Molecular characterization of hypoxia inducible factor-1 (HIF-1) from the white shrimp Litopenaeus vannamei and tissue-specific expression under hypoxia

Molecular characterization of hypoxia inducible factor-1 (HIF-1) from the white shrimp Litopenaeus vannamei and tissue-specific expression under hypoxia

Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405 Contents lists available at ScienceDirect Comparative Biochemistry and Physiology...

2MB Sizes 11 Downloads 33 Views

Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p c

Molecular characterization of hypoxia inducible factor-1 (HIF-1) from the white shrimp Litopenaeus vannamei and tissue-specific expression under hypoxia José G. Soñanez-Organis a, Alma B. Peregrino-Uriarte a, Silvia Gómez-Jiménez a, Alonso López-Zavala a, Henry Jay Forman b, Gloria Yepiz-Plascencia a,⁎ a b

Centro de Investigación en Alimentación y Desarrollo (CIAD), A.C., P.O. Box 1735, Carretera a la Victoria Km. 0.6 Hermosillo, Sonora C.P. 83000, Mexico University of California, Merced, CA, USA. School of Natural Sciences, P.O. Box 2039, Merced, CA 95344, USA

a r t i c l e

i n f o

Article history: Received 11 March 2009 Received in revised form 9 June 2009 Accepted 11 June 2009 Available online 21 June 2009 Keywords: Hypoxia Crustaceans Anaerobic metabolism Glycolysis Hypoxia inducible factor 1 (HIF-1)

a b s t r a c t Hypoxia inducible factor 1 (HIF-1) is a key transcription factor that regulates a variety of molecular responses to hypoxia. Some marine crustaceans experience changes of oxygen tension in their aquatic environment, but knowledge about the function and expression of HIF-1 is very limited. HIF-1 is a heterodimer composed by α and β subunits. We report the complete cDNA sequences of HIF-1α and HIF-1β from the white shrimp Litopenaeus vannamei. HIF-1α (LvHIF-1α) is 3672 bp and codes for 1050 amino acids, while HIF-1β is 2135 bp (LvHIF-1β) and 608 amino acids. Both, the α and β subunits have the helix-loop-helix (bHLH) and PAS domains. HIF-1α also has the oxygen dependent degradation (ODD) and the C-terminal transactivation domain (C-TAD), important for regulation in normoxia. Phylogenetic analyses of the proteins indicate separation of invertebrates from vertebrates. Large differences of HIF-1α and HIF-1β transcripts abundance were detected in gills, hepatopancreas and muscle under normoxia (6 mg/L dissolved oxygen, DO) and hypoxia (2.5 and 1.5 mg/L DO). HIF-1α was more abundant in gills and HIF-1β in hepatopancreas. Large changes in response to hypoxia were detected for HIF-1α in gills, while HIF-1β remained fairly constant. Glucose and lactate in hemolymph increased rapidly in hypoxia in all cases and up to 4.7 and 5.0-fold, respectively, in response to 1.5 mg/L DO for 1 h. © 2009 Elsevier Inc. All rights reserved.

1. Introduction The Pacific white shrimp Litopenaeus vannamei is the most commonly cultured shrimp not only in America, but also in Asia. Global shrimp farming production increasing at an average rate of 12% totaling nearly 2.3 million tons in 2006 and the vast majority of the growth is due to L. vannamei (Hedlund, 2007). In particular in Northwest Mexico, in the state of Sonora, shrimp farming production increased 900% during the last three years (Anonymous, 2008). However, during shrimp farming and also in natural environmental conditions, episodes of low dissolved oxygen in water (DO) or hypoxia do occur (Martínez-Palacios et al., 1996; Rosas et al., 1999). Some penaeid shrimp, in contrast to other crustaceans, can tolerate low concentrations of DO (Rosas et al., 1999), but this may affect growth (Seidman and Lawrence, 1985; Rosas et al., 1998; Ocampo et al., 2000). Oxygen conformation and oxygen regulation are physiologic and metabolic responses adopted by crustaceans under hypoxia (Hochachka,1988; McGaw et al.,1994; Reiber,1995; Reiber and McMahon, 1998; Wilkens, 1999). Oxygen conformers reduce metabolic demand for O2 consumption as response to environmental O2 levels (Loudon, 1988; Hochachka et al., 1999; Boutilier, 2001). Oxygen regulators maintain O2

⁎ Corresponding author. Tel.: +52 662 289 24 00; fax: +52 662 28004 21. E-mail address: [email protected] (G. Yepiz-Plascencia). 1532-0456/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2009.06.005

consumption independent of the environmental O2 levels until a point where O2 consumption is limiting (critical point, PCRIT) to maintain the aerobic process (Herreid, 1980; Hochachka, 1988). Below PCRIT, anaerobic processes as anaerobic glycolysis become import to satisfy energy requirements (Hochachka, 1988). PCRIT to L. vannamei is 5 mg/L DO (Martínez-Palacios et al., 1996). L. vannamei shift to anaerobic glycolysis in long term (three and five days) and short term (6, 12 and 24 h) of moderate (2–2.6 mg/L DO) and severe (1.0 mg/L DO) hypoxia, respectively (Racotta et al., 2002; Zenteno-Savín et al., 2006). Hypoxia inducible factor (HIF-1) is a transcription factor that regulates dozens of genes involved in the response to hypoxia, including erythropoietin, vascular endothelial growth factor, glycolytic enzymes, vasodilation, angiogenesis and glucose transporters (Harris, 2002; Semenza, 2001a,c; Trenin et al., 2003). In mammals, HIF-1 is a heterodimeric DNA-binding complex consisting of α and β subunits (β is also known as aryl hydrocarbon receptor nuclear translocator, or ARNT) that are members of the basic helix-loop/Per-Arnt-Sim (bHLH/PAS) family of proteins (Wang et al., 1995), characterized for containing bHLH and PAS conserved domains. The bHLH domains are responsible for oligomerization and DNA binding, while the PAS domains are also involved in dimerization, target specificity and transactivation (Semenza, 2001a,b). The bHLH domain is formed by approximately 60 amino acids with two functionally distinct regions. The first region is basic (composed by 15 amino acids), located at the N-terminal domain that is involved in DNA binding. The second region contains mainly hydrophobic residues

396

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

that function as a dimerization domain and is present in the C-terminal (Semenza, 2001a,b). PAS is an acronym formed from the names of the proteins in which were first identified: the Drosophila period clock protein (PER), vertebrate aryl hydrocarbon receptor nuclear translocator (ARNT), and the insect single-minded protein (SIM) (Nambu et al., 1991). PAS domains are sensor modules to changes in oxygen tension, redox potential or light intensity, and also mediate protein–protein interaction or binding to ligands. The primary structures between PAS domains show little similarity, but their secondary structures appear to be conserved. The PAS domain can be 200–300 amino acids long and contain two loosely conserved hydrophobic regions of approximately 50 amino acids (named as PAS A and PAS B) that functions as a dimerization interface between family members (Taylor and Zhulin, 1999). The α and β subunits of the HIF-1 genes are mainly constitutively transcribed and translated independently of oxygen tension, but only HIF-1α is regulated at the pos-translational level (Semenza, 2001a). HIF-1α contains two regions that modulate its activity as a function of oxygen availability, an oxygen dependent degradation domain (ODD) and the C-terminal transactivation domain (C-TAD). Under normoxic conditions, conserved proline and asparagine residues within these regions are hydroxylated by a family of hydroxylases (Bruick and McKnight, 2001; Epstein et al., 2001). This posttranslational modification permits interaction with the von Hippel–Lindau tumor suppressor protein (pVHL), a component of the protein–ubiquitin ligase complex that tags HIF-1α for rapid degradation (Ivan et al., 2001; Jaakkola et al., 2001; Yu et al., 2001). In hypoxia, hydroxylation is low, leading to accumulation of HIF-1α and its interaction with HIF-1β and subsequent induction of transcription of its target genes. For example, expression of eight of twelve glycolytic mammalian enzymes genes is induced during hypoxia by HIF-1. In human muscle cells, the change from aerobic to hypoxic growth conditions results in an approximately 3- to 5-fold increase of glycolytic enzyme proteins (Webster et al., 1993, 1994, 1999). Molecular and physiological adaptations are very important for some crustaceans to respond to frequent conditions of hypoxia and anoxia in their natural and culture environments. However, little is known about the structure and expression of the molecules that participate in these responses. Few crustacean HIF-1 sequences are known. Currently the sequences of HIF-1α from the grass shrimp Palaemonetes pugio (GenBank accession No. AAT72404), crab Cancer magister (ABF83561) and three partial sequences of the blue crab Callinectes sapidus (ABQ63087), the water flea Daphnia magna (BAG69568) and a small partial sequence of the shrimp L. vannamei (ACG71108) are available in GenBank, the later one became available after we had the first partial sequence from shrimp. The crustacean HIF-1α complete sequences have the bHLH, PAS, ODD and C-TAD domains. Interestingly, in these crustacean sequences, there is a unique 230 amino acid extention in the C-terminals that is not found in any vertebrate HIF-1α. For HIF-1β in crustaceans, the only one known is from the water flea D. magna (BAE94238). We obtained the full-length cDNA sequences of HIF-1 (α and β) from the white shrimp L. vannamei and the quantification of the transcripts (α and β) in different tissues; glucose and lactate concentrations in plasma under normoxic and hypoxic conditions were also determined. 2. Materials and methods 2.1. Experimental hypoxia, glucose and lactate concentrations Healthy subadult white shrimp, L. vannamei (15 ± 2 g) were obtained from a shrimp farm located in the state of Sonora, Mexico. Apparently healthy shrimps were considered if no pathogens (bacterium and virus) were found and the shrimp had normal coloration and behavior (data not shown). After acclimating for a couple of weeks to laboratory conditions in a re-circulated seawater system; an experimental group of 15 shrimp were randomly placed in a

50-L glass aquarium with temperature control (28 °C), 35 ppm salinity, controlled light and constant aeration. Shrimps were fed with a commercial shrimp diet (35% protein, Purina), using a daily ration of 5% of total biomass. Before experimental conditions, water was exchanged 50% and food that was not ingested and feces were removed. Sub-groups of 3 shrimp were sampled at each of the following experimental conditions: a) normoxia (6 ± 0.3 mg/L DO) followed by exposure to b) 2.5 ± 0.1 mg/L DO for 1 h; c) 1.5 ± 0.1 mg/L DO for 1 h and d) 1.5 ± 0.3 mg/L DO for 24 h. No mortality occurred under the experimental conditions. The particular oxygen levels were obtained by bubbling the media with fixed ratios of nitrogen gas and air. Dissolved oxygen, temperature and salinity were monitored continuously during all the experiments. DO was measured using a handheld oxygen meter. Hemolymph samples (200 μL) from each shrimp were removed through the arthrodial membrane of the cephalotorax–abdomen joint with a disposable syringe containing 200 μL of anticoagulant isotonic solution (10 mM EDTA, 450 mM NaCl, 10 mM HEPES, pH 7.3). Plasma was separated from hemocytes by centrifugation at 800g for 10 min and used for glucose and lactate determination. After hemolymph sampling, gills, hepatopancreas and muscle were dissected and frozen in liquid nitrogen and kept at −80 °C until HIF-1 expression analysis. Glucose and lactate were determined using 10 μL of plasma with commercial kits from Randox and adapting the methods for microplates. 2.2. HIF-1α and HIF-1β cDNA cloning Degenerate primers HIFfw4, HIFrw4, HIFaD1Rv and HIFaD2Rv (Table 1) were designed based on the conserved HIF-1α amino acids sequence regions GRKEKSWDA, KGQVTTGQY, MRAPFIP and LDCELNAP, respectively, since the partial HIF-1 α sequence was not yet available in GenBank at that time. For HIF-1β, the degenerate primers ARNTF1 and ARNTR2 (Table 1) based on the conserved HIF-1β amino acids sequence regions AVAHMK and AVVHCTG, respectively, were used. These primers were used to amplify each subunit of HIF-1 using as template cDNA. The cDNA was synthesized from total RNA (1 μg) previously extracted using TRIzol (Invitrogen) by reverse transcription (RT) with Superscript II Reverse Transcriptase (Invitrogen) and a modified oligo-dT primer CDS III/3′ and SMARTIV (Table 1) from Clontech.

Table 1 Primers used to obtain the cDNA sequences of HIF-1 (α and β). Primer name

Nucleotide sequences (5′–3′)

HIFfw4 HIFfw7 HIFfw8 HIFrw4 HIFrw5 HIFrw6 HIFaD1Rv HIFaD2Rv HIFrtF HIFrtR1 ARNTF1 ARNTR2 ARNTF3 ARNTF4 ARNTF5 ARNTrtF ARNTR3 ARNTR4 ARNTR5 ARNTC50F6 ARNTrtR1 L8F2 L8R2 CDSIII/3′ SMARTIV™

CGGAARGAGAARTCCMGNGAYGCNGC GTCAAGGAGGCCTACAAG GACTGTGAGCTTAATGCACC GGTACTGGCCGGTCGTCMCYTGNCCYTT GCGCTCTTGAGGTTGACG CTCGATGTTGGACGGGTG GGDATGWAVGGWGCYCTCAT GGWGCATTDACYTCAHARTC GGAGTCTTTGAGAGAGAG GCCTCCTTCCGTGATCTTC GGCHGTDKCWCACATGAA CCYGTGCARTGVACHAC CCTTGAAGCGGCAGATGGC GTGCACCCAGAAGATGTGGAG CGCAACTGATGGACATAAC CAAGAGCCAGCCAACCAAG CCCGTGCAGTGGACTACAGC CTGCACCAACTTTCATGCGGC GGGTGCACGTGTTCATAG CCAACGGGAATGGAATG CTGCGTCAGAGAAATTCC TAGGCAATGTCATCCCCATT TCCTGAAGGAAGCTTTACACG ATTCTAGAGGCCGAGGCGGCCGACATG-(T)28NN AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

The first HIF-1α fragment was obtained by PCR using the following conditions: for a 30 μL final volume reaction, 27 μL of Platinum PCR SuperMix (Invitrogen), 1 μL of cDNA from gills and 1 μL (20 μM) of each primer (HIFfw4 + HIFrw4) were mixed and subjected to the following conditions: 75 °C for 10 min for 1 cycle; 94 °C for 3 min for 1 cycle; 3 cycles of 94 °C for 30 s, 60 °C for 1 min and 68 °C for 1 min; 33 cycles of 94 °C for 30 s, 55 °C for 1 min and 68 °C for 1 min; and an overextension step of 68 °C for 10 min. A PCR fragment of ∼800 bp (Lvα800) was obtained, sequenced and identified as HIF-1α. The Lvα800 sequence was used to design the HIFrtF, HIFrtR1, HIFfw7, HIFrw6 and HIFrw5 primers (Table 1). The second PCR conditions to obtain HIF-1α were: a 30 μL final volume reaction containing 27 μL Platinum PCR SuperMix, 1 μL of cDNA from gills and 1 μL (20 μM) of each primer (HIFfw7 + HIFaD1Rv or HIFDα2Rv) under the following conditions: 5 cycles of 94 °C for 30 s, 55 °C for 1 min and 68 °C for 3 min; 35 cycles of 94 °C for 30 s, 50 °C for 1 min and 68 °C for 3 min; and an overextension step of 68 °C for 10 min. Two PCR fragment were obtained, one of ∼ 1200 bp (Lvα1200) and another of ∼ 2200 bp (Lvα2200) and identified as HIF-1α. By overlapping of Lvα800, Lvα1200 and Lvα2200 sequences, a consensus sequence of 2988 bp (Lvα2988) was obtained and used to design the HIFfw8 primer. Since the HIF-1α cDNA sequence was not complete, we used 5′RACE with the reverse primers (HIFrw6, HIFrw5 and HIFrtR1) and DNA Walking SpeepdUPTM Premix Kit (Seegene) to complete the fulllength sequence. Following the recommendation of the manufacturer, one PCR fragments of ∼300 bp (Lvα5′) was obtained using cDNA from gills. The PCR fragment Lvα5′ was identified as HIF-1α. For the 3′-end RACE, the HIFfw8 and CDS III/3′ primers were used as follows: a 30 µL final volume reaction containing 27 μL Platinum PCR SuperMix , 1 μL of cDNA from gills and 1 μL (20 μM) of each primer under the following conditions: 5 cycles of 94 °C for 30 s, 55 °C for 1 min and 68 °C for 1.5 min; 35 cycles of 94 °C for 30 s, 60 °C for 1 min and 68 °C for 1.5 min; and an overextension step of 68 °C for 10 min. A PCR fragment of ∼ 500 bp (Lvα3′) was obtained and the cDNA sequence for HIF-1α consisting of 3672 bp and named LvHIF-1α was completed by overlapping Lvα2988, Lvα5′ and Lvα3′ sequences. The first PCR fragment for HIF-1β was obtained using the ARNTF1 + ARNTR2 primers (Table 1) and as template cDNA from gills under the following conditions: 75 °C for 10 min for 1 cycle; 94 °C for 3 min for 1 cycle; 3 cycles of 94 °C for 30 s, 48 °C for 1 min and 68 °C for 1 min; 33 cycles of 94 °C for 30 s, 50 °C for 1 min and 68 °C for 1 min; and an overextension step of 68 °C for 10 min. A PCR fragment of ∼650 pb (Lvβ650) was identified as HIF-1β. ARNT forward and reverse (Table 1) primers were designed from the Lvβ650 sequence and used to obtain the 5′- and 3′-ends by RACE as before. The ARNTR3, ARNT4 and ARNT5 reverse sets primers were used with the DNA Walking SpeepdUPTM Kit to obtain the 5′-end. Following the recommendations for the kit, a PCR fragment of ∼478 bp (Lvβ5′) was obtained from gills cDNA and identified as HIF-1β. For the 3′-end RACE for HIF-1β, the ARNTC50F6 forward and CDS III/3′ reverse primers were used as follows: a 30 μL final volume reaction containing 27 μL Platinum PCR SuperMix (Invitrogen), 1 μL of cDNA from gills and 1 μL (20 µM) of each primer under the following conditions: 94 °C, 3 min (1 cycle), 94 °C, 30 s; 50 °C, 1 min; 68 °C, 3 min (40 cycles), and finally 68 °C for 10 min. The above reaction was re-amplified with the CDS III/3′ primer and ARNTrtF, ARNTF3, ARNTF4 and ARNTF5 forward primers as follow: a 30 μL final volume reaction containing 27 μL Platinum PCR SuperMix, 1 μL of reaction 1, 1 μL (20 µM) of each primer under the following conditions: 94 °C, 3 min (1 cycle), 94 °C, 30 s; 60 °C, 1 min; 68 °C, 3 min (40 cycles), and finally 68 °C for 10 min. For each specific primer pair, different PCR fragments were obtained: a 1622 bp with the ARNTrtF primer, 1700 bp with ARNTF3 primer, 1664 bp with ARNTF4 primer and 1419 bp with ARNTF5 primer. The four PCR products were identified as HIF-1β (Lvβ3′, see Results). The complete cDNA sequence for HIF-1β was obtained by overlapping of Lvβ650, Lvβ5′ and Lvβ3′ resulting in a sequence of 2135 bp for HIF-1β and named LvHIF-1β.

397

The different PCR products obtained were cloned using pGEM®-T Easy Vector System (Promega) or TOPO TA Cloning® (Invitrogen) and sequenced. The PCR products were identified as HIF-1α or HIF-1β sequences by comparison to GenBank data using the Blast algorithm (Altschul et al., 1990). Specific primers were designed using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www. cgi) (Rozen and Skaletsky, 2000) (Table 1). Analysis of the predicted HIF-1α and HIF-1β amino acid sequences were done as follows: the predicted amino acid sequences were obtained using the web site http://arbl.cvmbs.colostate.edu/molkit/translate/ and aligned with other HIF-1α and HIF-1β sequences using Clustal W (Thompson et al., 1994). The nucleotide and deduced protein sequences were compared to non-redundant nucleotide, ESTs, and protein databases using BLAST (Altschul et al., 1990). 2.3. Phylogenetic analysis Phylogenies for HIF-1α and HIF-1β deduced amino acid sequence were constructed separately. A multiple alignment of the deduced amino acid sequences of HIF-1 (α or β) was performed with Clustal W (Thompson et al., 1994). The sequences included have the following GenBank accession numbers: HIF1-α: L. vannamei, FJ807918; P. pugio, AAT72404; Tribolium castaneum, XP_967427; C. magister, ABF83561; Apis mellifera, XP_392382; Drosophila melanogaster, AAC47303; Oncorhynchus mykiss, AAK30364; Epinephelus coioides, AAW29027; Ctenopharyngodon idella, AAR95697; Gallus gallus, BAA34234; Mus musculus, NP_034561; Xenopus laevis, CAB96628; Homo sapiens, AAF20149; HIF-2α: Fundulus heteroclitus, AAL95711; Danio rerio, ABD33838; C. idella, AAT76668; H. sapiens, AAC51212; M. musculus, NP_034267; HIF-3α: D. rerio, AAQ94179; M. musculus, AAC72734; H. sapiens, AAD22668; HIF-4α: C. idella, AAR95698; E. coioides, AAW29028 and C. elegans HIF-1 homolog, CAA19521. GenBank accession numbers for HIF-1β are: L. vannamei, FJ807919; Rattus norvegicus, AAO89090; Oryctolagus cuniculus, BAA19931; Xenopus (Silurana) tropicalis, AAI61511; M. musculus NP_001032826 and NP_033839 (isoforms a and b respectively): H. sapiens, NP_001659, NP_848513 and NP_848514 (isoforms 1, 2 and 3, respectively); D. melanogaster, NP_731308; D. magna, BAE94238; Aedes aegypti, EAT37685; D. rerio, NP_001007790, NP_001011712 and NP_001038736 (isoforms a, b and c, respectively) and HIF-2β: D. rerio, NP_571749. The neighbor-joining method Jones–Taylor–Thornton matrix based was applied to molecular phylogenetic analyses using 1000 replicates to calculate a tree in MEGA software version 4 (Tamura et al., 2007). 2.4. HIF-1α and HIF-1β expression analysis Total RNA was isolated using TRIzol (Invitrogen) individually from shrimp tissues (gills, hepatopancreas and muscle) that had been exposed to the experimental conditions (normoxia and hypoxia) to investigate HIF-1 (α and β) expression. RNA integrity was confirmed by 1% agarose-formaldehyde gel electrophoresis (Sambrook and Russell, 2001). Two separate cDNAs from the tissues were synthesized from total DNA-free RNA (1 μg) using oligo-dT and the QuantiTect Reverse Transcription kit (Qiagen). HIF-1 (α and β) expression levels were compared to the ribosomal protein L8 as an internal standard (DQ316258) (Gómez-Anduro et al., 2006). HIF-1 (α and β) and L8 transcripts were determined by quantitative RT-PCR (qRT-PCR) using the following primers (Table 1): for HIF-1α, HIFrtF and HIFrtR1; for HIF1β, ARNTrtF and ARNTrtR1; and for L8, L8F2 and L8R2. Two separate cDNA reactions and two PCR reactions for each individual shrimp and tissue were done (four replicates for each individual shrimp) for qRTPCR on an iQ5 Real-Time PCR Detection System (Bio-Rad) in 20 μL final volume containing 10 μL of iQ SYBR Green Supermix (Bio-Rad), 6 μL of H2O, 0.5 μL of each primer (20 μM) and 3 μL of cDNA (equivalent to 50 ng of total RNA). After denaturing at 95 °C for 5 min, amplifications were performed for 40 cycles at 95 °C for 30 s, 60 °C for 35 s and a final step at 72 °C for 55 s, with a single fluorescence measurement and a final

398

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

melting curve program decreasing 0.3 °C each 20 s from 95 °C to 60 °C. Positive and negative controls were included. Standard curves of HIF-1 (α and β) and L8 were run to determine the efficiency of amplification using dilutions from 5 × 10− 4 to 5 × 10− 8 ng/μL of PCR fragments. For each measurement, expression levels (ng/μL) were normalized to L8 and expressed as relative values (HIF-1/L8).

2.5. Statistical methods Statistical analyses were performed using the software package STATISTICA 8 (StatSoft, Inc). Data set were normalized to test the statistical significance of treatment effect and a one-way Model I ANOVA was performed. Significant differences between group means were

Fig. 1. Nucleotide and predicted amino acid sequence of the L. vannamei HIF-1α cDNA. Primer sequences are shown in bold and underlined; the asterisk indicates the stop codon. The prolines and the asparagines that are hydroxylated are underlined and enclosed in a box, respectively.

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

399

Fig. 1 (continued).

determined using Post hoc Duncan's multiple range tests. The normal distribution of data set and homogeneity of variances was confirmed used the Kolmogorov–Smirnov and Levene's tests (Lilliefors, 1967), respectively. Values are reported as means ± SD, and statistical significant differences were considered at P b 0.05. 3. Results 3.1. Shrimp HIF-1α and HIF-1β coding sequences Partial cDNA sequences for HIF-1α (LvHIF-1α) and HIF-1β (LvHIF-1β) were obtained using degenerate primers. Overlapping fragments were obtained using 5′ and 3′-RACE. In both cases, the complete cDNAs were assembled and both strands were thoroughly sequenced. The shrimp LvHIF-1α (FJ807918) is 3672 bp long with the start and stop codons at positions 79 and 3229, respectively. The 5′ and 3′ untranslated regions (UTR) are 78 and 441 bp long, excluding the poly-A tail, respectively (Fig. 1). The predicted protein contains 1050 residues and has a calculated molecular weight of 115 kDa and pI of 5.69. The overall predicted amino acid sequence has high identity to HIF-1α from grass shrimp P. pugio (52%), crab C. magister (48%), the red flour beetle T. castaneum (48%), D. magna (44%), the bee A. mellifera (49%) and human H. sapiens (45%). The conserved bHLH domain in LvHIF-1α is from residues 34 to 90 and the regions from 122–175 and 240–330 form two PAS domains (Fig. 2A). In LvHIF-1α the conserved proline (Pro) that is hydroxylated is located in the N-terminal oxygen dependent degradation domain (N-ODD, residue 489) and C-terminal ODD (C-ODD, residue 660), while in the C-terminal transactivation domain (C-TAD) the asparagine (Asp, position 1036) is found in the hydroxylation motif in the LvHIF-1α sequence (Fig. 2A). The LvHIF-1α amino acid sequence is similar in length to HIF-1α from the

crustaceans P. pugio (1057 amino acids) and C. magister (1047), longer than most of the vertebrate (∼800 residues) homologs, and shorter than the Drosophila (1505) homolog. For HIF-1β, an initial partial fragment of 650 bp (Lvβ650) was obtained using degenerate primers. Lvβ650 corresponds to 204 amino acids. Specific primers were then designed to obtain the 5′ and 3′-ends. A sequence of 478 pb (Lvβ5′) was obtained using the CDS III/3′ primer with specific HIF-1β forward primers, and then four more fragments were obtained and sequenced (1622, 1700, 1664 and 1419 bp). The four overlapping sequences were assembled (named Lvβ3′). The full-length sequence of HIF-1β was obtained by overlapping the data from Lvβ650, Lvβ5′ and Lvβ3′ and named LvHIF1-β (FJ807919). The LvHIF1-β cDNA sequence is 2135 bp with start and stop codons at positions 76 and 1902, respectively (Fig. 3). The predicted protein for LvHIF1-β contains 608 residues and has a molecular weight of 69.4 kDa and pI of 6.75. LvHIF-1β has high overall identity to HIF-1β from several organisms (Fig. 2B) as T. castaneum (XP_970422) (65%), the water flea D. magna (59%), the fruit fly D. melanogaster (NP_731308) (56% and 55%, respectively), the louse Pediculus humanus corporis (EEB18222) (66%) and the wasp Nasonia vitripennis (XP_001605013) (57%). The LvHIF-1β has one bHLH (positions 9–66) and two PAS (positions 72–188 and 278–362) domains highly conserved (Fig. 2B). Both LvHIF-1 (α and β) proteins have the conserved residues in the bHLH/PAS domains and the main differences to HIF-1 s from other organisms are in their C-terminals (Fig. 2). 3.2. Phylogenetic analysis shows clearly distinct clades for vertebrate and invertebrate HIF-1 Deduced amino acid sequences from HIF-1 (α and β) were used in neighbor-joining analysis and resulted in trees with the same topology

400

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

Fig. 2. Domain structures of HIF-1 (α and β) from L. vannamei proteins. Sequence identities between homologous domains of HIF-1α (panel A) and HIF-1β (panel B) are shown. The amino acid positions for the different domains are indicated. For HIF-1 (α and β) include: bHLH, basic helix-loop-helix domain; PAS A/B, PerARNT-Sim A/B domain. For HIF-1α include: N-ODD, N-terminal oxygen dependent degradation domain; C-ODD, C-terminal oxygen dependent degradation domain; C-TAD, C-terminal transactivation domain.

and high bootstrap scores. HIF-1 (α and β) are grouped in the invertebrate (arthropod) clade and separated from vertebrates (Fig. 4). In the invertebrate clade, HIF-1α has 89% bootstrap support and is divided in two subclades: 1, insects (A. mellifera, T. castananeum and D. melanogaster) with 66% bootstrap support and 2, crustaceans (L. vannamei, P. pugio and C. magister) with 100% bootstrap support (Fig. 4A). For HIF-1β, the invertebrate clade has 100% bootstrap support and L. vannamei HIF-1β is grouped with insects (A. aegypti and D. melanogaster) with 79% bootstrap support (Fig. 4B).The vertebrate clade HIF-1 (α and β) has 99% and 100% bootstrap support and is separated in HIF-1 isoforms (α, 1/2/3/4 and β, 1/2/3/a/b/c), respectively (Fig. 4). 3.3. Transcript levels of HIF-1 α and β are tissue-specific and affected by hypoxia HIF-1α and HIF-1β transcripts were detected in tissues from shrimp subjected to normoxia and hypoxia (Fig. 5). Large differences in abundance of the transcripts were found in normoxia in the different tissues. In nomoxic conditions, HIF-1α transcripts were higher in gills than in hepatopancreas and muscle, while HIF-1β was higher in hepatopancreas compared to gills and muscle. A 35-fold decrease of HIF-1α in response to hypoxia (1.5 mg/L DO for 24 h) was detected in gills, while in muscle was 50-fold and in hepatopancreas this was 18-fold (Fig. 5A). In contrast HIF-1β decreased maximally 1.8-fold in gills, in muscle increased 4-fold and no changes were detected in hepatopancreas (Fig. 5B). HIF-1 (α and β) transcript in hepatopancreas did not statistically change under the different experimental conditions (Fig. 5).

A clear indication of anaerobic glycolysis with concomitant production of lactate during hypoxia, was detected, since lactate in plasma increased 3, 5.0 and 4.7-fold under hypoxia in 2.5 mg/L DO for 1 h,1.5 mg/L for 1 h and 1.5 mg/L for 24 h, respectively. Similarly, plasma glucose increased 2.17, 4.65 and 4.84-fold under the same conditions (Table 2). 4. Discussion We have identified and characterized the full-length cDNA sequences of the two HIF-1 subunits – LvHIF-1α and LvHIF-1β – from white shrimp. To our knowledge, the present study is the first to report the cloning and comparative analysis expression of HIF-1 subunits from shrimp species under hypoxia. The open reading frame (ORF) of LvHIF-1α is 3672 bp and codes for 1050 amino acid residues and is highly conserved with invertebrate and vertebrate homologs (Figs. 1 and 2). LvHIF-1α contains the typical domains of HIF-1α proteins including the basic helix-loop-helix (bHLH) and Per-ARNT-Sim (PAS)A and -B domains. Comparison of the LvHIF-1α bHLH domain (residues 34 to 90) with others HIF-1α in this region reveals high identity to P. pugio (84%), C. magister (75%), C. sapidus (74%) and H. sapiens (69%) as well as in the PAS domains (PAS A, 122–175 and PAS B, 240–330) to P. pugio (81% and 87%), C. magister (64% and 78%), C. sapidus (70% and 78%) and H. sapiens (55% and 60%) (Fig. 2A). The bHLH domain containing approximately 60 amino acids is involved in DNA binding and protein oligomerization. The bHLH domain includes a short component of mainly basic residues that bind to a consensus hexanucleotide “E-box” (CANNTG) (Voronova and Baltimore, 1990). The helix-loop-helix

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

401

Fig. 3. Nucleotide and predicted amino acid sequence of the L. vannamei HIF-1β cDNA. Primer sequences are shown in bold and underlined; the asterisk indicates the stop codon.

(HLH) forms two amphipathic alpha-helices separated by a variable length loop component for a highly hydrophobic oligomerization region of approximately 50 residues (Morgenstern and Atchley,1999). In general, the PAS domain is involved in target gene specificity, transactivation, and dimerization. The PAS domain is a region of 200–300 amino acids that contained two 50 residues conserved sequences (PAS A and PAS B) with hydrophobic regions. There are more than 300 conserved PAS domains known with little similarity in primary structures, but their secondary structures are conserved (Taylor and Zhulin, 1999). The HIF-1α protein contains the domains involved in nuclear translocation, transactivation

and posttranslational modifications, which control HIF protein stability and transcriptional activity. Degradation of HIF-1α under normoxic conditions is mediated by post-translational hydroxylation of conserved proline residues located in the oxygen dependent degradation domain (ODD). The ODD domain comprises residues 401–603 in human HIF-1α (Huang et al., 1998; Masson et al., 2001) and 692–863 in Drosophila Sima (LavistaLlanos et al., 2002; Nambu et al., 1996). In HIF-1α from invertebrates, the proline residues subjected to hydroxylation is in the N-terminal side of the ODD within the LXXLAP region, which is conserved in

402

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

Fig. 4. Tree derived phylogenetic analysis of HIF-1α (panel A) and HIF-1β (panel B) deduced amino acid sequences, including L. vannamei. Both trees were obtained using the neighborjoining method Jones–Taylor–Thornton matrix based. Numbers on the base of each node indicate the percentages of bootstrap support based on 1000 bootstrap resampling.

LvHIF-1α (residues 480–490) (Fig. 2A). A second Pro residue (661-Pro) in the C-terminal ODD is in residues 658 to 664 (MRAPFIP), while in Drosophila is in residues 847–853 (MRAPYIP) and in P. pugio in 634– 640 (MRAPFIP). Under hypoxic conditions HIF-1α is accumulated and translocated to the nucleus by a bipartite nuclear localization signal (NLS) in the C-terminal of the human protein (Luo and Shibuya, 2001). The bipartite NLS structure consists of two adjacent basic domains separated by a 10 amino acid spacer sequence. The predicted protein of LvHIF-1α, HIF1-α from P. pugio and C. magister, do not have the bipartite NLS in the C-terminal. A potential bipartite NLS in LvHIF-1α is located between residues 11 to 68 and similarly in P. pugio HIF-1α (Li and Brouwer, 2007) and C. magister that present two potential NLSs between residues 4 to 20 and 25 to 41. Similar bipartite NLS is found in the human HIF-1α in the N-terminal (residues 17 to 33) and mediates nuclear import of a GFPHIF1α/1-74 chimeric protein (Kallio et al., 1998). Modulation of HIF-1α transactivation domain is the second major control mechanism. In HIF-1α from vertebrates, the recruitment of transcriptional coactivators essential for gene expression is performed by two transactivation domains: N-TAD, the amino-terminal transactivation domain (residues 540 to 580 in mammals), and C-TAD, the carboxyl-terminal transactivation domain (residues 786 to 826 in mammals) (Bruick and McKnight, 2002; Jiang et al., 1997; Pugh et al., 1997). N-TAD from vertebrates is highly conserved and has the second proline hydroxylation motif in the C-ODD. This regulation is important for protein stability (Bruick and McKnight, 2002; Pugh et al., 1997). The LvHIF-1α appears to lack N-TAD, but as that of HIF-1α from P. pugio and C. magister the conserved proline hydroxylation motif still exists (Fig. 2A). The C-TAD domain interacts with the coactivator complex CBP/p300 only under hypoxia and can operate independently of ODD (Bruick, 2003; Kallio et al., 1998; Kung et al., 2000). Under normoxia a conserved Asn residue in C-TAD is hydroxylated to control its activity, in

HIF-1α from human the region is EVNAP (residues 801 to 805). The LvHIF1α has this Asn conserved in the region ELNAP (residues 1034 to 1038) (Fig. 2A). Interaction of C-TAD with the p300/CBP transcriptional coactivators is blocked by the hydroxylation of Asn, but activated with the abrogation of Asn hydroxylation under hypoxic conditions (Lando et al., 2002a,b). The LvHIF-1α protein has 224 amino acids (LvHIF-1α/224) more that the vertebrate HIF-1α, similar in length to HIF-1α from P. pugio and C. magister (230 and 221 amino acids, respectively). This LvHIF-1α/224 region only has identity to P. pugio (41%) and C. magister (44%), and no other known protein domains were found. At the nucleotide level, the LvHIF-1α/224 has identity to an EST (Expressed Sequence Tags) from L. vannamei, 98% (FE184967) reported by other authors and also to an EST from P. monodon, 93% (EE661933), but these two sequences are not identified as HIF-1α. These crustaceans HIF-1α C-terminal extensions have 20–24% hydroxyl- or sulfur-containing amino acids, 11–13% basic amino acids, 40–43% aliphatic amino acid and b5% others. In general, the crustacean HIF-1α C-terminal extensions have high content of hydrophobic amino acids. The transactivation domain has a relatively high proportion of hydrophobic amino acids (N40%) (Betney and McEwan, 2003), therefore the C-terminal extension in HIF-1α from crustaceans probably has the same function. For HIF-1β a sequence of 2135 bp -LvHIF-1β- coding for 608 amino acid residues was obtained (Fig. 2B). LvHIF-1β has the bHLH (9–66)/PAS (PAS A, 72–188 and PAS, B 278–362) domains with high identity to other bHLH/PAS regions of HIF-1β as: bHLH domain, 98% with D. magna, T. castaneum, D. melanogaster, A. aegypti, and 96% with H. sapiens; PAS (PAS A, 72–188 and PAS, B 278–362) domains, T. castaneum (86% and 83%, respectively), D. magna (84% and 80%, respectively), D. melanogaster (80% and 75%, respectively), A. aegypti (80% and 74%, respectively) and H. sapiens (78% and 67%, respectively) (Fig. 2B). For HIF-1α and HIF-1β, the bHLH/PAS domains are important for interaction with the DNA, and

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

Fig. 5. HIF-1α (panel A) and HIF-1β (panel B) transcript levels in different tissues of the white shrimp L. vannamei under normoxia and hypoxia conditions. mRNA relative levels were calculated by quantitative real-time RT-PCR and compared to ribosomal protein L8. N: normoxia; 2.5×1 h: 2.5 mg/L DO for 1 h; 1.5×1 h: 1.5 mg/L DO for 1 h; 1.5×24 h: 1.5 mg/L DO for 24. One-way ANOVA was used to compare experimental treatments for tissues. Values with the same letter are not significantly different (Pb 0.05).

the bHLH domain is involved in DNA/protein interaction, while the PAS domain gives the target gene specificity, transactivation, and dimerization (Semenza, 2001a,b). Gills, hepatopancreas and muscle play key roles in metabolic functions. Gills are involved in respiration, osmoregulation and detoxification, while muscle is involved mainly in locomotion and glyconeogenesis. Hepatopancreas is a multifunctional organ that participate in excretion, molting, lipid and carbohydrate metabolism, synthesis and secretion of digestive enzymes, absorption from nutrients, synthesis of hemocyanin and lipoproteins (Yepiz-Plascencia et al, 2000), and storage of energy reserves (Gibson and Barker, 1979). Significant differences in abundance of HIF-1 (α and β) transcripts were detected under normoxia and hypoxia in all tissues analyzed (Fig. 5). HIF-1α transcripts were higher than HIF-1β in gills and muscle under normoxia and hypoxia. HIF-1α transcripts were significantly reduced in gills and muscle under the hypoxia conditions tested; interestingly, this reduction appears to be time dependent (Fig. 5A). In contrast, HIF-1α expression in hepatopancreas from the grass shrimp P. pugio is constitutively expressed and did not change under moderate (2.5 mg/L DO) and severe (1.5 mg/L DO) hypoxia conditions for 3, 7 and 14 days of exposure (Li and Brouwer, 2007). However, in P. pugio, HIF-1α expression was only measured in hepatopancreas. HIF-1β transcripts significantly decreased in gills in 2.5 mg/L DO for 1 h and 1.5 mg/L DO for 24 h, but not in 1.5 mg/L DO for 1 h. In contrast, HIF-1β transcripts significantly increased in muscle under

403

1.5 mg/L DO for 24 h compared to normoxia and 2.5 mg/L DO or 1.5 mg/L DO for 1 h (Fig. 5B). In D. magna HIF-1β expression was detected during middle to late stages of embryonic development in the central nerve system, anus, dorsal organ, maxillary gland and carapace, while in adults, the expression was limited to the epipodites of thoracic limbs (Tokishita et al., 2006). HIF-1 (α and β) transcripts was not significantly different under normoxia and hypoxia in hepatopancreas. In mammals, HIF-1α, HIF-2α, HIF-3α and HIF-1β transcripts are constitutively expressed in normoxia and the amounts are tissue-specific. For example, HIF-1α, HIF-2α, HIF-3α and HI-1β expression in rats was higher in brain and lung compared to heart, liver and kidney, implicating an organ-specific priority. However, HIF-3α expression levels increased in lung under moderate hypoxia (2– 3 mg/L DO for 0.5 h and 2 h) compared to HIF-1α, HIF-2α and HIF-1β that did not change (Heidbreder et al., 2003). HIF-1α and HIF-4α expression in grass carp exposed to normoxia and hypoxia (0.5 mg/L DO for 4 h and 96 h) was constitutively and also tissue-specific (Law et al., 2006). Heidbreder et al. (2003) proposed that HIF-1α isoforms may contribute to protection during early intervals and/or moderate hypoxia or against severe and/or prolonged hypoxia. Normally, regulation of HIF-1 occurs at the post-transcriptional level where degradation of the HIF-1α protein occurs in normoxia, however the α and β subunits of the HIF-1 genes are constitutively transcribed and translated independently of oxygen tension. We have not characterized isoforms of HIF-1α or HIF-1β in L. vannamei, but our data show important significant differences between the transcript levels of α and β, probably indicating an alternative manner of regulation in these animals. It appears that a mechanism of feedback regulation may occur in gills and muscle in which the sustained elevation of HIF-1α protein under hypoxia signals for a decrease in its corresponding mRNA. Glucose and lactate concentration in plasma were 2.17 and 3-fold higher (P b 0.05) in shrimp exposed to 2.5 mg/L DO for 1 h compared to control, while for 1.5 mg/L DO for 1 h and 24 h an increment of 4.7 and 5.0-fold, respectively, was detected (Table 2). The increase in glucose and lactate in plasma indicates the switch to anaerobic glycolysis. In crustaceans, plasma lactate accumulations represent a typical response to hypoxia and a direct measurement of anaerobic metabolism (Albert and Ellington, 1985; Anderson et al., 1994; Bridges and Brand, 1980; Gäde,1984; Hagerman et al.,1990; Racotta et al., 2002; Taylor and Spicer, 1987; Zou et al., 1996). Glucose increase in shrimp has also been reported in other studies of shrimp and crustaceans under hypoxia indicating mobilization of glucose from glycogen stores in tissues to hemolymph to satisfy the substrate demand for anaerobic glycolysis (Racotta et al., 2002; Taylor and Spicer, 1987; Zou et al., 1996). In conclusion, to get insights on the molecular mechanisms involved in the response of marine crustaceans to low dissolved oxygen concentrations; we have obtained the full-length coding sequences of HIF-1α and HIF-1β from the white shrimp L. vannamei. HIF-1α and HIF-1β predicted proteins have the bHLH, PAS A and PAS B domains. HIF-1α also has the two prolines and one asparagine hydroxylation motifs presents in the ODD and C-TAD domains, respectively, important for regulation in response to hypoxia. Moreover, HIF-1α and HIF-1β expression is tissue-temporal-specific in normoxia and short-term hypoxia conditions. The effect of long-term hypoxia in HIF-1 transcripts levels and in natural conditions remains to be investigated. The presence of the highly conserved domains in the

Table 2 Glucose and lactate concentrations in plasma from L. vannamei exposed to different concentrations of dissolved oxygen. Treatments

Glucose [mmol/L]

Lactate [mmol/L]

Normoxia 2.5 mg/L DO × 1 h 1.5 mg/L DO × 1 h 1.5 mg/L DO × 24 h

0.892 ± 0.102a 1.94 ± 0.815b 4.154 ± 2.434c 4.323 ± 1.093c

1.203 ± 0.359a 3.659 ± 1.617b 6.025 ± 2.291b 5.695 ± 1.137b

Values with the same superscript are not significantly different. P b 0.05.

404

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405

HIF-1 subunits and the tissue-specific expression in shrimp exposed to normoxia and hypoxia, suggest functions and molecular mechanisms similar to HIF-1 from other organisms. Moreover, the HIF-1α protein sequence has an extension as HIF-1α from other crustaceans (P. pugio and C. magister) that may indicate additional features involved in adaptation to periodical fluctuations of oxygen that are normally faced by these animals. The effects of hypoxia on the HIF-1 proteins remain to be investigated. Acknowledgments We are grateful to Consejo Nacional de Ciencia y Tecnología (CONACYT, Mexico) for financial support, grants 45964 and 98507 and UC-MEXUS-CONACYT for a grant to GYP and HJF. JGSO was a recipient of a fellowship from CONACYT for graduate studies. References Albert, J.L., Ellington, W.R., 1985. Patterns of energy metabolism in the stone crab, Menippe mercenaria, during severe hypoxia and subsequent recovery. J. Exp. Zool. 234, 175–185. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Anderson, S.J., Taylor, A.C., Atkinson, R.J., 1994. Anaerobic metabolism during anoxia in the burrowing shrimp Calocaris macandreae Bell (Crustacea: Thalassinidea). Comp. Biochem. Physiol. A 108, 515–522. Anonymous. Panorama Acuicola Magazine, 2008. http://www.panoramaacuicola.com/, Sept–Oct. Betney, R., McEwan, I.J., 2003. Role of conserved hydrophobic amino acids in androgen receptor AF-1 function. J. Mol. Endocrinol. 31, 427–439. Boutilier, R., 2001. Mechanisms of cell survival in hypoxia and hypothermia. J. Exp. Biol. 204, 3171–3181. Bridges, C.R., Brand, A.R., 1980. The effect of hypoxia on oxygen consumption and blood lactate levels of some marine crustaceans. Comp. Biochem. Physiol. A 65, 399–409. Bruick, R.K., 2003. Oxygen sensing in the hypoxic response pathway: regulation of the hypoxia-inducible transcription factor. Genes Dev. 17, 2614–2623. Bruick, R.K., McKnight, S.L., 2001. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294, 1337–1340. Bruick, R.K., McKnight, S.L., 2002. Transcription. Oxygen sensing gets a second wind. Science 295, 807–808. Epstein, A.C., Gleadle, J.M., McNeill, L.A., Hewitson, K.S., O'Rourke, J., Mole, D.R., Mukherji, M., Metzen, E., Wilson, M.I., Dhanda, A., Tian, Y.M., Masson, N., Hamilton, D.L., Jaakkola, P., Barstead, R., Hodgkin, J., Maxwell, P.H., Pugh, C.W., Schofield, C.J., Ratcliffe, P.J., 2001. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107, 43–54. Gäde, G., 1984. Effects of oxygen deprivation during anoxia and muscular work on the energy metabolism of the crayfish, Orconectes limosus. Comp. Biochem. Physiol. A 77, 495–502. Gibson, R., Barker, P.L., 1979. The decapod hepatopancreas. Oceanogr. Mar. Biol. 17, 285–346. Gómez-Anduro, G.A., Sotelo-Mundo, R.R., Yepiz-Plascencia, G., 2006. The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: molecular cloning and expression. Dev. Comp. Immunol. 30, 893–900. Hagerman, L., Sondergaard, T., Weile, K., Hosie, D., Uglow, R.F., 1990. Aspects of blood physiology and ammonia excretion in Nephrops norvegicus under hypoxia. Comp. Biochem. Physiol. A 97, 51–55. Harris, A.L., 2002. Hypoxia a key regulatory factor in tumor growth. Nat. Rev., Cancer. 2, 38–47. Hedlund, S., 2007. Vannamei production to increase again this year: expect prices of Pacific whites to hold firm or drop. Seafood Bus. http://www.seafoodbusiness.com/. Heidbreder, M., Fröhlich, F., Jöhren, O., Dendorfer, A., Qadri, F., Dominiak, P., 2003. Hypoxia rapidly activates HIF-3α mRNA expression. FASEB J. 17, 1541–1543. Herreid, C.F., 1980. Hypoxia in invertebrates. Comp. Biochem. Physiol. A 67, 311–320. Hochachka, P.W., 1988. Metabolic suppression and oxygen availability. Can. J. Zool. 66, 152–158. Hochachka, P., Rupert, J., Monge, C., 1999. Adaptation and conservation of physiological systems in the evolution of human hypoxia tolerance. Comp. Biochem. Physiol. A 124, 1–17. Huang, L.E., Gu, J., Schau, M., Bunn, H.F., 1998. Regulation of hypoxia-inducible factor 1α is mediated by an O2-dependent degradation domain via the ubiquitin–proteasome pathway. Proc. Natl. Acad. Sci. U. S. A. 95, 7987–7992. Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A., Asara, J.M., Lane, W.S., Kaelin, W.G., 2001. HIF-1α targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 292, 464–468. Jaakkola, P., Mole, D.R., Tian, Y.M., Wilson, M.I., Gielbert, J., Gaskell, S.J., von Kriegsheim, A., Hebestreit, H.F., Mukherji, M., Schofield, C.J., 2001. Targeting of HIF-1α to the von Hippel–Lindau ubiquitylation complex by O2 regulated prolyl hydroxylation. Science 292, 468–472. Jiang, B.H., Zheng, J.Z., Leung, S.W., Roe, R., Semenza, G.L., 1997. Transactivation and inhibitory domains of hypoxia-inducible factor 1α. Modulation of transcriptional activity by oxygen tension. J. Biol. Chem. 272, 19253–19260.

Kallio, P.J., Okamoto, K., O'Brien, S., Carrero, P., Makino, Y., Tanaka, H., Poellinger, L.,1998. Signal transduction in hypoxic cells: inducible nuclear translocation and recruitment of the CBP/p300 coactivator by the hypoxia-inducible factor-1α. EMBO J. 17, 6573–6586. Kung, A.L., Wang, S., Klco, J.M., Kaelin, W.G., Livingston, D.M., 2000. Suppression of tumor growth through disruption of hypoxia-inducible transcription. Nat. Med. 6, 1335–1340. Lando, D., Peet, D.J., Gorman, J.J., Whelan, D.A., Whitelaw, M.L., Bruick, R.K., 2002a. FIH-1 is an asparaginyl hydroxylase enzyme that regulates the transcriptional activity of hypoxia-inducible factor. Genes Dev. 16, 1466–1471. Lando, D., Peet, D.J., Pongratz, I., Whitelaw, M.L., 2002b. Mammalian two-hybrid assay showing redox control of HIF-like factor. Methods Enzymol. 353, 3–10. Lavista-Llanos, S., Centanin, L., Irisarri, M., Russo, D.M., Gleadle, J.M., Bocca, S.N., Muzzopappa, M., Ratcliffe, P.J., Wappner, P., 2002. Control of the hypoxic response in Drosophila melanogaster by the basic helix-loop-helix PAS protein similar. Mol. Cell. Biol. 22, 6842–6853. Law, S.H.W, Wu, R.S.S., Ng, P.K.S., Yu, R.M.K, Kong, R.Y.C., 2006. Cloning and expression analysis of two distinct HIF-α isoforms – gcHIF-1α and gcHIF-4α – from the hypoxiatolerant grass carp, Ctenopharyngodon idellus. BMC Mol. Biol. 7 (15), 1186–1471. Li, T., Brouwer, M., 2007. Hypoxia-inducible factor, gsHIF, of the grass shrimp Palaemonetes pugio: molecular characterization and response to hypoxia. Comp. Biochem. Physiol. B 147, 11–19. Lilliefors, H.W., 1967. On the Kolmogorov–Smirnov test for normality with mean and variance unknown. J. Am. Stat. Assoc. 62, 399–402. Loudon, C., 1988. Development of Tenebrio molitor in low oxygen levels. J. Insect Physiol. 34, 97–103. Luo, J.C., Shibuya, M., 2001. A variant of nuclear localization signal of bipartite-type is required for the nuclear translocation of hypoxia inducible factors (1α, 2α and 3α). Oncogene 20, 1435–1444. Martínez-Palacios, C.A., Ross, L.G., Jiménez-Valenzuela, L., 1996. The effects of temperature and body weight on the oxygen consumption of Penaeus vannamei, Boone, 1931. J. Aquac. Trop. 11, 59–65. Masson, N., Willam, C., Maxwell, P.H., Pugh, C.W., Ratcliffe, P.J., 2001. Independent function of two destruction domains in hypoxia-inducible factor-α chains activated by prolyl hydroxylation. EMBO J. 20, 5197–5206. McGaw, I.J., Airriess, C.N., McMahon, B.R., 1994. Patterns of haemolymph flow variation in decapod crustaceans. Mar. Biol. 121, 53–60. Morgenstern, B., Atchley, W.R., 1999. Evolution of bHLH transcription factors: modular evolution by domain shuffling? Mol. Biol. Evol. 16, 1654–1663. Nambu, J.R., Lewis, J.O., Wharton, K.A.J., Crews, S.T., 1991. The Drosophila single-minded gene encodes a helix-loop-helix protein that acts as a master regulator of CNS midline development. Cell 67, 1157–1167. Nambu, J.R., Chen, W., Hu, S., Crews, S.T., 1996. The Drosophila melanogaster similar bHLH-PAS gene encodes a protein related to human hypoxia-inducible factor 1α and Drosophila single-minded. Gene 172, 249–254. Ocampo, L., Villarreal, H., Vargas, M., Portillo, G., Magallon, F., 2000. Effects of dissolved oxygen and temperature on growth, survival and body composition of juvenile Farfantepenaeus californiensis (Holmes). Aquacult. Res. 31, 167–171. Pugh, C.W., O'Rourke, J.F., Nagao, M., Gleadle, J.M., Ratcliffe, P.J., 1997. Activation of hypoxia-inducible factor-1; definition of regulatory domains within the α subunit. J. Biol. Chem. 272, 11205–11214. Racotta, I.S., Palacios, E., Méndez, L., 2002. Metabolic responses to short and long-term exposure to hypoxia in white shrimp (Penaeus vannamei). Mar. Freshw. Behav. Physiol. 35, 269–275. Reiber, C.L., 1995. Physiological adaptations of crayfish to the hypoxic environment. Am. Zool. 35, 1–11. Reiber, C.L., McMahon, B.R., 1998. Progressive hypoxia's effects on the crustacean cardiovascular system: a comparison of the freshwater crayfish (Procambarus clarkii) and the lobster (Homarus americanus). J. Comp. Physiol. B 168, 168–176. Rosas, C., Martinez, E., Gaxiola, G., Brito, R., Díaz-Iglesia, E., Soto, L.A., 1998. Effect of dissolved oxygen on the energy balance and survival of Penaeus setiferus juveniles. Mar. Ecol. Prog. Ser. 174, 67–75. Rosas, C., Martinez, E., Gaxiola, G., Brito, R., Sánchez, A., Soto, L.A., 1999. The effect of dissolved oxygen and salinity on oxygen consumption, ammonia excretion and osmotic pressure of Penaeus setiferus (Linnaeus) juveniles. J. Exp. Mar. Biol. Ecol. 234, 41–57. Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Seidman, E.R., Lawrence, A.L., 1985. Growth, feed digestibility, and proximate body composition of juvenile Penaeus vannamei and P. monodon grown at different dissolved oxygen levels. J. World Maric. Soc. 16, 333–346. Semenza, G.L., 2001a. HIF-1 and mechanisms of hypoxia sensing. Curr. Opin. Cell Biol. 13, 167–171. Semenza, G.L., 2001b. HIF-1, O(2), and the 3 PHDs: how animal cells signal hypoxia to the nucleus. Cell 107, 1–3. Semenza, G.L., 2001c. Hypoxia-inducible factor 1: control of oxygen homeostasis in health and disease. Pediatr. Res. 49, 614–617. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Taylor, A.C., Spicer, J.I., 1987. Metabolic responses of the prawns Palaemon elegans and Palaemon serratus (Crustacea: Decapoda) to acute hypoxia and anoxia. Mar. Biol. 95, 521–530. Taylor, B.L., Zhulin, I.B., 1999. PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63, 479–506. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionsspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.

J.G. Soñanez-Organis et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 395–405 Tokishita, S., Kimura, S., Mandokoro, Y., Kato, K., Shiga, Y., Takahashi, Y., Ohta, Y., Yamagata, H., 2006. Tissue-specific expression of a bHLH-PAS protein homologous to ARNT during the development of crustacean Daphnia magna. Gene 376, 231–239. Trenin, M., Shliar, J., Juang, H., Powell-Coffman, J.A., Bromberg, Z., Horowitz, M., 2003. HIF-1 is required for heat acclimation in the nematode Caenorhabditis elegans. Physiol. Genomics 14, 17–24. Voronova, A., Baltimore, D., 1990. Mutations that disrupt DNA binding and dimer formation in the E47 helix-loop-helix protein map to distinct domains. Proc. Natl. Acad. Sci. U. S. A. 87, 4722–4726. Wang, G.L., Jiang, B.H., Rue, E.A., Semenza, G.L., 1995. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. U. S. A. 92, 5510–5514. Webster, K.A., Discher, D., Bishopric, N.H., 1993. Induction and nuclear accumulation of fos and jun proto-oncogenes in hypoxia cardiac myocytes. J. Biol. Chem. 268, 16852–16859. Webster, K.A., Discher, D.J., Bishopric, N.H., 1994. Regulation of fos and jun immediateearly genes by redox or metabolic stress in cardiac myocytes. Circ. Res. 75, 361–371.

405

Webster, K.A., Discher, D.J., Kaiser, S., Hernandez, O.M., Sato, B., Bishopric, N.H., 1999. Hypoxia-activated apoptosis of cardiac myocytes requires reoxygenation or a pH shift and is independent of p53. J. Clin. Invest. 104, 239–252. Wilkens, J.L., 1999. Evolution of the cardiovascular system in crustacea. Am. Zool. 39, 199–214. Yepiz-Plascencia, G., Gollas-Galván, T., Vargas-Albores, F., García-Bañuelos, M., 2000. Synthesis of hemolymph high-density lipoprotein β-glucan binding protein by Penaeus vannamei shrimp hepatopancreas. Mar. Biotechnol. 2, 485–492. Yu, F., White, S.B., Zhao, Q., Lee, F.S., 2001. HIF-1α binding to VHL is regulated by stimulus sensitive proline hydroxylation. Proc. Natl. Acad. Sci. U. S. A. 98, 9630–9635. Zenteno-Savín, T., Saldierna, R., Ahuejote-Sandoval, M., 2006. Superoxide radical production in response to environmental hypoxia in cultured shrimp. Comp. Biochem. Physiol. C 142, 301–308. Zou, E.M., Du, N., Lai, W., 1996. The effects of severe hypoxia on lactate and glucose concentrations in the blood of the Chinese freshwater crab Eriocheir sinensis (Crustacea: Decapoda). Comp. Biochem. Physiol. A 114, 105–109.