Membrane progesterone receptors localization in the mouse spinal cord

Membrane progesterone receptors localization in the mouse spinal cord

Neuroscience 166 (2010) 94 –106 MEMBRANE PROGESTERONE RECEPTORS LOCALIZATION IN THE MOUSE SPINAL CORD F. LABOMBARDA,a,b D. MEFFRE,a B. DELESPIERRE,a ...

5MB Sizes 10 Downloads 30 Views

Neuroscience 166 (2010) 94 –106

MEMBRANE PROGESTERONE RECEPTORS LOCALIZATION IN THE MOUSE SPINAL CORD F. LABOMBARDA,a,b D. MEFFRE,a B. DELESPIERRE,a S. KRIVOKAPIC-BLONDIAUX,a A. CHASTRE,a P. THOMAS,c Y. PANG,c J. P. LYDON,d S. L. GONZALEZ,b A. F. DE NICOLA,b M. SCHUMACHERa AND R. GUENNOUNa*

cellular distribution of mPR expression in the nervous system, a prior requirement for in vivo molecular and pharmacological strategies aimed to elucidate their precise functions. It thus represents a first important step towards a new understanding of progesterone actions in the nervous system within a precise neuroanatomical context. © 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

a

UMR788 Inserm and University Paris-Sud 11, Kremlin-Bicêtre, France

b

Instituto de Biologia y Medicina Experimental and Department of Human Biochemistry, University of Buenos Aires, Argentina

Key words: membrane progesterone receptor, progesterone, spinal cord, motoneuron, oligodendrocyte, astrocyte.

c

University of Texas at Austin, Marine Science Institute, Port Aransas, USA

d

Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, USA

Recent studies have identified the spinal cord as an important target for the actions of progesterone. After injury and in a genetic model of spontaneous motoneuron degeneration, progesterone has been shown to exert marked protective effects on motoneurons and to regulate the expression of genes involved in neuronal functions and viability (Labombarda et al., 2002; De Nicola et al., 2006; Schumacher et al., 2007). In addition, progesterone regulates the synthesis of astrocyte-specific proteins, including the intermediate filament glial fibrillary acidic protein (GFAP), and it targets cells of the oligodendrocyte lineage, promoting the maturation of oligodendrocytes and myelin formation (De Nicola et al., 2006; Labombarda et al., 2009). In a murine model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE), progesterone treatment attenuated disease severity and reduced inflammatory responses and the occurrence of demyelination (Garay et al., 2007). In spite of the multiple effects of progesterone at the level of the spinal cord, its signaling mechanisms remain poorly understood. It is likely that its transcriptional effects, also named genomic effects, involve intracellular progesterone receptors (PR), as their presence in the rodent spinal cord has been demonstrated (Labombarda et al., 2000a, 2003). However, the precise functions of the two PR isoforms, PR-A and PR-B, which have different transcriptional activities, still remain to be elucidated in the nervous system (Conneely and Jericevic, 2002). Furthermore, direct actions of progesterone on specific membrane receptors may also play an important role. Progesterone is indeed the first steroid hormone for which membrane receptors have been cloned and well characterized, thus opening up completely new perspectives for understanding its actions in the nervous system. Progesterone receptor membrane component 1 (PGRMC1), previously also named 25-Dx, was a first membrane progesterone receptor candidate to be cloned, but the capacity of the protein to bind progesterone and its precise functions remain controversial (Cahill, 2007; Losel et al., 2008). In the rat spinal cord, PGRMC1-immunoreactivity has been located to dor-

Abstract—The recent molecular cloning of membrane receptors for progesterone (mPRs) has tremendous implications for understanding the multiple actions of the hormone in the nervous system. The three isoforms which have been cloned from several species, mPR␣, mPR␤ and mPR␥, have seventransmembrane domains, are G protein-coupled and may thus account for the rapid modulation of many intracellular signaling cascades by progesterone. However, in order to elucidate the precise functions of mPRs within the nervous system it is first necessary to determine their expression patterns and also to develop new pharmacological and molecular tools. The aim of the present study was to profile mPR expression in the mouse spinal cord, where progesterone has been shown to exert pleiotropic actions on neurons and glial cells, and where the hormone can also be locally synthesized. Our results show a wide distribution of mPR␣, which is expressed in most neurons, astrocytes, oligodendrocytes, and also in a large proportion of NG2ⴙ progenitor cells. This mPR isoform is thus likely to play a major role in the neuroprotective and promyelinating effects of progesterone. On the contrary, mPR␤ showed a more restricted distribution, and was mainly present in ventral horn motoneurons and in neurites, consistent with an important role in neuronal transmission and plasticity. Interestingly, mPR␤ was not present in glial cells. These observations suggest that the two mPR isoforms mediate distinct and specific functions of progesterone in the spinal cord. A significant observation was their very stable expression, which was similar in both sexes and not influenced by the presence or absence of the classical progesterone receptors. Although mPR␥ mRNA could be detected in spinal cord tissue by reverse transcriptase–polymerase chain reaction (RT–PCR), in situ hybridization analysis did not allow us to verify and to map its presence, probably due to its relatively low expression. The present study is the first precise map of the regional and *Corresponding author. Tel: ⫹33-1-49-59-18-80; fax: ⫹33-1-45-21-19-40. E-mail address: [email protected] (R. Guennoun). Abbreviations: ANOVA, analysis of variance; EAE, experimental autoimmune encephalomyelitis; GFAP, glial fibrillary acidic protein; HTZ, heterozygous; mPRs, progesterone membrane receptors; PGRMC1, progesterone receptor membrane component 1; PR, progesterone receptors; RT–PCR, reverse transcriptase–polymerase chain reaction.

0306-4522/10 $ - see front matter © 2010 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2009.12.012

94

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

sal horn and central canal ependymal cells, but is absent in ventral horn motoneurons, which are important targets of progesterone (Labombarda et al., 2003; Guennoun et al., 2008). In 2003, a new family of progesterone membrane receptors (mPRs) was been cloned from seatrout ovaries (Zhu et al., 2003a,b). The mPRs, which have been subdivided into three subtypes (mPR␣, mPR␤ and mPR␥), are unrelated to the known nuclear receptors. However, they display characteristics of true receptors, including the structure of a membrane-spanning protein with seventransmembrane domains, plasma membrane localization, expression in steroid target tissues, selective steroid binding, regulation of intracellular signaling pathways and biological functions (Zhu et al., 2003b; Thomas, 2008). The best characterized subtype is mPR␣, which has been cloned from both fishes and mammals, including seatrout and humans (Zhu et al., 2003a). When expressed in a human breast cancer cell line, mPR␣ from both species displayed high affinity for progestin hormones, with a Kd⬇5 nM, which is however less than the affinity reported for the intracellular PRs (kd⬇0.3 nM) (MacLusky and Ewen, 1980). The mPR␣s showed a limited binding capacity for progestins, and they appear to be directly coupled to Gi proteins. Most importantly, competitive binding assays have revealed that recombinant mPR␣ exhibits a particular pharmacological profile, and that it does not bind a series of synthetic progestins designed to target intracellular PRs and used in contraception or hormone replacement therapy (HRT) (Thomas et al., 2007). mPR␣, mPR␤ and mPR␥ have recently been shown to mediate progesterone-dependent gene regulation at physiologically relevant concentrations (EC50 in the nM range) in a heterologous (yeast) expression system that was also used to confirm the unique progestin binding characteristics of the three receptors (Smith et al., 2008). Together, these findings raise hope for a new pharmacology of progestins, with the development of selective ligands for the membrane receptors. Whereas nothing is currently known concerning the expression patterns and regulation of the mPRs in the nervous system, they have begun to be explored in the mammalian reproductive tract. A recent study has provided evidence for the presence of mPRs in the rat corpus luteum, a tissue which responds to progesterone, but interestingly does not contain detectable levels of intracellular PR (Cai and Stocco, 2005). Both mPR␣ and mPR␤ are also expressed in human myometrium. In cultured human myometrial cells, mPR activation lead to the transactivation of PR-B and to a decrease in steroid receptor coactivator-2 (SRC-2) expression, thus suggesting a cross-talk between mPR and PR signaling (Karteris et al., 2006). Both mPR␣ and mPR␤ subtypes are also present in the preoptic anterior hypothalamic region of the rodent brain and in immortalized GnRHsecreting neurons (GT1–7 cells). Treatment with mPR␣ siRNA attenuated specific progesterone binding to GT1–7 cell membranes and reversed the progesterone inhibition of cAMP accumulation. These results suggest a role for

95

mPR␣ in mediating progesterone feedback on GnRH secretion (Thomas, 2008; Sleiter et al., 2009). However, understanding the physiological significance of mPRs in vivo will have to await the development of specific pharmacological tools (selective mPR agonists and antagonists) and the generation of transgenic mouse models of mPR deletion, in particular with targeted inactivation of the mPR genes in specific tissues or cell types. The use of antisense probes or siRNA for target-specific gene silencing offers another option for functional studies. However, a first requirement for all these experimental strategies to unmask mPR functions is to define the precise expression patterns of the different mPR types to cellular resolution, both at the mRNA and protein levels, and to study their regulation. Because of the well-documented and multiple effects of progesterone in the spinal cord, some of which are likely to involve membrane actions, the aims of the present study were to determine whether mPR␣, mPR␤ and mPR␥ are expressed and regulated by estradiol and progesterone in the mouse spinal cord, and to precisely map their regional and cellular distributions.

EXPERIMENTAL PROCEDURES Animals All procedures concerning animal care and use were carried out in accordance with the European Community Council Directive (86/ 609/EEC). Efforts were made to minimize the number of animals used and their suffering. Either 10-week-old male C57BL6 mice (Janvier, France), or adult male and female PR knockout (PRKO, PR⫺/⫺), heterozygous (HTZ, PR⫹/⫺) or the corresponding wildtype (WT, PR⫹/⫹, C57BL6/129SvEv hybrid background) mice were used in this study. Original breeders were provided by J. P. Lydon (Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, USA). The development of PRKO mice has been previously described (Lydon et al., 1995). The WT, HTZ and PRKO mice were housed separately, four animals per cage, with food and water available ad libitum. Genotyping. Each mouse was identified for its PR genotype by using a validated protocol (Lydon et al., 1995). Briefly, genomic DNA from mouse tails was extracted by the phenol/chloroform method and 1 ␮g of DNA was subjected to PCR amplification using taq DNA polymerase (Invitrogen, Inc.). PCR was performed by denaturing the DNA at 94 °C for 5 min, followed by 37 cycles of amplification: 94 °C for 1 min, 57 °C for 1 min, 72 °C for 1.5 min, and a final extension step at 72 °C for 10 min. The following PR-specific primers were used: P1 (5=-TAG ACA GTG TCT TAG ACT CGT TGT TG-3=), P3 (5=-GAT GGG CAC ATG GAT GAA ATC-3=), and a neo gene-specific primer, N2 (5=-GCA TGC TCCAGA CTG CCT TGG GAA A-3=). The presence of primer-amplified PCR product was detected on agarose gel and visualized by ethidium bromide fluorescence. We observed the presence of a 589 bp DNA band for PR⫹/⫹ mice (corresponding to the PR gene, P1/P3 primers), a 473 bp band for PR⫺/⫺ mice (P1/N2 primers), or both bands for PR⫹/⫺ mice.

Analysis of mPR␣, mPR␤, and mPR␥ mRNA expression RNA isolation, cDNA synthesis and PCR. Mice were sacrificed by decapitation, and the lumbar region of the spinal cord was dissected out, frozen on dry ice and stored at ⫺80 °C until use. Brain, testis and kidney were also sampled and used as positive

96

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

Table 1. Nucleotide sequences of sense and antisense primers and conditions of semi-quantitative RT–PCR mRNA detected

Primer sequences 5=¡3=

mPR␣

Sense: 5=GGCCTCCTTCACCTACCTCT 3= Antisense: 5=CAGACCCGGCTTCTGGCTGT 3= Sense: 5=GTGGCTCTCTGCCACCTGGC 3= Antisense: 5=CAGCTGGGAGAGCGTGCAGA 3= Sense: 5=GGCCTCCTTCACCTACCTCT 3= Antisense: 5=CAGACCCGGCTTCTGGCTGT 3= Sense: 5=CTGAAGGTCAAAGGGAATGTG3= Antisense: 5=GGACAGAGTCTTGATGATCTC 3=

mPR␤ mPR␥ L19

controls, respectively for mPR␣, mPR␤, and mPR␥ expression. Total RNA was extracted using Trizol reagent (Life Technologies, Invitrogen, France) according to the manufacturer’s instructions. Total RNA was subjected to DNAse 1 (Stratagene, La Jolla, CA, USA) treatment (10 U for 15 min at 37 °C) to remove residual contaminating genomic DNA. cDNA templates for PCR amplification were synthesized from 2 ␮g of total RNA using a SuperScript II Rnase H reverse transcriptase kit (Gibco/BRL, Cergy Pontoise, France) for 90 min at 42 °C in the presence of random hexamer primers. Primers for reverse transcriptase–polymerase chain reaction (RT–PCR) amplification were designed using Oligo Primer Analysis Software version 6.54, Molecular Biology Insights Inc., USA. Sequences without homology between mPR subtypes were chosen for primer design. A fragment of L19 ribosomal RNA was amplified in parallel in separate reactions. The sequences of primers are presented in Table 1. Each PCR reaction contained 100 ng of cDNA template, 1⫻Taq DNA polymerase buffer, 200 ␮M of each dNTP, 1 Unit of Taq DNA polymerase (ATGC), and 0.2 ␮M of specific primers, in a total volume of 50 ␮l. The conditions of amplification were 2 min at 94 °C, followed by 30 cycles at 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min. The PCR reactions would be expected to yield a product, at 284 bp for mPR␣, 217 bp for mPR␤, 144 bp for mPR␥ and 194 bp for L19. Aliquots of the amplified products and 100 bp DNA ladder were separated on a 1.2% agarose gel and visualized by Ethidium Bromide staining. Sequencing of PCR products. To confirm the specificity of the RT–PCR amplified mPR␣, mPR␤ and mPR␥ products, they were purified after electrophoresis using the Prepagene Kit (BioRad, Marnes-la-Coquette, France). The identity of each of the PCR products from spinal cord, and hence the specificity of the PCR reaction was confirmed by DNA sequencing (Biofidal, Vaulx en Velin, France). Semi-quantitative RT–PCR. Semi-quantitative RT–PCR analysis was carried out on total RNA extracted from the lumbar region of the spinal cord of male and female WT, HTZ, and PRKO mice. In parallel to amplification of the mPR␣, mPR␤, mPR␥ isoforms, amplification of L19 RNA was performed in separate reactions, and used as an internal standard for normalization of the results. Reverse transcription was carried out using 2 ␮g of total RNA subjected to DNAse 1 (Stratagene, La Jolla, CA, USA) treatment (10 U for 15 min at 37 °C) to remove residual contaminating genomic DNA. All total RNA was assumed to be transcribed into cDNAs. Then, PCR amplification for mPRs, L19 RNA were assayed using different amounts of cDNA (0, 50, 100, 200, 300, 400, 500 ng). For each point, a different number of cycles (range 10 – 40 cycles) was used to determine the optimal cDNA amount and cycle number allowing detection of the messengers within the log phase of amplification. Aliquots of the amplified products and 100 bp DNA ladder were separated on a 1.2% agarose gel and visualized by Ethidium Bromide staining. The gels were subsequently quantified using Bio-Rad’s Image Analysis System and Molecular Analyst for Macintosh software. The relative levels of gene expression were measured by determining the ratio between

[ ] cDNA (ng/50 ␮l) semi-quantitative RT–PCR

Number of cycles

30

30

200

35

100

35

100

30

the products generated from the genes of interest (mPRs) and the endogenous internal standard (L19) in separate reactions. Validation of semi-quantitative RT–PCR was determined and the optimal number of cycles and cDNA concentration for remaining in the log phase of amplification were chosen (Fig. 1, Table 1). All experiments were repeated three times, with each experiment yielding comparable results. When appropriate, data were pooled to calculate means⫾SEM and to analyze them by two-way analysis of variance (ANOVA) followed by Bonferroni post hoc tests. In situ hybridization. Adult male mice (n⫽5) were anaesthetized with ketamine and perfused through the heart with phosphate buffer followed by 1% paraformaldehyde. Spinal cords were dissected out, post-fixed by immersion in the same fixative for 1 h and transferred to a solution of 15% sucrose in buffer phosphate where they remained overnight. Samples were frozen on powdered dry ice and stored at ⫺80 °C. Serial coronal sections (14 ␮m) were mounted on 3-Aminopropyl triethoxy-silane-subbed slides and stored at ⫺80 °C until use. Different oligonucleotides specific for each mPR isoform and 2 scrambled oligonucleotides were used. Specific 40-base synthetic oligonucleotides complementary to mPR␣ (GI2195525, 5=-GATCCTCCTCGGCAGGGAGGGGAGACACTATGATGCGGTG-3=), mPR␤ (GI38018672, 5=-CTTTCTTAATCAGTCTGTCCTTGACCTTGTGCCTCAGGAG-3␮), and mPR␥ (GI38018678, Probe 1: 5=-GCAGACCAGTGCATGAGGGAACGTGTATGCAGAGTAGGCG-3=, Probe 2: 5=-GCTGAGGATGCAGGCAGTGGCGGAACTCTGTGGGTGTCGG-3=, Probe 3: 5=-TGGCTGAGCCCAGGCTGAAGAGATTGACGGCACCATAGTC-3=) were selected in regions of the sequences with no homology between mPR subtypes. The sequences were then verified using BLAST search of EMBL and GenBank databases to ensure that there was no homology with other mRNAs. The oligonucleotides were labeled with [35S]dATP (1000 mCi/mmol, Perkin Elmer, France) to a specific activity of 2⫻109 cpm/␮g using terminal deoxynucleotidyltransferase (Amersham). Adjacent spinal cord sections were incubated in the presence of the 35S-labeled probes according to a previously described protocol (Guennoun et al., 1995). Briefly, 0.25 ng of labeled probe in the hybridization buffer (50% deionized formamide, 10% dextran sulfate, 500/␮g/ml denaturated salmon sperm DNA, 1% Denhardt’s solution, 5% sarcosyl, 250/␮g/ml yeast tRNA, 200 mM dithiothreitol, 20 mM Na2PO 4 in 2⫻SSC) was applied on tissue sections and hybridization proceeded overnight at 40 °C. The following day, sections were rinsed several times using SSC buffer (1X and 0.1X), dehydrated and exposed to X-ray films (Kodak Biomax MR, Sigma-Aldrich, Lyon, France) to verify the success of the experiment. Then the slides were dipped in Ilford K5 emulsion, exposed for 10 weeks, developed, counterstained with Toluidine Blue, dehydrated and mounted. Hybridization signal was analyzed by microscopic observation.

Controls Controls for the specificity of the in situ hybridization reactions were performed by (1) cold probe competition (the addition of an excess of related or unrelated probes to the hybridization medium

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

97

Fig. 1. Validation of the semi-quantitative RT–PCR analysis of mPR␣, mPR␤, mPR␥ and L19 RNA (A–D). Different amounts of cDNAs obtained by RT from spinal cord total RNA were amplified by PCR for 10 – 40 cycles in the presence of specific primers for mPR␣, mPR␤, and mPR␥ and L19 RNA. The number of cycles is denoted by different symbols. Quantification was carried out by Biorad’s Image Analysis System and Molecular Analyst for Macintosh software. Arrows show the conditions chosen for the further analysis.

before hybridization of adjacent sections); (2) the use of scrambled missense oligonucleotides with the same C-G ratio as the antisense probes (Scram1: 5=-GCCCTGACGCGTTGGAGTCGAGGTCCAAGGGACTAGGTGA-3=, Scram2: 5=-ACTTCCAGGATCGCTAAGGACTTCCCGTGAAAGGCTCCCG-3=).

Analysis of mPR␣ and mPR␤ protein expression Antibodies. To detect mPR␣ protein, a polyclonal antibody (GP47) was generated in rabbits against a synthetic 15 amino acid peptide derived from the C-terminal domain of mouse mPR␣ (llsqlvrrklhqktk) conjugated to KLH (Eurogentec, Belgium). Animals were bled after four intradermal injections in Freud’s complete adjuvant. Antibody production was tested by ELISA assay using the above peptide as screening antigen. Specific labeling of mPR␣ by GP47 antiserum was checked by Western blot analysis of cell lysate and plasma membrane preparations from MDA-MB231 cells stably transfected with hu-mPR␣. The MDA-MB-231 cells were stably transfected with hu-mPR␣ and plasma membranes were prepared for Western blot analysis as described previously (Thomas et al., 2007). Plasma membranes of huPR␣MDA-MB-231 transfected cells showed a more intense signal compared to untransfected MDA-MB-231 cells. An immunoreactive band around 40 kDa was revealed by the anti-serum, but was not detected in presence of the blocking peptide or the preimmune serum (not shown). A commercially available mPR␣ antibody (mPR␣ (Y-14): sc-50113, Santa Cruz Biotechnology, Heidelberg, Germany) was also used. This affinity purified goat polyclonal antibody raised against a peptide mapping within an internal region of mPR␣ of human origin detects mouse, rat and human mPR␣. To detect mPR␤ protein, an affinity purified goat polyclonal antibody raised against a peptide mapped near the N-terminus of human mPR␤, and which detects mouse, rat and human mPR␤

was used (mPR␤ (N-15): sc-50109, Santa Cruz Biotechnology, Heidelberg, Germany). Western blot analysis. Samples of spinal cord were homogenized in an ice cold lysis buffer (10 mm Tris-Cl, pH 8.0; 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 40 ␮M phenylmethylsulfonyl fluoride, and 1 ␮M leupeptin). This was followed by incubation for 30 min on ice and centrifugation at 10,000⫻g for 20 min at 4 °C. The supernatant was transferred to new tubes, aliquoted, and stored at ⫺80 °C until electrophoresis was performed. Protein concentrations were determined by the Bradford technique using the Bio-Rad protein assay kit with bovine serum albumin as reference standard (Bradford, 1976). Samples were denatured by adding sample buffer (62.5 mM Tris–HCl (pH 6.8), 2% SDS, 10% glycerol, and 0.01% bromophenol blue), followed by boiling for 5 min. Proteins (20 ␮g for mPR␣ detection, or 100 ␮g for mPR␤ detection) were separated on 10% SDS PAGE. Blots were incubated for 1 h at room temperature in 5% nonfat dry milk to block nonspecific binding, and then washed in TBST (4⫻5 min). Blots were then incubated overnight at 4 °C with the anti-mPR␣ serum GP47 (1/5000), or anti-mPR␣ (Y-14) at 1/200, or anti-mPR␤ (N-15) at 1/200. After three washes in TBST, membranes were incubated for 1 h with secondary horseradish peroxidase conjugated antibodies (Santa Cruz), and finally washed three times for 15 min with TBST. Blots were then treated with enhanced chemiluminescence (Amersham Pharmacia) according to the manufacturer’s instructions and exposed to x-ray film. The specificity of the GP47 antiserum was confirmed by (1) substituting the antiserum with pre-immune serum; (2) blocking the diluted anti-mPR␣ serum GP47 (1:5000) with the peptide (10 ␮g/ml), and incubating the mixture at room temperature for 2 h. To study the effect of steroid treatments on mPR expression, 24 adult male mice were used. Four experimental groups were prepared: (1) Controls (n⫽6) untreated; (2) 2 V (n⫽6) vehicle

98

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

injected (sesame oil, s.c.); (3) EB (n⫽6) estradiol injected (estradiol-17␤ benzoate 10 ␮g/kg/day s.c., 2 days); (4) PROG P (n⫽6) progesterone injected (progesterone, 4 mg/kg/day, 3 days). Animals were killed 24 h after the last injection. The dose and duration of estradiol benzoate treatment were similar to those which have been shown to induce nuclear progesterone receptors (Brown et al., 1987; Gréco et al., 2001). The paradigm of progesterone treatment is the one that has previously been shown to prevent neuronal loss after traumatic brain injury and spinal cord injury (Roof et al., 1994; Thomas et al., 1999) and to modulate motoneurons and glial cell markers after spinal cord injury (Labombarda et al., 2000b, 2002; Gonzalez et al., 2004; De Nicola et al., 2009). The progesterone treatment as applied resulted in high levels of progesterone in both plasma and spinal cord (Labombarda et al., 2003, 2006). For Western blot analysis, optimal conditions to detect the potential differences between groups were used: 20 ␮g of proteins were loaded and GP47 anti-serum was used. Signals were acquired directly using Chemidoc Molecular Imager (Bio-Rad) and quantified by Quantity one software (Bio-Rad). Blots were also exposed to X-ray films. Films were scanned and signals quantified using ImageJ software. Data were analyzed by one way ANOVA.

Immunohistochemical analysis. Adult male mice (n⫽5) were perfused with paraformaldehyde 4%, spinal cords were dissected out, then tissue and sections were prepared as described for in situ hybridization. mPR␣ and mPR␤ immunodetection was performed by using an indirect method with avidin– biotin-peroxidase following a standard protocol. Endogenous peroxidase activity was quenched by incubating the slides in 0.3% hydrogen peroxide in methanol for 30 min at room temperature. Slides were then incubated in 3% normal goat serum for 20 min at room temperature to reduce non-specific staining and then incubated overnight at 4 °C with the anti-rabbit-mPR␣ serum GP47 (1:7000), or anti-goat mPR␣ (Y-14) antibody at 1/200, or anti-goat mPR␤ (N-15) at 1/500. After washing to remove excess primary antibodies, the slides were incubated with biotinylated goat-anti-rabbit IgG or biotinylated rabbit antigoat IGG (Vector Laboratories) for 2 h at room temperature, washed in PBS, and incubated with avidin– biotin complex reagent for 30 min at room temperature. The slides were developed using a diaminobenzidine (DAB)-peroxidase substrate for 10 min. Finally, the slides were, rinsed in TRIS buffer, dehydrated, cleared, and mounted. To show the specificity of the immunostaining, negative controls were run in adjacent sections by substituting the primary antibodies

Fig. 2. Expression of mPR␣, mPR␤, and mPR␥ mRNA in the mouse spinal cord. (A) RT–PCR analysis. Representative gel electrophororetic analysis of RT–PCR products corresponding to mPR␣, mPR␤, and mPR␥. Brain, testis and kidney were used as positive control tissue. SC; spinal cord. (B) Semi-quantitative RT–PCR analysis of mPR␣, mPR␤, and mPR␥ and L19 ribosomal RNA mRNA expression in spinal cord of male and female wild type (Wt), heterozygotes (Htz) and PR–KO mice. Data represent the mean⫾SEM of eight mice per group. Statistical analysis: two-way ANOVA.

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106 with pre-immune serum and by using preadsorption tests as described for Western blot analysis. Double immunofluorescence staining and confocal microscopy analysis. To identify the type of cells expressing mPR␣ and mPR␤, double immunofluorescence staining and confocal microscopy analysis were performed using spinal cord slices from male mice (n⫽4). Two successive immunodetections were performed on the same section. mPR␣ antiserum GP47 at 1/1000, or mPR␤ (N-15) at 1/100 and specific markers of cell types and neurofilaments were used: mouse anti-neuronal nuclei (NEUN, Millipore, France, 1/100) for neurons, mouse anti- S-100 ␣/␤ chain (B32.1, Santa Cruz, 1/50) for astrocytes, Anti-APC (Ab-7) mouse mAb (CC1, Merck Chemicals Ltd., Nottingham, UK, 1/20) for oligodendrocytes, mouse anti-NG2 chondroitin sulfate proteoglycan (MAB5384, Millipore, France, 1/500) for oligodendrocyte progenitors, and mouse anti-neurofilament 200 (N5389, Sigma Aldrich, Lyon, France, 1/2000). The Vector M.O.M immunodetection kit (clinisciences, Montrouge, France) was used to reduce undesired background staining. One set of slides was first incubated with the rabbit mPR␣ antiserum GP47 overnight at 4 °C, after washing, the slides were incubated for 2 h at room temperature in the dark with cy3-goat anti-rabbit IgG (1/200, Chemicon International) washed, and incubated either with monoclonal anti-NEUN, or anti- S-100 ␣/␤ chain, or anti-CC1, or anti-NG2 for 2 h at room temperature. After washing in PBS, slides were incubated with Alexa Fluor 488-goat anti-mouse secondary antibody (1:200, Molecular Probes, Eugene, OR, USA) for 2 h. Using the same procedure, another set of slides was incubated with the goat mPR␤ (N-15) antibody which was revealed by Alexa Fluor 488rabbit anti-goat secondary antibody (Molecular probes, 1/200) while the antibodies for the different cell types and neurofilaments were revealed by cy3-goat anti-mouse secondary antibody (Chemicon International, 1/200). The slides were washed in PBS then mounted with fluoromount and observed under the confocal microscopy. Negative controls were also processed using the immunodepleted antibody preparation or normal serum in place of the mPR antibodies and normal serum in place of anti-NEUN, or anti- S-100 ␣/␤ chain, or anti-CC1, or anti-NG2 or anti-NF. Double

99

immunofluorescence labeling was visualized using a confocal Zeiss LSM 510 microscope (Carl Zeiss GmbH, Iena, Germany). Images were sequentially acquired with green (488 nm) and red (453 nm) excitations to avoid cross-talk between channels. Images were acquired sequentially in a line-scanning mode through an optical section of 1 ␮m in the z-axis and analysis was performed using Bioscan Optimas II software. The number of immunopositive cells was counted in sectors comprising a defined area measuring 9⫻104 ␮m2 of white matter for glial cells and the same area of grey matter of Lamina IX for ventral horns neurons and Lamina I–III for dorsal horns neurons. Cell quantification was carried out in four sections per animal and the percentage of double labeled cells respect to the total inmunopositive cells, was calculated. Quantitative analysis was performed by one-way ANOVA, followed by post hoc comparisons with the Newman– Keuls test.

RESULTS mPR␣, mPR␤ and mPR␥ mRNA expression in the mouse spinal cord The presence of mPR␣, mPR␤ and mPR␥ mRNA transcripts in the mouse spinal cord was demonstrated by RT–PCR (Fig. 2A). The identity of each PCR product, and hence the specificity of the PCR reactions, was confirmed by DNA sequencing. Analysis by the NCBI Blast Program showed that the nucleotide sequences of the amplified fragments were 100% homologous to the expected fragments in the sequence of mouse mPR␣ (GI 2195525), mPR␤ (GI38018672) and mPR␥ (GI38018678). Semiquantitative RT–PCR analysis showed similar expression of mPR␣, mPR␤ and mPR␥ in male and female spinal cords. Moreover, no differences were observed between wild-type (PR⫹/⫹), heterozygous (PR⫹/⫺) and PRKO (PR⫺/⫺) littermates (Fig. 2B).

Fig. 3. mPR␣ and mPR␤ mRNA expression: analysis by in situ hybridization. Representative hybridization signals over motoneurons with the mPR␣ probe (A) and mPR␤ (C) and with an excess of unlabeled homologous probe (A=, C=). In the interneurons a specific signal was observed with mPR␣ probe (B), while only background was observed with mPR␤ probe (D). Exposure time: 10 weeks. Scale bars: 15 ␮m.

100

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

Regional and cellular distribution of mPR␣ and mPR␤ mRNA in the mouse spinal cord In situ hybridization analysis was performed using probes specific for mPR␣, mPR␤ or mPR␥. With the mPR␣ probe, strong specific hybridization signals were obtained on both ventral horn motoneurons (Fig. 3A) and on dorsal horn neurons (Fig. 3B). On the contrary, with the mPR␤ probe, specific hybridization was only observed on the motoneurons (Fig. 3C), but not on the dorsal horn neurons (Fig. 3D). The specificity of the hybridization signals for mPR␣ and mPR␤ was verified: (1) by performing displacement experiments with an excess of unlabeled competing probes. A 500-fold excess of unlabeled homologous oligonucleotide completely abolished mPR␣ and mPR␤ hybridization signals on the motoneurons (Figs. 3A= and 3C=), whereas a 500-fold excess of unlabeled heterologous oligonucleotide did not modify the quality of the signal; (2) by using scrambled oligonucleotides, which gave no specific signal. While clear hybridization signals for mPR␣ and

mPR␤ mRNA could be observed on neurons, no firm conclusion could be made for glial cells because of their smaller size and the diffusion of the hybridization signal. Although mPR␥ mRNA transcripts could be detected by RT–PCR (Fig. 2A), three different probes did not allow detection of specific mPR␥ transcripts in the spinal cord by in situ hybridization, although they revealed a specific signal in kidney used as a positive control (not shown). mPR␣ and mPR␤ protein expression in the mouse spinal cord Western blot analysis demonstrated the presence of mPR␣ and mPR␤ proteins in the mouse spinal cord (Fig. 4A). A single immunoreactive band of the size expected for mPR␣ (40 kDa) was detected in spinal cord lysate by the antiserum GP47 raised against a peptide in the C-terminal domain of mPR␣ (see Experimental procedures). The band was not detected when the antiserum was either preadsorbed with the blocking peptide used for immuniza-

Fig. 4. Expression of mPR␣ and mPR␤ in the mouse spinal cord: Western blot analysis. (A) The anti-mPR␣ serum GP47 (1/5000) revealed one immunoreactive band around 40 kDa (left lane). No band was revealed in controls incubated with the anti-mPR␣ serum GP47 (1/5000) preadsorbed with the immunizing peptide (10 ␮g/ml) (middle lane) or with the pre-immune serum (right lane). The anti-mPR␣ (Y-14) at 1/200 revealed one immunoreactive band around 40 kDa. The anti-mPR␤ (N-15) at 1/200 revealed a faint immunoreactive band of 40 kDa in the spinal cord extracts. (B) Effects of treatments with estradiol benzoate and progesterone on mPR␣ expression using the anti-mPR␣ serum GP47. No significant difference in mPR␣ expression was observed between controls (C), vehicle (V), estradiol benzoate (EB), or progesterone (PROG) treated mice. Data represent the mean⫾SEM of six mice per group. Statistical analysis: one-way ANOVA.

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

tion, or when it was substituted by normal serum of the rabbit before immunization. A commercially available affinity purified goat polyclonal antibody raised against a peptide mapped within an internal region of the human mPR␣ (mPR␣ (Y-14): sc-50113, Santa Cruz Biotechnology, Inc.) also revealed a single immunoreactive band around 40 kDa in spinal cord lysate. An affinity purified goat polyclonal antibody raised against a peptide mapped near the N-terminus of human mPR␤ (mPR␤ (N-15): sc-50109,

101

Santa Cruz Biotechnology) revealed a weak immunoreactive band of the expected size of mPR␤ (around 40 kDa) (Fig. 4A). 20 ␮g of proteins was sufficient to detect mPR␣ while for mPR␤ 100 ␮g was needed and only a weak signal could be detected. To determine whether spinal mPR␣ protein levels are regulated by estrogen or progesterone, adult male mice were left undisturbed or were injected s.c. with vehicle alone, with estradiol benzoate (EB, 10 ␮g/kg/day for 2

Fig. 5. Immunohistochemical localization of mPR␣ in the mouse spinal cord. (A) Regional view of spinal cord slice showing the location where the micrographs in B, C, D and E were taken. (B) dorsal horn (C) mPR␣ immunoreactive motoneurons in the ventral horn (D) central canal (E) mPR␣ immunoreactive glial cells in the white matter. In control sections, the mPR␣ antibody GP47 was either (1) peptide adsorbed or (2) substituted by pre-immune serum. In both cases, no specific labeling was observed as shown in F in the glial cells after preadsorption with the peptide. Scale bars: 50 ␮m in A, 20 ␮m in B–F.

102

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

days) or with progesterone (PROG, 4 mg/kg/day for 3 days). Spinal cords were sampled for protein analysis 24 h after the last injection. Fig. 4B shows very similar receptor protein levels for the different groups and no effect of the hormone treatments.

Immunohistological analysis of mPR␣ and mPR␤ distribution in the mouse spinal cord The immunohistochemical analysis confirmed the results of the Western blot and also showed the regional pattern of

Fig. 6. mPR ␣ is expressed in neurons, oligodendrocytes, astrocytes and progenitor cells in the mouse spinal cord: analysis by double immunofluorescence and confocal microscopy. Immunostaining with the rabbit polyclonal anti-mPR␣ rabbit polyclonal antiserum GP47 (red) and mouse monoclonal antibodies NEUN (A, B), CC1 (C), S100 (D) and NG2 (E). Arrows in B showed some cells which did not express mPR␣ and that express NeuN. VH, ventral horn; DH, dorsal horn. Scale bar: 30 ␮m.

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

distribution of mPR␣ and mPR␤. Fig. 5A shows the location where the micrographs in B, C, D and E were taken. Consistent with the in situ hybridization data, specific mPR␣ immunolabeling was observed on dorsal horn neurons and on ventral horn motoneurons (Fig. 5B, 5C). In addition, ependymal cells around the central canal and neurons in the lamina X were also labeled (Fig. 5D). Interestingly, within the white matter tracts, small stellate or round cells were also stained, which probably corresponded to glial cells (Fig. 5E). No specific labeling was observed on adjacent sections incubated either with the antibody preadsorbed with the immunization peptide (Fig. 5F) or with the pre-immune serum (not shown). To identify the types of cells expressing mPR␣, we performed double immunofluorescence staining (mPR␣ together with a cell-specific marker), confocal microscopy and cell counting. The cell-specific antibodies used were (1) mouse anti-neuronal nuclei (NEUN) for neurons; (2) mouse anti-S-100 ␣/␤ chain for astrocytes; (3) mouse CC1 mAb for oligodendrocytes; (4) mouse anti-NG2 for oligodendrocyte progenitors. Double mPR␣/NEUN labeling showed that mPR␣ is expressed in 100% of the ventral horn motoneurons (Fig. 6A), and in 85% of the dorsal horn neurons (Fig. 6B). Indeed, in the dorsal horns, only 15% of the NEUNⴙ cells were negative for mPR␣. Colocalization of NEUN and mPR␣ was also observed in neurons of lamina X surrounding the central canal (not shown). Double mPR␣/CC1 and mPR␣/S100 labeling respectively showed that mPR␣ is also expressed in virtually all oligodendrocytes (Fig. 6C) and astrocytes (Fig. 6D). Most importantly, a large percentage (65%) of NG2⫹ progenitors also expressed mPR␣, suggesting that this membrane receptor may be expressed throughout the oligodendroglial cell lineage (Fig. 6E). Expression of mPR␤ was found to be much more restricted than that of mPR␣ and to be present in ventral horn motoneurons, but not in dorsal horn neurons, which was again consistent with the in situ hybridization findings. Interestingly, the labeling appeared punctuated around the motoneurons and was also present in their neurites (Fig. 7A). In addition to the motoneurons, labeling with a dotted pattern was also detected within the white matter (Fig. 7B). No specific labeling was observed on adjacent sections incubated with normal serum (Fig. 7C). Double immunofluorescence staining and confocal microscopy analysis showed localization of mPR␤ in neurites belonging to motoneurons strained with NEUN (Fig. 8A). However, no colocalizations of mPR␤ with the glial cell-type markers CC1 (Fig. 8B), S100 (Fig. 8C) or NG2 (Fig. 8D) were observed. In white matter, strong expression of mPR␤ was detected in axons, as shown by the colocalization of mPR␤ and neurofilaments (Fig. 8E).

DISCUSSION We report here for the first time the occurrence of mPR isoforms in the mouse spinal cord. Whereas the expression of all three mPR isoforms could be detected by RT– PCR, only mPR␣ and mPR␤ mRNAs were detected by in

103

Fig. 7. Immunohistochemical localization of mPR␤ in the mouse spinal cord. (A) A punctuate pattern of immunostaining surrounding a motoneuron, (B) a dotted pattern of immunostaining in white matter. (C) negative control after incubation with normal serum showing no specific labeling. Scale bars: 20 ␮m.

situ hybridization. Western blot analysis also revealed the presence of both isoform proteins. Noticeable was the constitutive expression and very widespread distribution of mPR␣ in the mouse spinal cord. Indeed, RT–PCR analysis of mPR␣ mRNA showed similar expression patterns in both males and females and no influence of the presence or absence of the classical PR

104

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

Fig. 8. Double immunofluorescence and confocal microscopy analysis of mPR␤ and NEUN, CC1, S100, NG2, and NF to identify mPR ␤ expressing cells in the mouse spinal cord. Immunostaining with the goat polyclonal ani-mPR␤ antibody N-15 (green) and mouse monoclonal antibodies NEUN (A), CC1 (B), S100 (C), NG2 (D) and NF (E) showed that mPR ␤ is expressed by neurites of motoneurones as shown in A and by axons in white matter as shown in E. Arrows in B, C and D show cells that express cell type-markers and which lack mPR␤ expression. Arrowheads in E show nerve fibers (cut in transverse plan) co-labeled with mPR␤ and NF anti-bodies. Scale bars: 10 ␮m.

(wild-type vs. PR knockout mice). Moreover, treatment of mice with either estradiol-17␤ or progesterone had no influence on mPR␣ protein levels. In situ hybridization

revealed the presence of mPR␣ mRNA in both ventral horn motoneurons and dorsal horn interneurons, and specific immunostaining was observed throughout the grey and

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

white matter. Most importantly, double immunofluorescence and confocal analysis showed that all ventral horn motoneurons, a majority of dorsal horn neurons, virtually all astrocytes and oligodendrocytes and a significant proportion of NG2⫹ progenitor cells express mPR␣. Such an ubiquitous distribution of mPR␣ strongly suggests a key role for this membrane receptor in the pleiotropic trophic and protective actions of progesterone within the spinal cord: neuroprotective effects on ventral horn motoneurons, modulation of nociception at the level of dorsal horn circuitry, inhibition of astrocyte proliferation, stimulation of the proliferation of oligodendrocyte progenitor cells, promotion of oligodendrocyte differentiation and myelin formation (Lacroix-Fralish et al., 2008; De Nicola et al., 2009; Labombarda et al., 2009). Moreover, the presence of mPR␣ in neurons of lamina X surrounding the central canal suggests a role for mPR␣ in the expression of female sexual behavior. Retrograde tracing studies have indeed shown that neurons within this spinal region, which also express estrogen-sensitive nuclear PR, are part of the lordosis reflex circuitry (Daniels et al., 1999; Monks et al., 2001). The wide expression of mPR␣ in the spinal cord is very similar to the previously described distribution pattern of the 3␤-hydroxysteroid dehydrogenase/⌬5-⌬4-isomerase (3␤-HSD), enzyme which converts pregnenolone to progesterone. Thus, in situ hybridization analysis has revealed that 3␤-HSD is expressed throughout the spinal grey matter, within the dorsal horns, ventral horns and central canal layer (Coirini et al., 2002). Notably, 3␤-HSD expression also appeared to be relatively stable, as it remained elevated even after removal of the steroidogenic endocrine glands (Coirini et al., 2002). In a more recent study, we confirmed that significant spinal levels of progesterone remain detectable in adrenalectomized and castrated males, and that injury resulted in an increase in progesterone without affecting 3␤-HSD expression (Labombarda et al., 2006). Together with the present observation of the large and steady expression of mPR␣, these findings point to an important role for progesterone as a local messenger within the spinal cord, with the involvement of membrane receptor signaling. This new concept has important implications for understanding steroid actions in the nervous system. Expression of mPR␤ was much more restricted than that of mPR␣. Indeed, the ␤ isoform was not present in the dorsal horns, was not expressed by glial cells, and was found to be limited to motoneurons and to neurites. Such an expression pattern would be consistent with an important role of mPR␤ in regulating neuron activity and characteristics of the axolemma. In contrast to mPR␣ and mPR␤, we were not able to observe mPR␥ in the mouse spinal chord by in situ hybridization, although we could detect its mRNA by RT–PCR. This may reflect very low and/or localized expression of this isoform. It is intriguing how many receptors and signaling mechanisms appear to be involved in the actions of progesterone. In addition to the two classical intracellular PR and the three mPR isoforms studied here, PGRMC1, another putative progesterone membrane receptor, has been shown

105

to be selectively expressed in dorsal horn and central canal ependymal cells of the rat spinal cord, but to be absent in ventral horn motoneurons (Labombarda et al., 2003; Guennoun et al., 2008). Progesterone is a very active antagonist of the sigma 1 receptor with Ki values close to the physiological concentrations of the steroid during pregnancy or acute stress conditions (Su et al., 1988; Maurice et al., 2006). Sigma 1 receptor has been shown to be present in the ventral and dorsal horns of the spinal cord (Kim et al., 2008; Guzman-Lenis et al., 2009). In addition, progesterone can be converted to allopregnanolone which is a potent positive modulator of GABAA receptors (Belelli and Lambert, 2005). Although all these progesterone targets show distinct distributions within the nervous system, some of them may colocalize in the same neural cell. Thus, PR, mPR␣, mPR␤, sigma 1 receptors and GABAA receptors are all expressed by spinal motoneurons, and their respective contributions to the actions of progesterone, their interactions and also their possible redundancies need to be explored. Acknowledgments—This work was partly supported by AFM (Project R06083LL, grant N° RAE06031LLA to RG) and a cooperative program between the Governments of France and Argentina (INSERM/CONICET).

REFERENCES Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72:248 –254. Brown TJ, Clark AS, MacLusky NJ (1987) Regional sex differences in progestin receptor induction in the Rat hypothalamus: effects of various doses of estradiol benzoate. J Neurosci 7:2529 –2538. Belelli D, Lambert JJ (2005) Neurosteroids: endogenous regulators of the GABA(A) receptor. Nat Rev Neurosci 6:565–575. Cahill MA (2007) Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 105:16 –36. Cai Z, Stocco C (2005) Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 146:5522– 5532. Coirini H, Gouezou M, Liere P, Delespierre B, Pianos A, Eychenne B, Schumacher M, Guennoun R (2002) 3 Beta-hydroxysteroid dehydrogenase expression in rat spinal cord. Neuroscience 113:883– 891. Conneely OM, Jericevic BM (2002) Progesterone regulation of reproductive function through functionally distinct progesterone receptor isoforms. Rev Endocr Metab Disord 3:201–209. Daniels D, Miselis RR, Flanagan-Cato LM (1999) Central neuronal circuit innervating the lordosis-producing muscles defined by transneuronal transport of pseudorabies virus. J Neurosci 19:2823– 2833. De Nicola AF, Gonzalez SL, Labombarda F, Deniselle MC, Garay L, Guennoun R, Schumacher M (2006) Progesterone treatment of spinal cord injury: effects on receptors, neurotrophins, and myelination. J Mol Neurosci 28:3–15. De Nicola AF, Labombarda F, Deniselle MC, Gonzalez SL, Garay L, Meyer M, Gargiulo G, Guennoun R, Schumacher M (2009a) Progesterone neuroprotection in traumatic CNS injury and motoneuron degeneration. Front Neuroendocrinol 30:173–187. Garay L, Deniselle MC, Lima A, Roig P, De Nicola AF (2007) Effects of progesterone in the spinal cord of a mouse model of multiple sclerosis. J Steroid Biochem Mol Biol 107:228 –237. Gréco B, Allegretto EA, Tetel MJ, Blaustein JD (2001) Coexpression of ER beta with ER alpha and progestin receptor proteins in the

106

F. Labombarda et al. / Neuroscience 166 (2010) 94 –106

female rat forebrain: effects of estradiol treatment. Endocrinology 142:5172–5181. Gonzalez SL, Labombarda F, Gonzalez Deniselle MC, Guennoun R, Schumacher M, De Nicola AF (2004) Progesterone up-regulates neuronal brain-derived neurotrophic factor expression in the injured spinal cord. Neuroscience 125:605– 614. Guennoun R, Fiddes RJ, Gouezou M, Lombes M, Baulieu EE (1995) A key enzyme in the biosynthesis of neurosteroids, 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase (3 beta-HSD), is expressed in rat brain. Brain Res Mol Brain Res 30:287–300. Guennoun R, Meffre D, Labombarda F, Gonzalez SL, Deniselle MC, Stein DG, De Nicola AF, Schumacher M (2008) The membrane associated progesterone-binding protein 25-Dx: expression, cellular localization and up-regulation after brain and spinal cord injuries. Brain Res Rev 57:493–505. Guzman-Lenis MS, Navarro X, Casas C (2009) Selective sigma receptor agonist 2-(4-morpholinethyl)1-phenylcyclohexanecarboxylate (PRE084) promotes neuroprotection and neurite elongation through protein kinase C (PKC) signaling on motoneurons. Neuroscience 162:31–38. Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, Thomas P (2006) Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol 20:1519 –1534. Kim HW, Roh DH, Yoon SY, Seo HS, Kwon YB, Han HJ, Kim KW, Beitz AJ, Lee JH (2008) Activation of the spinal sigma-1 receptor enhances NMDA-induced pain via PKC- and PKA-dependent phosphorylation of the NR1 subunit in mice. Br J Pharmacol 154:1125–1134. Labombarda F, Gonzalez SL, Deniselle MC, Vinson GP, Schumacher M, De Nicola AF, Guennoun R (2003) Effects of injury and progesterone treatment on progesterone receptor and progesterone binding protein 25-Dx expression in the rat spinal cord. J Neurochem 87:902–913. Labombarda F, Guennoun R, Gonzalez S, Roig P, Lima A, Schumacher M, De Nicola AF (2000a) Immunocytochemical evidence for a progesterone receptor in neurons and glial cells of the rat spinal cord. Neurosci Lett 288:29 –32. Labombarda F, Gonzalez SL, Gonzalez DM, Guennoun R, Schumacher M, De Nicola AF (2000b) Modulation of NADPH-diaphorase and glial fibrillary acidic protein by progesterone in astrocytes from normal and injured rat spinal cord. J Steroid Biochem Mol Biol 73:159 –169. Labombarda F, Gonzalez SL, Gonzalez DM, Guennoun R, Schumacher M, de Nicola AF (2002) Cellular basis for progesterone neuroprotection in the injured spinal cord. J Neurotrauma 19:343–355. Labombarda F, Gonzalez SL, Lima A, Roig P, Guennoun R, Schumacher M, de Nicola AF (2009) Effects of progesterone on oligodendrocyte progenitors, oligodendrocyte transcription factors, and myelin proteins following spinal cord injury. Glia 57:884 – 897. Labombarda F, Pianos A, Liere P, Eychenne B, Gonzalez S, Cambourg A, De Nicola AF, Schumacher M, Guennoun R (2006) Injury elicited increase in spinal cord neurosteroid content analyzed by gas chromatography mass spectrometry. Endocrinology 147:1847– 1859. Lacroix-Fralish ML, Tawfik VL, Nutile-McMenemy N, Deleo JA (2008) Neuregulin 1 is a pronociceptive cytokine that is regulated by

progesterone in the spinal cord: implications for sex specific pain modulation. Eur J Pain 12:94 –103. Losel RM, Besong D, Peluso JJ, Wehling M (2008) Progesterone receptor membrane component 1—many tasks for a versatile protein. Steroids 73:929 –934. Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA Jr, Shyamala G, Conneely OM, O’Malley BW (1995) Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9:2266 –2278. MacLusky NJ, McEwen BS (1980) Progestin receptors in the developing rat brain and pituitary. Brain Res 189:262–268. Maurice T, Grégoire C, Espallergues J (2006) Neuro(active)steroids actions at the neuromodulatory sigma1 (sigma1) receptor: biochemical and physiological evidences, consequences in neuroprotection. Pharmacol Biochem Behav 84:581–597. Monks DA, Arciszewska G, Watson NV (2001) Estrogen-inducible progesterone receptors in the rat lumbar spinal cord: regulation by ovarian steroids and fluctuation across the estrous cycle. Horm Behav 40:490 – 496. Roof RL, Duvdevani R, Braswell L, Stein DG (1994) Progesterone facilitates cognitive recovery and reduces secondary neuronal loss caused by cortical contusion injury in male rats. Exp Neurol 129: 64 – 69. Schumacher M, Guennoun R, Stein DG, De Nicola AF (2007) Progesterone: therapeutic opportunities for neuroprotection and myelin repair. Pharmacol Ther 116:77–106. Sleiter N, Pang Y, Park C, Horton TH, Dong J, Thomas P, Levine JE (2009) Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology 150:3833–3844. Smith JL, Kupchak BR, Garitaonandia I, Hoang LK, Maina AS, Regalla LM, Lyons TJ (2008) Heterologous expression of human mPRalpha, mPRbeta and mPRgamma in yeast confirms their ability to function as membrane progesterone receptors. Steroids 73:1160 –1173. Su TP, London ED, Jaffe JH (1988) Steroid binding at ␴ receptors suggests a link between endocrine, nervous, and immune systems. Science 240:219 –221. Thomas P (2008) Characteristics of membrane progestin receptor alpha (mPRalpha) and progesterone membrane receptor component 1 (PGMRC1) and their roles in mediating rapid progestin actions. Front Neuroendocrinol 29:292–312. Thomas P, Pang Y, Dong J, Groenen P, Kelder J, de Vlieg J, Zhu Y, Tubbs C (2007) Steroid and G protein binding characteristics of the seatrout and human progestin membrane receptor alpha subtypes and their evolutionary origins. Endocrinology 148:705–718. Thomas AJ, Nockels RP, Pan HQ, Shaffrey CI, Chopp M (1999) Progesterone is neuroprotective after acute experimental spinal cord trauma in rats. Spine 24:2134 –2138. Zhu Y, Bond J, Thomas P (2003a) Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci U S A 100:2237–2242. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P (2003b) Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci U S A 100:2231–2236.

(Accepted 3 December 2009) (Available online 16 December 2009)