mTOR pathway

mTOR pathway

Journal Pre-proof Matrine pre-treatment suppresses AGEs- induced HCSMCs fibrotic responses by regulating Poldip2/mTOR pathway Wangxia Ma, Jing Xu, Yon...

9MB Sizes 0 Downloads 0 Views

Journal Pre-proof Matrine pre-treatment suppresses AGEs- induced HCSMCs fibrotic responses by regulating Poldip2/mTOR pathway Wangxia Ma, Jing Xu, Yong Zhang, Hong Zhang, Zhu Zhang, Liqin Zhou, Xincheng Wang, Hongbo Liu, Yani Chen, Peng Du, Ningbin Min, Zhongwei Liu, Yanrong Yin PII:

S0014-2999(19)30698-3

DOI:

https://doi.org/10.1016/j.ejphar.2019.172746

Reference:

EJP 172746

To appear in:

European Journal of Pharmacology

Received Date: 27 August 2019 Revised Date:

15 October 2019

Accepted Date: 17 October 2019

Please cite this article as: Ma, W., Xu, J., Zhang, Y., Zhang, H., Zhang, Z., Zhou, L., Wang, X., Liu, H., Chen, Y., Du, P., Min, N., Liu, Z., Yin, Y., Matrine pre-treatment suppresses AGEs- induced HCSMCs fibrotic responses by regulating Poldip2/mTOR pathway, European Journal of Pharmacology (2019), doi: https://doi.org/10.1016/j.ejphar.2019.172746. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.

Matrine pre-treatment suppresses AGEs- induced HCSMCs fibrotic responses by regulating Poldip2/mTOR pathway

Wangxia Ma1,2,3*, Jing Xu2*, Yong Zhang2, Hong Zhang4, Zhu Zhang4, Liqin Zhou4, Xincheng Wang3, Hongbo Liu3, Yani Chen3, Peng Du3, Ningbin Min5, Zhongwei Liu2, Yanrong Yin1

1

Department of Cardiology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an,

Shaanxi Province, China 2

Department of Cardiology, Shaanxi Provincial People’s Hospital, Xi’an, Shaanxi Province,

China 3

Department of Cardiology, Zhouzhi County People’s Hospital, Xi’an, Shaanxi Province,

China 4

Department of Cardiology, The First Affiliated Hospital of Baotou Medical College, Baotou,

the Nei Monggol Autonomous Region, China 5

Department of Cardiology, Heyang County People’s Hospital, Weinan, Shaanxi Province,

China

Please correspond to: Prof. Yanrong Yin Department of Cardiology, The First Affiliated Hospital of Xi’an Jiaotong University,

Xi’an, China Email: [email protected]

Prof. Ningbin Min Department of Cardiology, Heyang County People’s Hospital, Weinan, China Email: [email protected]

Prof. Zhongwei Liu Department of Cardiology, Shaanxi Provincial People’s Hospital Xi’an, China Email: [email protected]

* Wangxia Ma and Jing Xu contributed equally to this work.

Abstract The fibrotic response of vascular smooth muscle cells (VSMCs) takes responsibilities in atherosclerosis. Advanced glycation end products (AGEs) induce and promote the fibrotic responses of VSMCs. Matrine shows potent anti-fibrotic and cardio-protective effects. This study was aimed to investigate the underlying mechanisms of matrine’s inhibitory effects on AGEs-induced VSMCs fibrotic responses. Cultured human coronary smooth muscle cells (HCSMCs) were pre-treated with matrine and exposed to AGEs. Specific siRNA was used to silence polymerase delta interacting protein 2 (Poldip2) expression. Sircol collagen assay was used to assess collagen content. Protein expression and phosphorylation levels were determined by Western blotting. Matrine pre-treatment significantly reduced collagen content, increased smooth muscle myosin heavy chain 11 (MYH11) and Poldip2 expression, decreased expressions of collagen I, β1-integrin, phsphoinositide-3-kinase (PI3K) and nuclear phosphorylated p70S6k, and reduced phosphorylation levels of protein kinase B (Akt) and mechanistic target of rapamycin (mTOR) in HCSMCs exposed to AGEs in a concentration dependent manner. Specific siRNA effectively silenced Poldip2 expression and impaired matrine’s effect on collagen content, expressions of MYH11, collagen I, β1-integrin, PI3K, nuclear p-p70S6k and phosphorylation levels of Akt and mTOR in HCSMCs exposed to AGEs. Matrine suppresses AGEs- induced fibrotic responses in HCSMCs via regulating Poldip2/mTOR signaling pathway. Keywords: Matrine; Advanced glycation end products; Vascular smooth muscle cells; Fibrosis; Poldip2; mTOR signaling pathway

1. Introduction Atherosclerotic vascular disease is one of the leading causes of death worldwide which is highly associated with diabetes(Zeadin et al., 2013). Promoted formation and progression of atherosclerotic plaques are characterized pathological features of diabetes. Under condition of type 2 diabetes mellitus (T2DM), advanced glycation end products (AGEs) are fertilized after set of non-enzymatic glycation reactions. It has been accepted that AGEs exacerbated progression and vulnerability of atherosclerotic plaques which is associated with the adverse outcomes of atherosclerosis(de Vos et al., 2016; Nenna et al., 2015). The role of AGEs in inducing proliferation and migration of VSMCs has been proposed(Simard et al., 2015).

VSMCs are basic components of arterial vessel wall, participating in maintaining the integrity and function of arteries. VSMCs exhibit diverse phenotypes to adjust different conditions(Bennett et al., 2016). Under normal physiological conditions, by conducting contraction and relaxation, the contractile phenotype of VSMCs is crucial for preserving vascular tone. However, when encountering harmful stimuli, the VSMCs phenotype conversion takes place(Basatemur and Jorgensen, 2019). Our previous investigation suggested that AGEs triggered the phenotypic conversion of human coronary smooth muscle cells (HCSMCs) from contractile to synthetic phenotype(Liu et al., 2018a). VSMCs lose its contractibility and produce excessive extracellular matrix (ECM), taking part in arterial stiffing, stenosis and atherogenesis.

Deletion of polymerase delta interacting protein 2 (Poldip2) was reported to increase the ECM synthesis in VSMCs(Fujii et al., 2016). The mechanistic target of rapamycin (mTOR) was recognized as one of the down-stream effectors of Poldip2(Fujii et al., 2016). Poldip2 knocking down resulted in activation of mTOR signaling in VSMCs, which further promoted expression of ECM proteins by phosphorylating its down-stream translational modulator 70-kDa ribosomal S6 kinase (p70S6k)(Ai et al., 2015). According to a very recent study, the expression of Poldip2 was found decreased in T2DM model(Jiang et al., 2019). Moreover, mTOR signaling also played roles in phenotypic modulation of VSMCs(Sun et al., 2018). Thus, it is reasonable for us to hypothesize that under circumstance of T2DM, AGEs may down regulate expression of Poldip2, leading to activation of mTOR signaling and resulting in contractile- synthetic phenotypic conversion of VSMCs.

In recent decades, bio-active agents extracted from natural medical herbs have been attracting researchers’ attention due to their effectiveness and bio-safety. Matrine has been proved cardiac and vascular protective. Our previous study showed that matrine attenuated AGEsinduced contractile- synthetic phenotypic conversion of HCSMCs(Liu et al., 2018a). Our pilot experiments indicated that matrine incubation suppressed the down-regulation of Poldip2 in HCSMCs. In the current study, HCSMCs were exposed to AGEs. Specific siRNA knocking-down poldip2 and/or matrine were used to treat HCSMCs. The involvement of Poldip2/mTOR pathway in contractile- synthetic phenotypic conversion was investigated. We believe that our results would not only add more understanding of molecular mechanisms of VSMC contractile- synthetic phenotypic conversion, but also provide more evidence for

potential clinical application of matrine in treatment of atherosclerotic vascular diseases.

2. Materials and Methods 2.1. AGEs-BSA preparation The preparation of AGEs-BSA was performed according to our previous descriptions(Liu et al., 2017; Liu et al., 2018b). Briefly, bovine serum albumin (BSA, Hyclone) was incubated with 0.1 mmol/l glyceraldehyde (Sigma-Aldrich) under sterile condition in 0.2mmol/l NaPO4 buffer (pH=7.4) at 37℃ for consecutive 7 days. After chromatography with PD-10 desalting columns (GE healthcare) and dialysis against phosphate buffered saline (PBS), the unicorporated sugars were cleared. Nonglycated BSA was used as control which was processed with the same protocol without glyceraldehyde incubation.

2.2. Cell culture HCSMCs preserved in our lab were recovered and maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with antibiotics mix (Invitrogen) in a cell incubator providing humidified atmosphere composed of 95% fresh air and 5% CO2 at 37℃. When reached 90% confluence, the cultured HCSMCs were used for subsequent experiments. The cell treatment protocol was carried out in accordance with our previous investigations(Liu et al., 2018a). Cells were treated with AGEs at final concentrations of 0, 5 and 10µmol/l for 24 h. Several cells treated with AGEs at 10µmol/l were pre-treated with matrine at 0, 0.25, 0.5, 0.75 and 1.0mmol/l for 48 h. Several cells were also pre-treated with specific siRNA silencing poldip2.

2.3. siRNA transfection In this study, expression of poldip2 was silenced by siRNA transfection technique in cultured HCSMCs. The sequence of siRNA against poldip2 was: sense: 5’GCCCACAUAUAUCUCAGAGAUCUCA3’, antisense: 5’UGAGAUCUCUGAGAUAUAUGUGGGC3’. The poldip2-siRNA was synthesized by GenePharma (Shanghai, China). SignalSilence Control siRNA (Cell Signaling Technology) was used as negative control. The siRNAs were transfected into cultured HCSMCs by using Mirus TransIT-TKO reagent (Mirus Bio LLC) for 48 h in accordance to the manufacturer’s instructions.

2.4. Sircol collagen assay The content of secreted collagen in cultured HCSMCs was detected by Sircol collagen assay (SCA) which was carried out in accordance with our previous descriptions(Liu et al., 2018a). A commercially available SCA kit (Biocolor Life Science) was used by following the instructions provided by the manufacturer.

2.5. Western blotting Cell lysis buffering system (Santa Cruz) supplemented with PMSF (Santa Cruz) was used to treat HCSMCs. Total protein was extracted with Total Protein Extraction Reagents (Beyotime) and nuclear protein was extracted with Nuclear Protein Extraction Reagents (Beyotime) according to the protocols suggested by the manufacturer. The concentrations of the protein

samples were determined by BCA method. After separated by vertical sodium dodecyl sulfate -polyacrylamide gel electrophoresis (SDS-PAGE), the proteins were then transferred to polyvinylidene fluoride (PVDF) membranes. Primary antibodies against smooth muscle myosin heavy chain (MYH11, Abcam, 1:1000), collagen I (Abcam, 1:2000), Poldip2 (Abcam, 1:2000), β1-integrin (Abcam, 1:1000), phsphoinositide-3-kinase (PI3K, Cell Signaling Tech, 1:2000), protein kinase B (Akt, Cell Signaling Tech, 1:2000), phospho-Akt (p-Akt, Cell Signaling Tech, 1:2000), mTOR (Abcam, 1:2000), phospho-mTOR (p-mTOR, Abcam, 1:2000), phospho-p70S6k (p-p70S6k, Abcam, 1:2000), Histone H3 (Abcam, 1:2000) and GAPDH (Abcam, 1:2000) were used to incubate the membranes at 4℃ for 8 h. GAPDH and Histone H3 were introduced as the internal reference for total protein and nuclear protein samples respectively. The membranes were washed by 0.02% Tris-buffered saline-Tween20 (TBST) and then incubated with secondary antibodies conjugated to HRP (Abcam) at room temperature for 2 h. The immunoblots were visualized on X-ray films after developed by Super Signal West Pico chemiluminescence reagent (Invitrogen).

2.6. Statistics Data were presented in a (mean ± S.D.) manner and analyzed by using software SPSS (version16.0). One-way ANOVA were carried out to determine the significance of differences between groups. Tukey’s test was performed as post-hoc test. Compared differences were considered statistically significant when P<0.05.

3. Results

Matrine suppressed AGEs-induced HCSMCs contractile-synthetic phenotypic conversion and fibrotic responses The results were demonstrated in Fig1. Incubation of AGEs at serially diluted concentrations significantly decreased the expression levels of Poldip2 and MYH11 but increased expression levels of Collagen I in a concentration- dependent manner. Matrine pre-treatment dramatically increased the expression levels of Poldip2 and MYH11 but decreased expression levels of Collagen I in VSMCs exposed to AGEs at 10µmol/l in a concentration- dependent manner.

Matrine pre-treatment suppressed activation of PI3K/Akt/mTOR signaling by increasing Poldip2 expression in AGEs- incubated HCSMCs The results were showed in Fig2. AGEs incubation significantly increased the expression levels of β1-integrin and PI3K as well as the phosphorylation levels of Akt, mTOR and p70S6k in a concentration-dependent manner. Moreover, the expression levels of p-p70S6k in nuclei were also found increased significantly in HCSMCs exposed to AGEs in a concentration- dependent manner. The matrine pre-treatment, however, reduced the expression levels of β1-integrin and PI3K as well as the phosphorylation levels of Akt, mTOR and p70S6k in 10µmol/l AGEs- exposed HCSMCs in a matrine- concentration dependent manner. Moreover, matrine pre-treatment also decreased the expression level of p-p70S6k in nuclei of HCSMCs exposed to AGEs at 10µmol/l in a concentration-dependent manner.

Poldip2 silencing impaired suppressing effects of matrine pre-treatment on AGEs- induced HCSMCs contractile-synthetic phenotypic conversion and fibrotic responses As demonstrated in Fig3, matrine pre-treatment significantly increased the expression levels of Poldip2 and MYH11 but reduced Collagen I expression levels and collagen content in HCSMCs exposed to AGEs at 10µmol/l. siRNA transfection significantly reduced expression levels of Poldip2 in HCSMCs. The siRNA transfection also dramatically impaired matrine’s promoting effect on MYH11 expression and inhibitory effect on Collagen I expression in HCSMCs exposed to AGEs at 10µmol/l.

Deletion of Poldip2 increased activation of PI3K/Akt/mTOR signaling in matrine- pre-treated HCSMCs exposed to AGEs As shown in Fig4, matrine pre-treatment significantly decreased the expression levels of β1-integrin and PI3K as well as the phosphorylation levels of Akt and mTOR in HCSMCs exposed to AGEs at 10µmol/l. Moreover, matrine pre-treatment also decreased the expression levels of p-p70S6k in nuclei in HCSMCs exposed to AGEs at 10µmol/l. The poldip2-siRNA transfection dramatically impaired the matrine’s effects on decreasing expression levels of β1-integrin and PI3K, the phosphorylation levels of Akt and mTOR and the nuclear expression levels of p-p70S6k in HCSMCs exposed to AGEs at 10µmol/l.

4. Discussion The incidence, mortality and morbidity of T2DM are increasing rapidly worldwide. AGEs are a set of substance produced under condition of un-treated and uncontrolled T2DM. It was

believed that elevation of AGEs level was associated with formation of atherosclerotic plaques(de Vos et al., 2016). VSMCs take responsibilities in maintaining the integrity and physiological functions of arteries. Contractile-synthetic phenotypic conversion of VSMCs is one of the features of atherosclerosis(Wang et al., 2017). Our previous investigation suggested that AGEs exposure facilitated cultured HCSMCs converted into synthetic phenotype which exhibited fibrotic responses(Liu et al., 2018a).

Several molecular mechanisms underlying contractile-synthetic phenotypic conversion of VSMCs were proposed. In this present study, we found that Poldip2- regulated mTOR signaling pathway was involved in. Poldip2 took responsibilities in several signaling pathways related with fundamental cellular biological functions. Loss of Poldip2 enhanced ECM secretion VSMCs was suggested previously(Sutliff et al., 2013). Deletion of poldip2 was reported to increase transcription of β1-integrin which facilitated the activation of PI3K/Akt pathway(Fujii et al., 2016). In this study, we found that the expression of Poldip2 was significantly down-regulated, leading to up-regulation of β1-integrin in AGEs- incubated HCSMCs. As a result, PI3K/Akt signaling was activated which further stimulated mTOR. As one of the critical down-stream effectors of mTOR, p70S6k is activated after phosphorylation and translocates to cell nucleus, causing transcription initiation of ECM proteins(Laplante and Sabatini, 2012). Our results showed that AGEs exposure activated mTOR and facilitated nuclear accumulation of phosphorylated p70S6k, leading to contractile-synthetic phenotypic conversion and fibrotic responses in HCSMCs.

A natural medical herb with the name of Shan-Dou-Gen has been being used in treatment of diabetes and several vascular diseases in Traditional Chinese Medicine (TCM) from ancient times. Matrine, also known as C15H24N2O, is a key tetracyclo- quinolizindine alkaloids extracted from Shan-Dou-Gen (Sophora flavescens Aiton) (Fig5). Our team has been focusing on investigating matrine’s cardio-protective effects(Liu et al., 2017). According to one of our recent publication, matrine suppressed AGEs- induced contractile-synthetic phenotypic conversion and fibrotic responses in HCSMCs(Liu et al., 2018a). Similarly, in the current study, we found that matrine treatment inhibited contractile-synthetic phenotypic conversion of HCSMCs exposed to AGEs. As a result, evidenced by decreased collagen content, matrine also suppressed AGEs- induced fibrotic responses in cultured HCSMCs.

In order to further understand the role of Poldip2 in matrine’s effects on contractile-synthetic phenotypic conversion and fibrotic responses, siRNA was used to silent Poldip2 in HCSMCs. The results turned out that poldip2 silencing impaired matrine’s inhibitory effects on AGEsinduced contractile-synthetic phenotypic conversion and fibrotic responses in HCSMCs. Poldip2 silencing also increased the activation of PI3K/Akt/mTOR signaling in matrinetreated HCSMCs which were exposed to AGEs. These results suggested that Poldip2 was a molecular target for matrine. Fig5C demonstrated the concluded schematic mechanisms according to the results of this study. Briefly, the encountering of harmful stimuli such as AGEs facilitated the loss of Poldip2 which resulted in up-regulation of β1-integrin. After binding to its receptors, β1-integrin relieves the inhibition of PI3K which participates in the production of PIP3. As a result, the Akt/mTOR signaling is activated by specific

phsophorylation. Then the down-stream effecter, p70S6k is activated after phosphorylation which initiates the transcription of the ECM proteins. Matrine treatment up-regulates the expression of Poldip2 and thus exerts inhibitory effect on the fibrotic responses.

In summary, data from our current investigation proposed that: 1. AGEs induced contractile-synthetic phenotypic conversion and fibrotic responses in HCSMCs by regulating Poldip2/mTOR signaling. 2. Poldip2 was recognized as one of the targets for matrine in inhibiting AGEs- induced contractile-synthetic phenotypic conversion and fibrotic responses of HCSMCs.

Founding Sources This study was supported by National Scientific Foundation of China (No. 81600646); Health Research Foundation of Shaanxi Province (2018E011); Innovative Talents Promotion Project of Shaanxi Province (2019KJXX-019).

References Ai, F., Chen, M., Yu, B., Yang, Y., Xu, G., Gui, F., Liu, Z., Bai, X., Chen, Z., 2015. Berberine regulates proliferation, collagen synthesis and cytokine secretion of cardiac fibroblasts via AMPK-mTOR-p70S6K signaling pathway. International journal of clinical and experimental pathology 8, 12509-12516. Basatemur, G.L., Jorgensen, H.F., 2019. Vascular Smooth Muscle Cells in Atherosclerosis. Nat Rev Cardiol, doi: 10.1038/s41569-019-0227-9. Bennett, M.R., Sinha, S., Owens, G.K., 2016. Vascular Smooth Muscle Cells in Atherosclerosis. Circulation

research 118, 692-702. de Vos, L.C., Lefrandt, J.D., Dullaart, R.P., Zeebregts, C.J., Smit, A.J., 2016. Advanced glycation end products: An emerging biomarker for adverse outcome in patients with peripheral artery disease. Atherosclerosis 254, 291-299. Fujii, M., Amanso, A., Abrahao, T.B., Lassegue, B., Griendling, K.K., 2016. Polymerase delta-interacting protein 2 regulates collagen accumulation via activation of the Akt/mTOR pathway in vascular smooth muscle cells. Journal of molecular and cellular cardiology 92, 21-29. Jiang, Z., Zhou, J., Li, T., Tian, M., Lu, J., Jia, Y., Wan, G., Chen, K., 2019. Hepatic deficiency of Poldip2 in type 2 diabetes dampens lipid and glucose homeostasis. Metabolism: clinical and experimental, 153948. Laplante, M., Sabatini, D.M., 2012. mTOR signaling in growth control and disease. Cell 149, 274-293. Liu, Z., Lv, Y., Zhang, Y., Liu, F., Zhu, L., Pan, S., Qiu, C., Guo, Y., Yang, T., Wang, J., 2017. Matrine-Type Alkaloids Inhibit Advanced Glycation End Products Induced Reactive Oxygen Species-Mediated Apoptosis of Aortic Endothelial Cells In Vivo and In Vitro by Targeting MKK3 and p38MAPK Signaling. Journal of the American Heart Association 6, e007441 Liu, Z., Wang, Y., Zhu, H., Qiu, C., Guan, G., Wang, J., Guo, Y., 2018a. Matrine blocks AGEs- induced HCSMCs phenotypic conversion via suppressing Dll4-Notch pathway. European journal of pharmacology 835, 126-131. Liu, Z., Zheng, S., Wang, X., Qiu, C., Guo, Y., 2018b. Novel ASK1 inhibitor AGI-1067 improves AGE-induced cardiac dysfunction by inhibiting MKKs/p38 MAPK and NF-kappaB apoptotic signaling. FEBS open bio 8, 1445-1456. Nenna, A., Nappi, F., Avtaar Singh, S.S., Sutherland, F.W., Di Domenico, F., Chello, M., Spadaccio, C., 2015. Pharmacologic Approaches Against Advanced Glycation End Products (AGEs) in Diabetic Cardiovascular Disease. Research in cardiovascular medicine 4, e26949.

Simard, E., Sollradl, T., Maltais, J.S., Boucher, J., D'Orleans-Juste, P., Grandbois, M., 2015. Receptor for Advanced Glycation End-Products Signaling Interferes with the Vascular Smooth Muscle Cell Contractile Phenotype and Function. PloS one 10, e0128881. Sun, L., Zhao, M., Liu, A., Lv, M., Zhang, J., Li, Y., Yang, X., Wu, Z., 2018. Shear Stress Induces Phenotypic Modulation of Vascular Smooth Muscle Cells via AMPK/mTOR/ULK1-Mediated Autophagy. Cellular and molecular neurobiology 38, 541-548. Sutliff, R.L., Hilenski, L.L., Amanso, A.M., Parastatidis, I., Dikalova, A.E., Hansen, L., Datla, S.R., Long, J.S., El-Ali, A.M., Joseph, G., Gleason, R.L., Jr., Taylor, W.R., Hart, C.M., Griendling, K.K., Lassegue, B., 2013. Polymerase delta interacting protein 2 sustains vascular structure and function. Arteriosclerosis, thrombosis, and vascular biology 33, 2154-2161. Wang, T.M., Chen, K.C., Hsu, P.Y., Lin, H.F., Wang, Y.S., Chen, C.Y., Liao, Y.C., Juo, S.H., 2017. microRNA let-7g suppresses PDGF-induced conversion of vascular smooth muscle cell into the synthetic phenotype. Journal of cellular and molecular medicine 21, 3592-3601. Zeadin, M.G., Petlura, C.I., Werstuck, G.H., 2013. Molecular mechanisms linking diabetes to the accelerated development of atherosclerosis. Canadian journal of diabetes 37, 345-350.

Figure Legends Fig1 A the immunoblots of Poldip2, MYH11, Collagen I and GAPDH in HCSMCs treated with AGEs and matrine at various concentrations were demonstrated. B columns indicated the relative expression levels of MYH11 and Collagen I in HCSMCs. C columns indicated the relative expression levels of Poldip2 in HCSMCs. D columns indicated the collagen content

in cell medium of HCSMCs treated with AGEs and matrine at various concentrations. [* differences were statistically significant]

Fig2 A demonstrated the immunoblots of β1-integrin, PI3K and GAPDH in HCSMCs treated with AGEs and matrine at various concentrations. B columns indicated the relative expression levels of β1-integrin, PI3K and mTOR. C demonstrated the immunoblots of p-Akt, Akt, p-mTOR and mTOR in HCSMCs treated with AGEs and matrine at various concentrations respectively. D columns indicated the relative phosphorylation levels of Akt and mTOR respectively. E demonstrated the immunoblots of p-p70S6k and Histone H3 in extracted nuclear protein samples in HCSMCs treated with AGEs and matrine at various concentrations. F columns indicated the relative expression levels of p-p70S6k in nuclear protein samples. [* differences were statistically significant]

Fig3 A the immunoblots of Poldip2, MYH11, Collagen I and GAPDH in poldip2-siRNAtransfected HCSMCs treated with AGEs and matrine at various concentrations were demonstrated. B columns indicated the relative expression levels of Poldip2, MYH11 and Collagen I in HCSMCs respectively. C columns indicated the relative expression levels of Poldip2 in HCSMCs. D columns indicated the collagen content in cell medium of poldip2-siRNA- transfected HCSMCs treated with AGEs and matrine at various concentrations. [* differences were statistically significant]

Fig4 A demonstrated the immunoblots of β1-integrin, PI3K and GAPDH in poldip2-siRNAtransfected HCSMCs treated with AGEs and matrine at various concentrations. B columns indicated the relative expression levels of β1-integrin and PI3K. C demonstrated the immunoblots of p-Akt, Akt, p-mTOR and mTOR in poldip2-siRNA- transfected HCSMCs treated with AGEs and matrine at various concentrations. D columns indicated the relative phosphorylation levels of Akt and mTOR respectively. E demonstrated the immunoblots of p-p70S6k and Histone H3 in extracted nuclear protein samples in poldip2-siRNA- transfected HCSMCs treated with AGEs and matrine at various concentrations. F columns indicated the relative expression levels of p-p70S6k in nuclear protein samples. [* differences were statistically significant]

Fig5 A Chemical structure of matrine. B Pictures of flavescens and its root. C Schematic diagram of the proposed molecular mechanisms. AGEs induced the loss of Poldip2 which results in the up-regulation of β1-integrin. Then the PI3K/Akt/mTOR/p70S6k signaling is activated, leading to increased synthesis of ECM proteins. Matrine up-regulates the expression of Podip2 and thus inhibits AGEs- induced fibrotic responses.