidase B (AMPB_ECOLI), E. coli aminopeptidase A (AMPA ECOLI) (SwissProt accession number P11648), H. injluenzae aminopeptidase A (AMPA HAEIN) (P45334), and bovine, potato, and cress cyt%sol aminopeptidases (AMPL BOVIN, AMPL SOLTU, and AMPL ARATH, respectzely) (PO0727, P31427, and P30184, respectively). Only highly similar regions in&ding the octape$ide cytosol aminopepiidase signature (underlined) is shown. Amino acid sequences, except that of peptidase B, were obtained from SwissProt. Amino acid residues are shaded when more that four of these sequences contained the same amino acid at the same position. Asterisks above the amino acid residues indicate a possible metal binding site in the bovine aminopeptidase (32). Hyphens represent gaps introduced to optimize sequence alignments.

and is a metallopeptidase (34). We also found that all amino acid residues comprising the metal binding sites of bovine aminopeptidases (32) are conserved in the central region of peptidase B (Fig. 4). However, in the N-terminal region about 100 amino acid residues of peptidase B and the other peptidases showed no sequence similarity. The C-terminal amino acid sequences of peptidase B and these other peptidases exhibit only slight similarity. These results indicate that the amino acid sequence of the central region of peptidase B has sequence generating aminopeptidase activity. In fact, in the case of bovine aminopeptidase, the N-terminal 137 amino acids of the protein could be cleaved off by trypsin without loss of enzymatic activity nor the hexameric structure (35). Nterminal and C-terminal regions of peptidase B might be the regions that confer different properties on peptidase B compared with aminopeptidase As and cytosol aminopeptidases, although we do not know how these peptidases are different, since peptidase B has never been purified from E. coli K-12 nor S. typhimurium and its enzymatic characteristics have never been studied. Now since we can purify peptidase B easily from strain SH949 which over-produces it, we intend to study the enzymatic properties of this enzyme. We thank Drs. C. A. Gross (University of California, San Francisco), C. G. Miller (University of Illinois, Urbana-Champaign), A. Nishimura (National Institute of Genetics), and S. N. Cohen (Stanford University) for kind gifts of their strains and plasmid pACYC184. We are indebted to Drs. Y. Uchida and H. Yukawa (Tsukuba Research Center, Mitsubishi Chemical Co.) for N-terminal amino acid sequencing of peptidase B. We wish to thank Drs. J.-H. Roh, H. Yamagata, and H. Yukawa (Research Institute of Innovative Technology for the Earth) for letting us use their DNA sequencing facilities. This work was partly supported by Research Grants-in-Aid nos. 06453168 and 07556023 from the Ministry of Education, Science and Culture, Japan to HK and by Promotive Research Grant from Japan Bioindustry Association to HS.

REFERENCES 1. Miller, C. G. and Schwartz, G.: Peptidase-deficient mutants of Escherichiu coli. J. Bacterial., 135, 603-611 (1978). 2. Miller, C. G.: Genetics and physiological roles of Salmonella typhimurium peptidases. Microbiology-1985, 346-349 (1985). 3. Miller, C. G.: Protein degradation and proteolytic modification. D. 680-691. In Neidhardt, F. C., Inaraham, J. L., Low, K. b.,- Magasanik, B., Schaechier, Ml, &d Umbarger,. H. E: (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. (1987). 4. Stirling, C. J., Colloms, S. D., Collins, J. F., Szatmari, G., and Sherratt, D. J.: xerB, an Escherichia coli gene required for plasmid ColEl site-specific recombination, is identical to pepA, encoding aminopeptidase A, a protein with substantial similarity to bovine lens leucine aminopeptidase. EMBO J., 8, 16231627 (1989). 5. Klein, J., Henrich, B., and Plapp, R.: Cloning and expression of the pepD gene of Escherichia coli. J. Gen. Microbial., 132, 2337-2343 (1986). 6. Henrich, B., Monnerjahn, U., and Plapp, R.: Peptidase D gene @epD) of Escherichiu coli K-12: nucleotide sequence, transcript mapping, and comparison with other peptidase genes. J. Bacterial.. 172. 4641-4651 (1990). 7. MeCamao, M.‘T. and Villa;ejo,‘M. R.: Structural and catalytic properties of peptidase N- from Escherichia coli. Arch. Biochem. Biovhvs.. 213. 384-394 (1982). 8. McCaman, G. i. and dabe, J. D.: Thd nucleotide sequence of the pepN gene and its over-expression in Escherichia coli. Gene, 48, 145-153 (1986). 9. Foglino, M., Gharbi, S., and Lazdunski, A.: Nucleotide sequence of the pepN gene encoding aminopeptidase N of Escherichia co/i. Gene, 49, 303-309 (1986). 10. Miller, J. H.: Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1972). 11. Suzuki, H., Kumagai, H., and Tochikura, T.: Isolation, genetic mapping, and characterization of Escherichia coli K-12 mutants lacking y-glutamyltranspeptidase. J. Bacterial., 169, 3926-3931 (1987). 12. Singer, M., Baker, T. A., Scbnitzler, G., Deischel, S. M., Gael, M., Dove, W., Jaacks, K. J., Grossman, A., Erickson, J. W., and Gross, C. A.: A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia co/i. Microbial. Rev., 53, l-24 (1989).

NOTES

VOL. 82, 1996 13. Maniatis, T., Fritscb, E. F., and Sambrook, J.: Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1982). 14. Sanger, F., Nicklen, S., and CouIson, A. R.: DNA sequencing with chain-terminating inhibitor. Proc. Natl. Acad. Sci. USA, 74, 5463-5467 (1977). 15. Umbarger, H. E.: The biosynthesis of isoleucine and valine and its regulation, p. 245-266. In Herrmann, K. and Somerville, R. L. (eds.), Amino acids: biosynthesis and genetic regulation. Addison-Wesley, Reading, MA (1983). 16. Henrich, B. and Plapp, R.: Locations of the genes from pepD through prd on the physical map of the Escherichia co/i chromosome. J. Bacterial., 173, 7407-7408 (1991). 17. Latil, M., Murgier, M., Lazdunski, A., and Lazdunski, C.: Isolation and genetic mapping of Escherichia coli aminopeptidase mutants. Mol. Gen. Genet., 148, 43-47 (1976). 18. McCaman, M. T., McPartIand, A., and ViIlarejo. M. R.: Genetics and regulation of peptidase N in Eschericka coli K12. J. Bacterial., 152. 848-854 (1982). 19. Green, L. and hei, C. G.: bene& mapping of the Salmonella typhimurium pepB locus. J. Bacterial., 143, 1524-1526 (1980). 20. Sanderson, K. E. and Roth, J. R.: Linkage map of Salmonella typhimurium, edition VII. Microbial. Rev., 52, 485-532 (1988). 21. Clarke, L. and Carbon, J.: Selection of specific clones from colony banks by suppression or complementation tests. Methods Enzymol., 68, 396-408 (1979). 22. Nisbimura, A., Aklyama, K., Kobara, Y., and Horiocbi, K.: Correlation of a subset of the pLC plasmids to the physical mau of Escherichia coli K-12. Microbial. Rev., 56, 137-151 (1992). 23. Davis, D. J.: Disc electrophoresis-II. Method and application to human serum proteins. Ann. N. Y. Acad. Sci., 121, 404-427 (1964). 24. Miller, CC. and Mackinnon, K.: Peptidase mutants of Salmonella typhimurium. J. Bacterial., 120, 355-363 (1974). 25. Kobara, Y., Akiyama, K., and Isono, K.: The physical map of

26.

27.

28.

29.

30.

31.

32.

33.

34. 35.

397

the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell, 50, 495-508 (1987). Cbang, A. C. and Cohen, S. N.: Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacterial., 134, 11411156 (1978). Maeda, T., Tacbi, K., Kojima, K., and Okayama, T.: Twodimensional electronhoresis of nlasma uroteins without denaturing agents. J. Biocdem., 85, 649-659 (i979). Hirano, H.: Microsequence analysis of proteins electroblotted from polyacrylamide gels. Protein, Nucl. Acid Enzyme, 33, 2388-2396 (1988). AItscbuI, S. F., Gisb, W., Miller, W., Myers, E. W., and Lipman, D. J.: Basic local alignment search tool. J. Mol. Biol.. 215, 403-410 (1990). Kawula, T. H. and Lelivelt, M. J.: Mutations in a gene encoding a new Hsp70 suppress rapid DNA inversion and bgl activation, but not proll derepression, in hns-I mutant Escherichia co/i. J. Bacterial., 176, 610-619 (1994). Shine, J. and DaIgarno, L.: The 3’-terminal sequence of Escherichia coli 16s ribosomal RNA: complementarity to nonsense triplets and ribosome binding site. Proc. Natl. Acad. Sci. USA, 71, 1342-1346 (1974). Kim, H. and Lipscomb, W. N.: Differentiation and identification of the two catalytic metal binding sites in bovine lens leucine aminopeptidase by X-ray crystallography. Proc. Natl. Acad. Sci. USA, 90, 50065010 (1993). McCuIlocb, R., Burke, M. E., and Sberratt, D. J.: Peptidase activity of Escherichia cob’ aminopeptidase A is not required for its role in Xer site-specific recombination. Mol. Microbial., 12, 241-251 (1994). Rawlings, N. D. and Barrett, A. J.: Evolutionary families of metallopeptidases. Methods Enzymol., 248, 183-228 (1995). van Loon-Klassen, L., Cuypers, H. T., and BIoemendaI, H.: Limited tryptic digestion of bovine eye lens leucine aminopeptidase. FEBS Lett., 107, 366-370 (1979).