MicroRNA-30c functions as a tumor suppressor via targeting SNAI1 in esophageal squamous cell carcinoma

MicroRNA-30c functions as a tumor suppressor via targeting SNAI1 in esophageal squamous cell carcinoma

Biomedicine & Pharmacotherapy 98 (2018) 680–686 Contents lists available at ScienceDirect Biomedicine & Pharmacotherapy journal homepage: www.elsevi...

962KB Sizes 0 Downloads 9 Views

Biomedicine & Pharmacotherapy 98 (2018) 680–686

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

MicroRNA-30c functions as a tumor suppressor via targeting SNAI1 in esophageal squamous cell carcinoma Teng Maa,

T

⁎,1

, Ye Zhaob,1, Qitong Lua,1, Yun Lua, Zhiyong Liua, Tao Xuea, Yongfeng Shaoc

a

Department of Cardiothoracic Surgery, Zhongda Hospital, Southeast University, Nanjing 210009, China Department of Gastroenterology, Zhongda Hospital, Southeast University, Nanjing 210009, China c Department of Cardiothoracic Surgery, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, China b

A R T I C L E I N F O

A B S T R A C T

Keywords: ESCC miR-30c EMT

Background: Aberrant expression of miRNAs was involved in tumor initiation, progression and metastasis in multiple cancers. Many kinds of microRNAs in esophageal squamous cell carcinoma (ESCC) have been researched, whereas miR-30c has not been included. Methods: Firstly, we explored the expression of miR-30c in ESCC tissue and serum samples and its relations to the survival. To further investigate its effects on ESCC cells, we completed a series of experiments. We detected the effects of ectopic miR-30c expression on the proliferation, migration and invasion of ESCC cells in vitro. We identified the target role of SNAI1 in ESCC using Dual-luciferase reporter assay and western blot assay. Results: The results showed miR-30c was significant down-regulated in ESCC tissues and cell lines. Clinically, we found lower miR-30c expression was significantly correlated with worse ESCC progression and survival. Also we clarified that miR-30c suppressed cell proliferation, invasion and epithelial to mesenchymal transition (EMT) of ESCC cell lines. What's more, we figured out that miR-30c inhibits ESCC biological behaviors and EMT progress by directly binding to the 3′-UTR of SNAI1. Conclusion: This study provides new insight into the mechanism responsible for the development of human ESCC. Therefore, miR-30c could be a promising biomarker and a therapeutic target for ESCC in the future.

1. Introduction Esophageal cancer is one of the most common upper gastrointestinal tract cancers with high morbidity and mortality worldwide. In eastern Asia, esophageal squamous cell carcinoma (ESCC) is the most popular histologic type of esophageal cancer [1]. Although diagnostic methods have been deeply developed, a large proportion of patients with ESCC are diagnosed at advanced stages accompanied by tumor metastasis, and the 5-year overall survival rate of ESCC remains less than 20% [2]. Thus, it is essential to elucidate the molecular mechanisms of ESCC development. MicroRNAs (miRNAs) are a class of short non-coding RNAs that are 18–25 nucleotides in length [3]. It is widely accepted that miRNAs suppress the expression of protein coding genes by binding to the 3′untranslated regions (3′-UTRs) of messenger RNAs (mRNAs) [4]. Studies have shown that aberrant expression of miRNAs was involved in tumor initiation, progression and metastasis in multiple cancers [5–7]. MiR-30c is a member of the miR-30 family (miR-30a/b/c/d/e/f).Published articles indicate that loss expression of miR-30c contributes to



1

various malignancies, including breast cancer, endometrial cancer, lung cancer and colorectal cancer [8–11]. Nevertheless, the role of miR-30c has never been introduced in ESCC. Epithelial to mesenchymal transition (EMT) is a complicated process, in which epithelial cells loosen their cell to cell adhesion and gain a mesenchymal phenotype. Indeed, the process of epithelial cells invasion frequently involves EMT characterized by loss expression of Ecadherin and the acquisition of migratory properties [12]. The zincfinger transcription factor SNAI1 has been already proposed as an important mediator of tumor invasion because of its role in down regulation of E-cadherin and induction of EMT [13,14]. In the present study, we firstly examined the expression of miR-30c in ESCC tissue and serum samples, and then studied the relationship between miR-30c expression level and ESCC clinical features. Besides, the role of serum miR-30c as a noninvasive biomarker for ESCC diagnosis was evaluated by investigating the survival of 100 ESCC patients. The roles of miR-30c in modulating cell proliferation and invasion were explored, as well as the potential underlying molecular mechanisms involving the regulation of SNAI1 and EMT process.

Corresponding author. E-mail address: [email protected] (T. Ma). Contributed equally.

https://doi.org/10.1016/j.biopha.2017.12.095 Received 30 August 2017; Received in revised form 18 December 2017; Accepted 19 December 2017 0753-3322/ © 2017 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

2. Materials and methods

2.6. Apoptosis assay

2.1. Clinical samples

After cells were transfected for 48 h, apoptosis of the cells was evaluated with annexin V labeling. An annexin V–FITC labeled Apoptosis Detection Kit (Abcam Cambridge, MA, USA) was used according to the manufacturer’s protocol.

Fresh human samples including ESCC and the corresponding adjacent tissues were collected from 50 patients who received radical surgery from 2013 to 2014 at The First Affiliated Hospital of Nanjing Medical University. All tissues were immediately frozen in liquid nitrogen, and then stored at −80 °C until RNA extraction. Patients who had received chemotherapy or radiotherapy were strictly excluded. Serum samples from 100 ESCC patients who subsequently received radical surgery from 2013 to 2014 and serum samples from 50 healthy volunteers were also obtained from The First Affiliated Hospital of Nanjing Medical University. Every patient had written an informed consent, and this study was approved by the Ethical Committee of The First Affiliated Hospital of Nanjing Medical University as well as the Ethical Committee of Zhongda Hospital, Affiliated to Southeast University.

Transwell invasion assays were measured using 8 mm membrane pores transwell chambers (Corning, New York, USA). 1 × 105 cells in serum-free medium were seeded into the upper chamber which was pre-coated with Matrigel (BD, Bedford, MA, USA). After incubation for 24 h, cells that migrated onto the lower surface of the membrane were fixed with 100% methanol and stained with 0.1% crystal violet. Then the non-invading cells on the upper membrane surface were removed with cotton swabs. Cells on the lower surface were counted and photographed, respectively.

2.2. Cell culture

2.8. Bioinformatics analysis

HEEC, TE-1, TE-13, ECA-109, KYSE-410 and KYSE-520 cell lines were purchased from the Chinese Academy of Sciences (Shanghai, China). All the cells were cultured in RPMI-1640 medium with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) at 37 °C with 5% CO2.

Bioinformatics method was used to predict the potential targeting genes of miR-30c in this study. The results of TargetScan (release 5.1, http://www.targetscan.org/), miRWalk, PICTAR 5 and miRanda indicated that 3′-UTR of SNAI1 binds to miR-30c with the high score.

2.3. Isolation of total RNA and quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR)

2.9. Western blot

2.7. Transwell invasion assay

Total protein was extracted from cells, measured using a protein assay (bicinchoninic acid method; Beyotime). Proteins were fractionated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) transferred to polyvinylidene fluoride (PVDF) membrane, blocked in 5% dry milk at room temperature for 1 h and immunostained overnight at 4 °C using rabbit anti-snail (1:1000, Cell Signaling Technology, CST, USA), rabbit anti-E-cadherin (1:1000, CST), rabbit anti-N-cadherin (1:1000, CST) and rabbit anti-Vimentin (1:1000, CST). Rabbit anti-GAPDH (1:5000, CST) was used as a loading control. The membrane was washed with tris-buffered saline–0.1% Tween 20 and incubated with a goat anti-rabbit secondary antibody (CST) for 1 h at room temperature. Relative protein levels were quantified by Image J software.

Total RNA was extracted from fresh tissues, serum samples or cells using TRIzol (Invitrogen, USA) and both miRNA and mRNA were reversely transcribed to cDNA. The stem-loop primer for miR-30c was 5′GTC GTA TCC AGT GCA GGG TCC GAG TAT TCG CAC TGG ATA CGA CGC TGA-3′. U6 small nuclear RNA was used for normalization. The specific primers for PCR reactions are as follows: for hsa-miR-30c, forward, 5′-GCC GCT GTA AAC ATC CTA CAC T-3′ and reverse, 5′-GTG CAG GGT CCG AGG T-3′; for U6, forward, 5′-CTC GCT TCG GCA GCA CAT ATA CT- 3′ and reverse, 5′-ACG CTT CAC GAA TTT GCG TGTC- 3′; for SNAI1, forward, 5′- GAG TGG TTC TTC TGC GCT AC-3′ and reverse, 5′- AGG GCT GCT GGA AGG TAA ACT-3′;for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward, 5′-TGG GTG TGA ACC ATG AGA AGT-3′ and reverse, 5′-TGA GTC CTT CCA CGA TAC CAA-3′.

2.10. Plasmid construction and cell transduction 2.4. Transient transfection The 3′-UTR sequence of SNAI1 or a mutant sequence with the predicted target sites was inserted into the KpnI and SacI sites of pGL3 promoter vector (Genscript, Nanjing, China). They were named pGL3SNAI1 and pGL3-SNAI1-mut. The cells were planted onto 6-well plates and were transfected with 100 ng of pGL3-SNAI1 or pGL3-SNAI1-mut, and miR-30c mimics (50nM) by using Lipofectamine 2000 (Invitrogen). The differences in transfection efficiency were normalized by cotransfecting a Renilla luciferase vector pRL-SV40 (5 ng).

Small interfering RNAs (siRNA) specific for SNAI1 were purchased from GenPharma (Shanghai, China).The sequence used for si-SNAI1 was 5′- CCACTCAGATGTCAAGAAGTA3-'. To minimize nonspecific effects of interfering RNAs, non-targeting control siRNA was used as negative control. The siRNA transfection reagent (Invitrogen) was used according to the manufacturer’s instructions. Oligonucleotides negative control (NC), miR-30c mimics (mimics), inhibitor negative control (inhibitor NC) and miR-30c inhibitor (inhibitor) were purchased from GenePharma (Shanghai, China). Transfection of cells with oligonucleotides was performed using Lipofectamine 2000 Reagent (Invitrogen) at a final concentration of 100 nM. Transfection efficiency was monitored by qRT-PCR. The experiments were repeated at least three times, independently.

2.11. Luciferase report assay Luciferase report assay was measured in Victor 1420 Multilabel Counter (Wallac, Finland) using Luciferase Assay System (Promega, USA) according to the manufacturer’s protocol, 48 h after cell transfection.

2.5. Cell-proliferation assay (cell-counting kit-8) 2.12. Statistical analysis Cells were seeded into 96-well plates (6.0 × 103 cells per well). Cell viability was assessed by cell-counting kit-8 (CCK-8) assay (Beyotime, Shanghai, China). The absorbance of each well was read on a spectrophotometer (Thermo Scientific, Rockford, IL, USA) at 450 nm (A450). Three independent experiments were performed.

The chi-squared test was used to test the significance of differences in the data of Table 1. Pearson correlation was used for correlation analysis in Fig. 3E. Paired t-test was used for results in Fig. 1A. Unpaired t-test was used to determine the significant differences of other results. 681

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

P < 0.05 was considered to be statistically significant.

Table 1 Correlations between clinical factors and miR-30c expression in ESCC tissue and serum samples.

Factors Gender Male Female Age(years) < 60 ≥60 Differentiation Well/mod Poor Location Upper Lower and middle T-stage T I, T 2 T3, T4 N-stage N0, N1 N2, N3 M-stage M0 M1

miR-30c expression in tissue samples (n = 50)

miR-30c expression in serum samples (n = 100)

Low

Low

High

p

High

0.269 19 6

22 3

5 20

3 22

44 6

39 11

9 41

12 38

5 20

8 17

7 18

18 7

8 17

17 8

41 9

36 14

11 39

18 32

16 34

35 15

12 38

32 18

0.123

0.002*

< 0.001*

0.011*

< 0.001*

0.018* 25 0

First of all, the expression of miR-30c was analyzed in 50 ESCC samples and corresponding adjacent tissues by qRT-PCR. The miR-30c expression was significantly lower in tumor specimens compared with corresponding adjacent areas (p < 0.0001; Fig. 1A). Then, we categorized all those patients into two groups by the expression levels of miR-30c: one with more than median of miR-30c expression level and another with less than median of miR-30c expression level. After analyzing the clinical information of those patients, we found that miR-30c expression level in tumors had significant correlations with T-stage, Nstage and M-stage of ESCC (Table 1). Furthermore, ESCC patients with less miR-30c expression in cancer tissues had obviously shorter survival (median survival 12.5 months) than the patients with higher miR-30c expression in ESCC tissues (median survival 32.2 months; Fig. 1B). These results suggest that miR-30c might play a suppressive role in ESCC.

0.234

0.333

20 5

p

0.181

0.564 16 9

3.1. Down-regulation of miR-30c in tissues is correlated with poor survival

0.183

0.478

14 11

3. Results

3.2. Serum miR-30c is a non-invasive biomarker for ESCC diagnosis and prognosis

0.002* 39 11

49 1

It is known that serum miRNAs could be promising diagnostic and prognosis biomarkers for kinds of cancers. However, the expression pattern of miR-30c in the serum of ESCC patients has not yet been reported. To estimate the feasibility of miR-30c as a non-invasive biomarker, we recruited 100 ESCC patients and 50 healthy volunteers and analyzed the miR-30c expression levels of their serum samples. The mean expression level of miR-30c in the serum of ESCC patients was about half of that in healthy individuals (0.0214 ± 0.0016 vs

p -value represents the probability from a Student’s t-test for miR-30c expression between variable subgroups. M1 indicates the cervical metastasis. * p < 0.05 was considered to have a significant difference.

Fig. 1. Expression of miR-30c and its prognostic significance in ESCC. A: Mean miR-30c expression was significantly downregulated in ESCC tissues compared with paired adjacent tissues. B: Kaplan–Meier analysis of survival of 50 ESCC patients stratified according to tumor miR-30c expression level. C: Serum miR-30c level in 100 ESCC patients and 50 healthy control volunteers. D: Kaplan–Meier analysis of survival of 100 patients with ESCC stratified according to admission serum miR-30c level. *Indicates p < 0.05.

682

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

Fig. 2. miR-30c inhibited proliferation and invasion of ESCC cell lines in vitro. A: Expression levels of miR-30c in human esophageal epithelial cells (HEEC) and 5 ESCC cell lines (TE-1, TE-13, Eca-109, KYSE-410 and KYSE-520). B: The results of miR-30c expression level in cell lines transfected with miR-30c mimics, negative control (NC), inhibitor and negative control for inhibitor (inhibitor NC). C: CCK-8 assays shown distinct differences on proliferation after manipulation of miR-30c mimic and inhibitor in ESCC cells at 48-h and 72-h time points. D: Transwell assays showed that overexpression of miR-30c inhibited invasive ability of Eca-109 and TE-13 cells, and miR-30c knockdown promoted invasive ability of ESCC cells. *Indicates p < 0.05.

together, those results indicated a crucial role of miR-30c on repressing cell proliferation and invasion of ESCC in vitro.

0.0425 ± 0.0021; P < 0.0001; Fig. 1C).What's more, serum miR-30c expression levels had a substantial correlation with T-stage, N-stage and M-stage of ESCC (Table 1). In addition, lower miR-30c serum expression was significantly correlated with worse survival (Fig. 1D). Collectively, our data suggested that serum miR-30c could be developed into a promising non-invasive biomarker for ESCC diagnosis and prognosis.

3.4. MiR-30c directly targets and inhibits SNAI1 expression in ESCC To further explore the underlying molecular mechanism by which miR-30c influences the functions of ESCC cells, bioinformatics analysis (microRNA.org, miRDB and TargetScan database) was recruited. Among all those potential targets of miR-30c, what intrigues us the most is SNAI1, one of the most commonly used marker for EMT. Then, SNAI1 3′-UTR fragment was cloned into pGL3 luciferase reporter vector (pGL3–SNAI1) to further determine the association between miR-30c and SNAI1 expression. The 3′-UTR fragment with mutant sequence in the predicted target site was also cloned as a control group (pGL3–SNAI1–MUT). As the results showed, overexpression of miR-30c dramatically inhibited the luciferase activity of wild-type SNAI1, but mutation of the binding site of miR-30c on SNAI1 obviously blocked the inhibitory effects. (Fig. 3A). In addition, qRT-PCR and western blot assay were performed to evaluate the expression of SNAI1 in transfected TE-13 and ECA-109 cells. The results showed that up-regulated expression of miR-30c suppressed the expression of SNAI1 on both mRNA and protein levels, vice versa (Fig. 3B, C). More importantly, the inverse correlation between miR-30c and SNAI1 expressions in ESCC specimens suggests a regulatory mechanism between miR-30c and SNAI1 in ESCC development (Fig. 3E). Collectively, these findings showed that miR-30c could suppress SNAI1 expression, by binding to its 3′-UTR and conducting mRNA degradation, in ESCC.

3.3. MiR-30c inhibits proliferation and suppresses invasive ability of ESCC cells in vitro Expression level of miR-30c was examined in five ESCC cell lines (TE-1, TE-13, ECA-109, KYSE410 and KYSE-520) and a normal esophageal epithelial cell line (HEEC) by using qRT-PCR. As shown in Fig. 2A, compared with HEEC cell line, miR-30c expression was decreased in all five kinds of cancer cells. What’s more, the expression level of miR-30c was moderate in TE-13 and ECA-109 cell lines. Hence, those two cell lines were chose for further investigation. Then, cells were transfected with miR-30c mimics, negative control (NC), miR-30c inhibitor and inhibitor negative control (inhibitor NC), respectively. The transfection efficiency was validated by using qRT-PCR (Fig. 2B). The CCK-8 assay showed distinct difference on proliferation after manipulation of miR-30c at 72-h time point in both TE-13 and ECA-109 cells, while no significant difference was found at 24-h time point (Fig. 2C). Transwell invasion assay was carried out to test the function of miR-30c in ESCC invasion, which showed that ectopic expression of miR-30c inhibited cell invasion, and vice versa (Fig. 2D). Taken 683

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

Fig. 3. miR-30c regulated SNAI1 expression by directly binding its 3′-UTR A: The potential miR-30c seed region at the 3′-UTR of SNAI1 mRNA was computationally predicted by using TargetScan. TE-13 and ECA-109 cells were co-transfected with miR-30c mimics (or NC) with pGL3-SNAI1 (or pGL3-SNAI1-MUT) vector. Luciferase activity was normalized by the ratio of firefly and Renilla luciferase signals. B: SNAI1 mRNA expression levels in transfected ESCC cells were analyzed by using qRT-PCR. C: Snail expression level in transfected ESCC cells were analyzed by western blot. D: Knockdown of miR-30c induced EMT and overexpression of miR-30c reversed EMT in ESCC cells. E: A negative correlation was found between the expression of miR-30c and SNAI1 in ESCC tissues. * Indicates P < 0.05.

3.5. MiR-30c was involved in the regulation of EMT in ESCC cells

4. Discussion

Known as a famous regulator of EMT process, SNAI1 could directly activate E-cadherin expression. To further investigate the effects that miR-30c and SNAI1 made on the EMT of ESCC cells, western blot assay was performed to detect the expression of EMT markers. As shown in Fig. 3D, transfection of miR-30c resulted in obviously increased expression of E-cadherin and decreased expression of N-cadherin and Vimentin in both TE-13 and ECA-109 cells, and vise versa. These results strongly suggested that miR-30c was exactly involved in the regulation of EMT process of ESCC, probably via targeting SNAI1, in vitro.

Emerging evidence has shown that aberrant expressions of miRNAs, acting as critical regulators of initiation and development of malignant diseases, prevail in many types of cancers. Commonly introduced as a tumor suppressor, miR-30c has been reported in a variety of cancers, whereas no study addressed its expression or function in ESCC [8–11]. In the present study, for the first time, a remarkably down-regulation of miR-30c expression was detected by in ESCC tissue and serum samples, and that lower miR-30c expression was statistically correlated with their clinical and pathological features characterized by TNM stage and shorter survival. These results are similar to those for other malignant tumors, such as breast cancer, endometrial cancer, lung cancer and colorectal cancer [8–11], suggesting that miR-30c might act as an essential tumor suppressor in both tumorigenesis and development of ESCC. However, it remains confused that the levels of miR-30c in serum were significantly lower in ESCC patients, when the expression level of miR-30c in non-tumor esophagus tissue was comparatively maintained. It’s hard to figure out whether miR-30c expression in whole esophagus tissue is altered in ESCC patients, since we have not got any esophagus tissue from healthy controls. There may also be complex molecular mechanisms, such as a kind of competing endogenous RNA functioning in serum. Further investigations of this point are expected to be carried out by the following researcher. Nevertheless, results based on clinical ESCC samples strongly suggested that miR-30c might be a useful non-invasive diagnostic and prognostic biomarker. To our best knowledge, this is the first time that miR-30c was considered as a useful biomarker in ESCC, thus giving the study of vital importance.

3.6. Silence of SNAI1 could abolish the effects of down-regulated miR-30c At last, we carried out a rescue assay to investigate whether the effects of miR-30c made on ESCC cell lines relied on the expression of SNAI1. In our study, TE-13 and ECA-109 cells were transfected with miR-30c inhibitor and siRNA for SNAI1 (si-SNAI1). Meanwhile, cells transfected with miR-30c inhibitor and cells co-transfected with miR30c inhibitor and si-SNAI1-control were used as control groups. Compared with controls, cells transfected with miR-30c inhibitor and si-SNAI1 showed significant lower expression of SNAI1 on both mRNA and protein levels (Fig. 4A, B). Then, transwell invasion assay was performed. Compared with controls, the invasion ability of si-SNAI1 groups was significantly suppressed (Fig. 4C). Here we can draw a conclusion that the effects miR-30c had made on ESCC cells were at least partly dependent on the modulation of SNAI1. 684

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

Fig. 4. Knockdown of SNAI1 abolished the effects of down-regulated miR-30c. A: ESCC cells were co-transfected. Cells transfected with miR-30c inhibitor and cells co-transfection cells with miR-30c inhibitor and si-SNAI1-NC were used as control groups. B: The transfection efficiency was confirmed by using western blot assays. C: The representative images of transwell assays. *Indicates P < 0.05.

latest study clamming miR-30a/c-5p directly inhibited DNMT1 and Snail in cisplatin-resistant ovarian cancer cell [23], we made a bold assumption that miR-30c could suppress SNAI1 expression by binding to its 3′-UTR in ESCC. As expected, western blot assay showed a significant decrease of Snail expression in cell transfected with miR-30c mimic. But the gold standard to demonstrate whether a gene is the target of a miRNA is luciferase assay. Actually, a study published 2 years ago demonstrated that miR-30c could affect liver fibrosis by directly targeting SNAI1 [24]. In our study, as the results showed, overexpression of miR-30c dramatically inhibited the luciferase activity of wild-type SNAI1, but mutation of the binding site of miR-30c on SNAI1 obviously blocked the inhibitory effects. It is well documented that Snail is crucial regulator of EMT by repressing the transcription of Ecadherin [13]. However, the sophisticated regulation of EMT could never be simply elucidated as the function of single factor, as well as the regulation of E-cadherin transcription. MiR-30c, reported as a tumor suppressor and an EMT blocker for the first time in ESCC, remains much more to be researched by the following studies and has great potential clinical application in diagnosis and prognosis of ESCC. In summary, the present study demonstrated that miR-30c was significantly correlated with ESCC progression and survival. Moreover, down-regulation of miR-30c enhanced proliferation and invasion of ESCC cells via negative regulation of SNAI1 expression and promotion of EMT process. Our study provides new insight into the mechanism responsible for the development of human ESCC. Therefore, miR-30c could be a promising biomarker and a therapeutic target for ESCC in the future.

Then we conducted a series of cell experiments to further investigate the biological effects miR-30c would make on ESCC cells. Compared with HEEC, the expression levels of miR-30c were found obviously decreased in 5 kinds of ESCC cell lines. Accordingly, we speculated that miR-30c might inhibit ESCC carcinogenesis and progression in some way. Next, we further investigated the biological functions of miR-30c in ESCC cell lines. As expected, introduction of miR-30c repressed cell proliferation in both TE-13 and Eca109. Moreover, miR-30c-transfected cells also showed a markedly decrease in cell migration, and vise versa. Most especially, western bolt assays revealed that miR-30c could increase the expression of E-cadherin and decrease the expression of N-cadherin and Vimentin. All results above indicated that miR-30c must be a tumor suppressor of ESCC, and in vivo experiments need to be performed in the following studies. Here we aimed at uncovering the potential underlying molecular mechanisms. During the past decades, the regulation of E-cadherin provided significant insights into the molecular mechanisms concerning tumor invasion [15]. What’s more, transcriptional repression of E-cadherin has been regarded as one of the fundamental mechanisms for inhibition of EMT process [16,17]. Transcription factor SNAI1, one of the zinc finger factors, is crucial to the initiation of EMT during tumor progress [18]. Studies indicated that SNAI1 was associated with the suppression of E-cadherin expression in kinds of cancers, including gastric cancer [19], hepatocellular carcinoma [20] and melanoma [21]. In fact, Japanese researchers SHOJI et al. claimed Snail, the protein product of gene SNAI1, played a key role in E-cadherin-preserved ESCC as early as 10 years ago[14]. A recent study conducted by Jin et al. found SNAI1 was up-regulated in metastatic progression of ESCC, claiming that SNAI1 may exert its functions in migration of ESCC cells by modulating EMT progress [22]. However, precise mechanism concerning the regulation of SNAI1 expression in ESCC is rarely studied though. Based on the results of prediction of bioinformatics analysis and a

Funding This work was supported by the grant from the National Natural Science Foundation of China (no. 81702899). 685

Biomedicine & Pharmacotherapy 98 (2018) 680–686

T. Ma et al.

Ethical approval

gene-1, Oncol. Rep. 27 (3) (2012) 807–812. [10] Z. Zhong, Y. Xia, P. Wang, B. Liu, Y. Chen, Low expression of microRNA-30c promotes invasion by inducing epithelial mesenchymal transition in non-small cell lung cancer, Mol. Med. Rep. 10 (5) (2014) 2575–2579. [11] Q. Zhang, L. Yu, D. Qin, R. Huang, X. Jiang, C. Zou, Q. Tang, Y. Chen, G. Wang, X. Wang, X. Gao, Role of microRNA-30c targeting ADAM19 in colorectal cancer, PLoS One 10 (3) (2015) e0120698. [12] J.P. Thiery, H. Acloque, R.Y. Huang, M.A. Nieto, Epithelial-mesenchymal transitions in development and disease, Cell 139 (5) (2009) 871–890. [13] D. Olmeda, M. Jorda, H. Peinado, A. Fabra, A. Cano, Snail silencing effectively suppresses tumour growth and invasiveness, Oncogene 26 (13) (2007) 1862–1874. [14] S. Natsugoe, Y. Uchikado, H. Okumura, M. Matsumoto, T. Setoyama, K. Tamotsu, Y. Kita, A. Sakamoto, T. Owaki, S. Ishigami, T. Aikou, Snail plays a key role in Ecadherin-preserved esophageal squamous cell carcinoma, Oncol. Rep. 17 (3) (2007) 517–523. [15] J.P. Thiery, Epithelial-mesenchymal transitions in tumour progression, Nat. Rev. Cancer 2 (6) (2002) 442–454. [16] W. Birchmeier, J. Behrens, Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness, Biochim. Biophys. Acta 1198 (1) (1994) 11–26. [17] J.P. Thiery, J.P. Sleeman, Complex networks orchestrate epithelial-mesenchymal transitions, nature reviews, Mol. Cell Biology 7 (2) (2006) 131–142. [18] A. Cano, M.A. Perez-Moreno, I. Rodrigo, A. Locascio, M.J. Blanco, M.G. del Barrio, F. Portillo, M.A. Nieto, The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression, Nat. Cell Biol. 2 (2) (2000) 76–83. [19] Y. Yanaka, T. Muramatsu, H. Uetake, K. Kozaki, J. Inazawa, miR-544a induces epithelial-mesenchymal transition through the activation of WNT signaling pathway in gastric cancer, Carcinogenesis 36 (11) (2015) 1363–1371. [20] F.D. Meng, J.C. Wei, K. Qu, Z.X. Wang, Q.F. Wu, M.H. Tai, H.C. Liu, R.Y. Zhang, C. Liu, FoxM1 overexpression promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma, World J. Gastroenterol. 21 (1) (2015) 196–213. [21] J.E. Kim, E. Leung, B.C. Baguley, G.J. Finlay, Heterogeneity of expression of epithelial-mesenchymal transition markers in melanocytes and melanoma cell lines, Front. Genet. 4 (2013) 97. [22] L. Jin, J. Yi, Y. Gao, S. Han, Z. He, L. Chen, H. Song, MiR-630 inhibits invasion and metastasis in esophageal squamous cell carcinoma, Acta Biochim. Biophys. Sin. 48 (9) (2016) 810–819. [23] X. Han, S. Zhen, Z. Ye, J. Lu, L. Wang, P. Li, J. Li, X. Zheng, H. Li, W. Chen, X. Li, L. Zhao, A feedback loop between miR-30a/c-5p and DNMT1 mediates cisplatin resistance in ovarian cancer cells, Cell. Physiol. Biochem.: Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 41 (3) (2017) 973–986. [24] S. Roy, F. Benz, D.Vargas Cardenas, M. Vucur, J. Gautheron, A. Schneider, C. Hellerbrand, N. Pottier, J. Alder, F. Tacke, C. Trautwein, C. Roderburg, T. Luedde, miR-30c and miR-193 are a part of the TGF-beta-dependent regulatory network controlling extracellular matrix genes in liver fibrosis, J. Dig. Dis. 16 (9) (2015) 513–524.

All patients provided a written informed consent for sample collection, and further analysis was approved by the local Ethics and Research Committee. The study has been performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Disclosure of interest None. Acknowledgements We thank Dr. Xia from First Affiliated Hospital of Nanjing Medical University, for providing ESCC cell lines. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA: Cancer J. Clin. 65 (2) (2015) 87–108. [2] P.C. Enzinger, R.J. Mayer, Esophageal cancer, N. Engl. J. Med. 349 (23) (2003) 2241–2252. [3] L. He, G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation, Nat. Rev. Genet. 5 (7) (2004) 522–531. [4] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2) (2009) 215–233. [5] Z. He, H. Xu, Y. Meng, Y. Kuang, miR-944 acts as a prognostic marker and promotes the tumor progression in endometrial cancer, Biomed. Pharmacother. = Biomedecine & Pharmacotherapie 88 (2017) 902–910. [6] Y. Liu, F. Wang, P. Xu, miR-590 accelerates lung adenocarcinoma migration and invasion through directly suppressing functional target OLFM4, Biomed. Pharmacother. = Biomedecine & Pharmacotherapie 86 (2017) 466–474. [7] F. Tavanafar, R. Safaralizadeh, M.A. Hosseinpour-Feizi, B. Mansoori, D. Shanehbandi, A. Mohammadi, B. Baradaran, Restoration of miR-143 expression could inhibit migration and growth of MDA-MB-468 cells through down-regulating the expression of invasion-related factors, Biomed. Pharmacother. = Biomedecine & Pharmacotherapie 91 (2017) 920–924. [8] J. Bockhorn, K. Yee, Y.F. Chang, A. Prat, D. Huo, C. Nwachukwu, R. Dalton, S. Huang, K.E. Swanson, C.M. Perou, O.I. Olopade, M.F. Clarke, G.L. Greene, H. Liu, MicroRNA-30c targets cytoskeleton genes involved in breast cancer cell invasion, Breast Cancer Res. Treat. 137 (2) (2013) 373–382. [9] H. Zhou, X. Xu, Q. Xun, D. Yu, J. Ling, F. Guo, Y. Yan, J. Shi, Y. Hu, microRNA-30c negatively regulates endometrial cancer cells by targeting metastasis-associated

686