NF-κ B activates fibronectin gene expression in rat hepatocytes

NF-κ B activates fibronectin gene expression in rat hepatocytes

BBRC Biochemical and Biophysical Research Communications 297 (2002) 1218–1224 www.academicpress.com NF-jB activates fibronectin gene expression in rat...

321KB Sizes 2 Downloads 22 Views

BBRC Biochemical and Biophysical Research Communications 297 (2002) 1218–1224 www.academicpress.com

NF-jB activates fibronectin gene expression in rat hepatocytes Byung-Heon Lee,a Seung-Yoon Park,a Kae-Bok Kang,a Rang-Woon Park,b and In-San Kimb,* b

a Department of Biochemistry, School of Medicine, Dongguk University, Kyungju 780-714, Republic of Korea Department of Biochemistry, Cell and Matrix Biology, National Research Laboratory, School of Medicine, Kyungpook National University, Taegu 700-422, Republic of Korea

Received 11 September 2002

Abstract Fibronectin (FN) plays a role in various biological processes such as fibrosis and tumor metastasis. In this study, we investigated the regulation of FN gene expression by NF-jB transcription factor. Transient expression of NF-jB p65 increased FN promoter activity in rat hepatocytes. Deletion analysis of FN promoter localized the NF-jB-responsive region at the position between )1214 and )1126. Mutations in a putative NF-jB element (50 -GAGAATTTCC-30 ) at )1180 blocked most of the p65-induced promoter activity. Electromobility shift assays showed that the expression of p65 induced the binding of the p65/p65 homodimer to the NF-jB site at )1180. Stably p65-expressing cells showed increase of promoter activity, FN protein, and its mRNA levels over control cells. Furthermore, treatment of cells with interleukin-1b, a NF-jB-stimulating cytokine, also increased promoter activity, FN production, and mRNA levels. These results show that NF-jB activates FN gene expression by binding to the responsive element at )1180 as the p65/p65 homodimer in rat hepatocytes. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Fibronectin; Hepatocyte; NF-jB

Fibronectin (FN) is a large glycoprotein with a molecular weight of 220–240 kDa and exists as a soluble dimer in body fluids (plasma FN) or as an insoluble fibrillar form in the extracellular matrix (ECM) (cellular FN). FN is synthesized by diverse cell types such as fibroblasts, endothelial cells, and hepatocytes [1]. In particular, hepatocytes synthesize and secrete plasma FN and are the major source of this protein in vivo [2]. FN plays a critical role in cell adhesion and migration, wound healing, fibrosis, and tumor metastasis [1]. In addition, adhesion of cells to FN and subsequent integrin signaling is important for cell survival and cell cycle progression [3,4]. Modulating the expression of FN at the level of transcription would be an important regulatory step in these biological processes. Regulatory elements and transcription factors involved in the control of FN expression have been described. For example, cAMP-responsive element (CRE) was shown to mediate *

Corresponding author. Fax: +82-53-422-1466. E-mail address: [email protected] (I.-S. Kim).

FN gene expression in response to cAMP, serum, and human papilloma virus in several cell types [5–7]. G10BP, a negative regulator of Sp1, was shown to mediate the adenovirus E1A-induced repression of the FN gene by binding to Sp1 sites in fibroblasts [8]. EGR-1 transcription factor was shown to induce the expression of the FN gene in fibrosarcoma and glioblastoma cells [9,10]. The NF-jB family of transcription factors consists of homo- or hetero-dimeric subunits of the Rel family including p65 (or RelA), p50, p52, c-Rel, and Rel-B [11]. NF-jB is activated by a variety of cytokines and mitogens and is a key regulator of many genes involved in immune and inflammatory responses [11,12]. The target genes include cytokines such as interleukin (IL)-2 and IL-8 and inflammatory adhesion molecules such as Eselectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) [11,12]. In unstimulated cells, most of the NF-jB is localized in the cytoplasm in complex with an inhibitory protein IjB. Upon stimulation by agents such as tumor

0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 2 3 5 6 - 2

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

necrosis factor-a (TNF-a) or IL-1b, IjB becomes phosphorylated, ubiquitinated, and subsequently degraded by the proteosome machinery [12]. This allows NF-jB to translocate to the nucleus, bind DNA, and activate transcription of specific genes. In a previous study [13], we have suggested that the NF-jB transcription factor may regulate FN gene expression in both activating and inhibitory ways. We demonstrated that the binding of NF-jB p65/p50 to the regulatory element at )41 in the FN gene played an inhibitory role during the activation of the FN gene by phorbol myristate acetate, while the expression of NFjB p65 itself activated FN gene. Here we identified the NF-jB p65-responsive regulatory element in the FN gene and the component of proteins binding to the element.

Materials and methods Cell cultures. A BRL 3A rat hepatocyte cell line (ATCC CRL 1442) was obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were cultured in DulbeccoÕs modified EagleÕs medium supplemented with 5% fetal bovine serum (Life Technologies, Gaithersburg, MD, USA) at 37 °C in a 5% CO2 air environment. Plasmid constructs. Construction of pGL2F1900 containing the rat FN gene between positions )1908 and +136 fused to the luciferase reporter gene was described previously [13]. Deletion constructs pGL2F1255 and pGL2F1214 were constructed by PCR techniques using pGL2F1900 as a template and the enzyme site-inserted primers. To construct pGL2F1126 and pGL2F1002, pGL2F1900 was digested with MfeI at )1127 or BlnI at )1003 followed by blunting of the ends and then digested with HindIII. The resulting fragment was ligated into the SmaI and HindIII site of pGL2-basic. To construct pGL2F882, pF882CAT (provided by Dr. Kinichiro Oda) was digested with BglII and HindIII and the resulting fragment was ligated into pGL2-basic. To prepare pGL2F1900mjB-1180 containing mutations in a NF-jB element at )1180, a site-directed mutagenesis using a twostep PCR method was performed using )1192/)1160mjB oligonucleotide (see below) as primers. pCMV-p65 expression vector was provided by Dr. P.A. Baeuerle (Tularik, South San Francisco, CA) and previously described [14]. pCMV-IjBa expression vector was previously described [15]. pSV-bgalactosidase expression vector and pGL2-basic luciferase vector were from Promega (Madison, WI, USA). pNFjB-luc reporter vector containing four tandem copies of the consensus NF-jB sequence (50 GGGGATTCCC-30 ) from the major histocompatibility I gene fused to the luciferase reporter gene was from Clontech (Palo Alto, CA, USA). Transfection and luciferase assays. Transient transfection of plasmids using liposome method and assays for the activity of luciferase and bgalactosidase were performed as described previously [13]. Briefly, cells (2  105 cells per dish) were plated the day before transfection onto 35mm culture dishes and grown to an approximate 70% confluence. After 6 h of transfection, cells were incubated overnight with the medium containing 5% serum for recovery and then incubated for 24 h in the medium containing 0.5% serum. Luciferase activities were normalized for the transfection efficiency by b-galactosidase activities. For the construction of stably p65-expressing transfectants, cells were transiently transfected with pCMV-p65 expression vector. Transfected clones were selected by subculture in a culture medium containing 400 lg/ml G418 (Life Technologies). After a selection for 2 weeks, multiple cell clones were isolated and then pooled as described previously [16].

1219

Electromobility shift assay (EMSA). The preparation of nuclear extracts and EMSA were performed as described previously [13]. Antibodies specific for the p65, p50, and c-Rel subunit of NF-jB were from Santa Cruz Biotechnology, (Santa Cruz Biotechnology, CA, USA). The sequences of the oligonucleotides used in this study are as follows (underlining indicates a target NF-jB site and lowercase italicized letters indicate the introduced mutations): ) 1192/)1160 ) 1192/)1160mjB

50 -GTAGAAAGTCCGGAGAATTT CCGGAGACTTTTTCAGGCCTCT TAAAGGCCTCTGAAAAG-50 50 -GTAGAAAGTCCGtttGAATTTC aGGAGACTTCTTTCAGGCaaaCT TAAAGtCCTCTGAAAAG-50

Western blot analysis. Cell lysates were prepared in a lysis buffer (10 mM Tris–HCl, pH 7.4, 0.15 M NaCl, 1% Nonidet P-40, 1% sodium deoxycholate, 0.5% SDS, 1 mM phenylmethylsulfonyl fluoride, and 1 mM ethylenediaminetetraacetic acid). For p65 analysis, cytoplasmic and nuclear extracts were prepared as previously described [13]. Immunoblotting was performed with goat anti-human NF-jB p65 antibody (Santa Cruz Biotechnology) or goat anti-human FN antibody (Sigma Chemical). The membrane was developed using chemiluminescence ECL detecting reagent (Amersham Pharmacia Biotech, Uppsala, Sweden). Northern blot analysis. Isolation of total cellular RNA and subsequent hybridization with a radiolabeled cDNA probe were performed as described previously [17]. FH1 human FN cDNA and 18 S ribosomal RNA cDNA were used as hybridization probes.

Results NF-jB activates FN promoter in rat hepatocytes Expression of p65 subunit of NF-jB dose-dependently increased the activity of a FN promoter construct pGL2F1900 in BRL 3A rat hepatocytes (Figs. 1A and B). p65 also increased the activity a NF-jB reporter construct pNF-jB-luc, indicating that the expressed p65 is functionally active in the cells (Fig. 1A). To further investigate the activation of FN promoter by p65, we used a mutant IjBa that is known to act as a constitutive repressor of NF-jB [15]. Coexpression of the mutant IjBa with p65 eliminated the p65-induced promoter activity (Fig. 1B).

Fig. 1. NF-jB activates FN promoter in rat hepatocytes. (A) BRL 3A rat hepatocytes were transfected with pGL2F1900 or pNF-jB-luc reporter together with 50 ng of either pCMV-p65 or pCMV vector. (B) Cells were transfected with pGL2F1900 together with 25, 50, 100 ng of pCMV-p65 in the presence or absence of 50 ng IjBa. Data represent luciferase activities relative to the control as means  SD of three separate experiments.

1220

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

A

B

Fig. 2. Region between )1214 and )1126 of the FN promoter is responsible for the p65-induced transcriptional activation. (A) Diagram of the 50 serial deletion constructs. Numbers in parenthesis represent the basal activity of each construct relative to that of the wild-type construct. (B) Cells were transfected with each deletion construct together with either pCMV-p65 or pCMV vector. Data represent luciferase activities relative to the control value of each construct as means  SD of three different experiments.

Region between )1214 and )1126 of FN promoter is responsible for the p65-induced transcriptional activation To determine where the p65-responsive region of FN promoter is located, 50 -serial deletion constructs were

prepared (Fig. 2A). Deletion of the region between )1900 and )1126 of FN promoter decreased the basal promoter activity to 22% of the wild-type promoter (Fig. 2A). Further deletion of the region between )1126 and )882 slightly recovered the basal promoter activity

Fig. 3. A NF-jB binding site at )1180 of the FN promoter is the p65-responsive regulatory element. (A) The nucleotide sequence between )1214 and )1126 and potential transcriptional regulatory sites. Italicized lowercase letters indicate the introduced mutations at the putative NF-jB element at )1180. (B) Mutations in the NF-jB element at )1180 block the p65 activation of the FN promoter. Cells were transfected with either wild-type or mutant (mjB-1180) pGL2F1900 together with pCMV-p65. Data represent luciferase activities relative to the control of the wild-type construct as means  SD of three separate experiments. (C) The NF-jB element at )1180 is a functional binding site for nuclear proteins. Nuclear extracts from the cells that transiently express p65 were incubated for binding with )1192/)1160 oligonucleotide or with either the indicated oligonucleotide as a competitor (lanes 3–5) or the indicated antibody (1 ll) before the binding reaction (lanes 6–8).

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

to 45% of wild-type promoter (Fig. 2A), which is similar with the results previously described [8]. Next, we examined the promoter activities of the deletion constructs in response to p65. As shown in Fig. 2B, deletion of the region between )1900 and )1214 did not significantly affect the p65 responsiveness of the promoter, whereas further deletion of the region between )1214 and )1126 eliminated the induction of the promoter activity by p65. These results show that the region between )1214 and )1126 of the FN promoter is necessary for both basal promoter activity and the p65-induced transcriptional activation. A NF-jB binding site at )1180 of FN promoter is the p65responsive regulatory element Sequence analysis of the region between )1214 and )1126 in FN promoter showed a putative NF-jB element (50 -GAGAATTTCC-30 ) at the position of )1180 as well as an Sp1 site and a CAAT box at positions )1212 and )1205, respectively (Fig. 3A). To examine whether the

1221

putative NF-jB site at )1180 is important in the p65-induced transcriptional activation, mutations in the site were introduced. Mutations in the NF-jB site (50 -GAGAATTTCC-30 to 50 -tttAATTTCa-30 ) blocked approximately 70% of the p65-induced FN promoter activity, whereas they did not affect the basal promoter activity (Fig. 3B). To study whether the NF-jB site at )1180 is a functional binding site for nuclear proteins, EMSA was performed using nuclear extracts from cells that transiently express NF-jB p65 subunit. Expression of p65 induced the formation of a DNA–protein complex binding to a )1192/)1160 oligonucleotide flanking the putative NF-jB site at )1180 of FN promoter (Fig. 3C). The binding activity was competed by the consensus NF-jB oligonucleotide but not by a )1192/)1160mjB oligonucleotide containing mutations in the )1180 NF-jB element (Fig. 3C, lanes 3–5). An antibody to p65 subunit inhibited the formation of the DNA–protein complex, while antibodies to either p50 or the c-Rel subunit of NFjB did not (Fig. 3C, lanes 6–8). There was no protein binding to the mutant )1192/)1160mjB oligonucleotide

Fig. 4. Stably p65-expressing cells show increased FN production, promoter activity, and mRNA levels. (A) Culture medium and cytoplasmic lysates were prepared from p65-expressing cells or control cells and then subjected to Western blot. For p65 Western blot, nuclear and cytoplasmic extracts were prepared from the cells. (B) Cells were transfected with either pGL2F1900 or pNF-jB-luc reporter. Data represent luciferase activities from p65-expressing cells relative to control cells as means  SD of three separate experiments. (C) Total RNA was isolated from p65-expressing cells and subjected to Northern blot analysis. The 18 S ribosomal RNA (18S) was shown as a control for the equal RNA loading.

1222

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

(data not shown). These results indicate that the NF-jB site at )1180 is an essential element for the p65-induced activation of FN promoter and a functional binding site for the NF-jB p65 homodimer. Stably p65-expressing cells show increased FN production, promoter activity, and mRNA levels To further investigate the regulation of FN expression by NF-jB, we established BRL 3A cells stably expressing NF-jB p65. The stably p65-expressing cells showed increased levels of p65 protein in both the

nucleus and the cytoplasm (Fig. 4A, lower panel). Since most of the FN synthesized in cells is secreted, we determined FN levels in both the culture medium and the cell lysates. As shown in Fig. 4A (upper panel), p65-expressing cells showed increased levels of FN protein in both the culture medium and the cell lysates over control cells. The p65-expressing cells also showed increased activities of FN promoter and NF-jB reporter (Fig. 4B) and FN mRNA levels over control cells (Fig. 4C). IL-1b treatment increases FN expression in rat hepatocytes To examine the ability of endogenous NF-jB pathway to activate FN expression, BRL 3A cells were incubated with IL-1b, an agent known to stimulate intracellular NFjB activity [11,12]. Treatment of cells with 2.5 ng/ml IL1b for 24 h increased FN promoter activity, which was inhibited either by the expression of the mutant IjBa or mutations of the NF-jB element at )1180 (Fig. 5A). In addition, IL-1b increased the NF-jB reporter activity used as a control, indicating the activation of the intracellular NF-jB pathway (Fig. 5A). IL-1b also increased the levels of FN protein, particularly in the culture medium (Fig. 5B) and FN mRNA levels (Fig. 5C). These results show that the activation of the endogenous NF-jB pathway by IL-1b increases FN gene expression in rat hepatocytes.

Discussion

Fig. 5. IL-1b treatment increases FN expression in rat hepatocytes. (A) Cells were transfected with either pGL2F1900 together with pCMVIjBa or pNF-jB-luc. After transfection, cells were incubated with 2.5 ng/ml IL-1b for 24 h. (B) Culture medium and cell lysates were prepared from IL-1b-treated cells and subjected to Western blot analysis. (C) Total RNA was isolated from IL-1b-treated cells and subjected to Northern blot analysis. 18S, 18 S ribosomal RNA.

This study shows that the NF-jB transcription factor activates FN expression in rat hepatocytes through the NF-jB element (50 -GAGAATTTCC-30 ) at )1180 in the FN gene by binding as the p65/p65 homodimer. To examine the role of NF-jB, we activated the intracellular NF-jB pathway by using transient and stable expression of the exogenous NF-jB p65 subunit or incubating cells with a NF-jB-stimulating cytokine IL1b. Deletion and mutation analysis of the FN gene identified the location of the NF-jB-responsive regulatory element at )1180. EMSA using antibodies against NF-jB subunits showed that this element is a functional binding site for NF-jB p65/p65. It is a novel finding that NF-jB activates the expression of FN gene. The NF-jB-responsive element of FN gene is a preferential binding site for the p65/p65 homodimer. This would be an unusual finding in that the p65/p50 heterodimer is a more common form of DNA-binding complex with stronger binding activity and transcriptional activating activity than the p65/p65 homodimer [11,14,18]. Our data showed that expression of p65 induced the binding of the p65/p65 homodimer to the NF-jB site at )1180 of FN gene. In addition, the expression of p65

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

alone had higher transcriptional activation of FN gene than the coexpression of p65 and p50 (data not shown). However, we could not show the IL-1b-induced binding of the endogenous p65/p65 homodimer to the NF-jB site of FN. A possible explanation for this might be a relatively weak binding activity of the p65 homodimer to a NF-jB site [11,14] and thus the IL-1b-induced binding of the p65 homodimer to the NF-jB site of FN would not be sufficient to form a DNA–protein complex on gel shift assay, although we could show its binding when the p65 subunit is overexpressed in cells. It has been shown that NF-jB p50 subunit prefers to bind to the highly conserved 50 -half site in the consensus NF-jB binding site (50 GGGACTTTCC-30 ), while p65 subunit prefers to bind to the less conserved 30 -half site [11,18]. The highly conserved 50 -GGG-30 sequence in the 50 -half site of the consensus NF-jB element is changed to 50 -GAG-30 in the NF-jB site of FN (50 -GAGAATTTCC-30 ). The difference in sequence between the consensus NF-jB site and the NF-jB site from the FN gene may explain the preferential binding of the p65/p65 homodimer to the NF-jB site of FN. NF-jB dimers are composed of distinct subunits likely to play an activating or inhibitory role in the expression of FN gene by acting on the NF-jB binding sites at different positions in the FN promoter. For example, we previously showed that the NF-jB p65/p50 heterodimer and the p50/p50 homodimer which bind to the proximal NF-jB element at )41 in FN promoter play an inhibitory role during the activation of the FN gene by phorbol myristate acetate [13]. On the other hand, the present study showed that the binding of NFjB as p65/p65 homodimers to the distal NF-jB element at )1180 activates the expression of FN gene. Moreover, the presence of distinct subunits of NF-jB family depending on the cell type may be responsible for the differential regulation of a target gene in different cell types. For example, the activation of NF-jB by TNF-a has been shown to induce VCAM-1 gene expression in vascular endothelial cells but not in epithelial cells, while the inhibition of the p50 subunit using an antisense oligonucleotide restored the induction of the VCAM-1 gene by the cytokine in the epithelial cells [19]. What would be the physiological significance of the regulation of FN expression by NF-jB? Inhibition of the NF-jB p65 subunit was shown to block the adhesion of tumor cell lines to ECM and inhibit tumor growth [20]. NF-jB was also shown to increase the expression of the avb3 integrin on cell surface and promote cell attachment to ECM [21]. Similar to NF-jB, the EGR-1 transcription factor has been shown to induce FN expression of cells, thereby leading to enhanced cell adhesion to ECM [9,10]. Adhesion of cells to FN and subsequent integrin signaling has been shown to be important for cell survival and cell cycle progression [3,4]. Interestingly, attachment to FN was shown to in-

1223

crease intracellular NF-jB activity [22]. Taken together, NF-jB may play a role in cell adhesion and cell survival by modulating the levels of FN in ECM. A growing number of reports describe the importance of NF-jB in the liver. Mice lacking the p65 NF-jB subunit die during embryogenesis from massive hepatic apoptosis [23]. Liver regeneration is defective in mice that do not show increase of NF-jB after partial hepatectomy [24]. In contrast to these beneficial effects, NFjB appears to have harmful effects in the liver by contributing to the inflammatory response of activated hepatic stellate cells, which is a condition that often precedes and coexists with fibrogenesis. For example, inhibition of NF-jB in the activated hepatic stellate cells reduces the expression of IL-6 and ICAM-1 genes whose products contribute to the inflammatory response [25,26]. These findings suggest an application of NF-jB as a potential anti-inflammatory and antifibrotic agent of the liver. Taken together, it may be of interest to study whether the expression of FN in response to NFjB activation would contribute to the survival and regeneration of hepatocytes or to the hepatic fibrogenesis in the microenvironment of the liver.

Acknowledgments We thank Dr. Kinichiro Oda (Science University of Tokyo, Tokyo, Japan) for providing pF882CAT construct and Dr. Patrick A Baeuerle (Tularik, South San Francisco, A) for pCMV-p65 expression vector. This work was supported by a program of National Research Laboratory (M10104000036-01J0000-01610).

References [1] R.O. Hynes, Fibronectins, Springer, New York, 1990. [2] J.W. Tamkun, R.O. Hynes, Plasma fibronectin is synthesized and secreted by hepatocytes, J. Biol. Chem. 258 (1983) 4641–4647. [3] F.G. Giancotti, E. Ruoslahtit, Integrin signaling, Science. 285 (1999) 1028–1032. [4] R.K. Assoian, Anchorage-dependent cell cycle progression, J. Cell. Biol. 136 (1997) 1–4. [5] D.C. Dean, J.J. McQuillan, S. Weintraub, Serum stimulation of fibronectin gene expression appears to result from rapid seruminduced binding of nuclear proteins to a cAMP response element, J. Biol. Chem. 265 (1990) 3522–3527. [6] C. Bowlus, J.J. McQuillan, D.C. Dean, Characterization of three different elements in the 50 -flanking region of the fibronectin gene which mediate a transcriptional response to cAMP, J. Biol. Chem. 266 (1991) 1122–1127. [7] Y. Shino, H. Shirasawa, T. Kinoshita, B. Simizu, Human papillomavirus type 16 E6 protein trasncriptionally modulates fibronectin gene expression by induction of protein complexes binding to the cyclic AMP response element, J. Virol. 71 (1997) 4310–4318. [8] T. Nakajima, T. Nakamura, S. Tsunoda, S. Nakada, K. Oda, E1A-responsive elements for repression of rat fibronectin gene transcription, Mol. Cell. Biol. 12 (1992) 2837–2846. [9] C. Liu, J. Yao, I. Belle, R.-P. Huang, E. Adamson, D. Mercola, The transcription factor EGR-1 suppresses transformation of

1224

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

B.-H. Lee et al. / Biochemical and Biophysical Research Communications 297 (2002) 1218–1224

human fibrosarcoma HT1080 cells by coordinated induction of transforming growth factor-b1, fibronectin, and plasminogen activator inhibitor-1, J. Biol. Chem. 274 (1999) 4400–4411. C. Liu, J. Yao, D. Mercola, E. Adamson, The transcription factor EGR-1 directly transactivates the fibronectin gene and enhances attachment of human glioblastsoma cell line U251, J. Biol. Chem. 275 (2000) 20315–20323. P.A. Baeuerle, The inducible transcription factor NF-jB: regulation by distinct protein subunits, Biochem. Biophys. Acta 1072 (1991) 63–80. P.A. Baeuerle, V.R. Baichwal, NF-jB as a frequent target for immunosuppressive and anti-inflammatory molecules, Adv. Immunol. 65 (1997) 111–137. B.-H. Lee, M.-S. Kim, J.-H. Rhew, R.-W. Park, B. Crombrugghe, I.-S. Kim, Transcriptional regulation of fibronectin gene by phorbol myristate acetate in hepatoma cells: a negative role for NF-jB, J. Cell. Biochem. 76 (2000) 437–451. M.L. Schmitz, P.A. Baeuerle, The p65 subunit is responsible for the strong transcription activating potential of NF-jB, EMBO J. 10 (1991) 3805–3817. J.A. Brockman, D.C. Scherer, T.A. McKinsey, S.M. Hall, X. Qi, W.A. Lee, D.W. Ballard, Coupling of a signal response domain in IjBa to multiple pathways for NF-jB activation, Mol. Cell. Biol. 15 (1995) 2809–2818. T.G. Yi, H.M. Choi, R.W. Park, K.Y. Sohn, I.S. Kim, Transcriptional repression of type I procollagen genes during adipocyte differentiation, Exp. Mol. Med. 33 (2001) 269–275. B.H. Lee, R.W. Park, K.Y. Sohn, I.S. Kim, Antagonistic regulation of protein kinase C-induced stimulation of fibronectin synthesis by cyclic AMP in human lung fibroblasts, Biochem. Mol. Biol. Int. 43 (1997) 383–390.

[18] M.B. Urban, R. Schreck, P.A. Baeuerle, NF-jB contacts DNA by a heterodimer of the p50 and p65 subunit, EMBO J. 101 (1991) 1817–1825. [19] M. Ahmad, N. Marui, R.W. Alexander, R.M. Medford, Cell typespecific transactivation of the VCAM-1 promoter through an NFkappa B enhancer motif, J. Biol. Chem. 270 (1995) 8976–8983. [20] K.A. Higgins, J.R. Perez, T.A. Coleman, K. Dorshkind, W.A. McComas, U.M. Sarmiento, C.A. Rosen, R. Narayanan, Antisense inhibition of the p65 subunit of NF-jB blocks tumorigenicity and causes tumor regression, Proc. Natl. Acad. Sci. USA. 90 (1993) 9901–9905. [21] C.K. Ritchie, A. Giordano, K. Khalili, Integrin involvement in glioblastoma multiforme: possible regulation by NF-jB, J. Cell. Physiol. 184 (2000) 214–221. [22] E.E. Qwarnstrom, C.O. Ostberg, G.L. Turk, C.A. Richardson, K. Bomsztyk, Fibronectin attachment activates the NF-jB p50/p65 heterodimer in fibroblasts and smooth muscle cells, J. Biol. Chem. 269 (1994) 30765–30768. [23] A.A. Beg, W.C. Sha, R.T. Bronson, S. Ghosh, D. Baltimore, Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-jB, Nature. 376 (1995) 167–170. [24] Y. Yamada, I. Kirillova, J.J. Peschon, N. Fausto, Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type I tumor necrosis factor receptor, Proc. Natl. Acad. Sci. USA. 94 (1997) 1441–1446. [25] R. Taub, Blocking NF-jB in the liver: the good and bad news, Hepatology. 27 (1998) 1445–1446. [26] C. Hellebrand, C. Jobin, Y. Iimuro, L. Licato, B. Sartor, D.A. Brenner, Inhibition of NFjB in activated rat hepatic stellate cells by proteasome inhibitors and an IjB super-repressor, Hepatology 27 (1998) 1285–1295.