Nucleotide sequence of the promoter region of the gene cluster for proton-translocating ATPase from Escherichiacoli and identification of the active promoter

Nucleotide sequence of the promoter region of the gene cluster for proton-translocating ATPase from Escherichiacoli and identification of the active promoter

Vol. 107, No. 2, 1982 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS July 30, 1982 Pages NUCLEOTIDE SEQUENCE OF THE FOR PROTON-TRANSLOCATIN...

1014KB Sizes 0 Downloads 3 Views

Vol. 107, No. 2, 1982

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

July 30, 1982

Pages

NUCLEOTIDE SEQUENCE OF THE FOR PROTON-TRANSLOCATING IDENTIFICATION Hiroshi

Kanazawa.

Department

Received

June

PROMOTER REGION OF THE GENE CLUSTER ATPASE FROM ESCHERICHIA COLI AND OF THE ACTIVE PROMOTER

Kazunori

Mabuchi

and

Masamitsu

Futai

of Microbiology, Faculty of Pharmaceutical Okayama University, Okayama 700, Japan. 15,

568-575

Sciences,

1982

Summary:

A 50Snucleotide long DNA sequence of a part of the gene cluster for the proton-translocating ATPase (pap operon) of E.colt -was determtned. In the sequence determtned upstream of the gene for 14K protean, two promoter sequences with reverse dtrecttons to each other were found. One of them was tdenttfied as the active promoter for the operon by tn vitro transcriptton and the DNase I footprrnting technique. The otherwas located upstream of the pap operon promoter and identifted as an acttve promoter of a gene codtng for a small RNA of unknown functton adjacent to the operon.

The

proton-translocating

syntheses

of

Independent for

ATP,

map

nucleotlde

and

genomtc a the

located

form

a

-hlr

of

DNA

14K

sequence.

the

However,

Thus

deftnttely no

F,

b,

83

minute

was

and of

etght

the

genes

the

E. 151.

(,1L.S,

colt -~ fhe

determtned

gene of

of

All of

operon)

organtzatton

promoter

‘(1,2).

regton

novel

determrned

functtonal

c

(pap

a

hydrolyses

composed

subuntts

addttton the

and

operon for

the is

a,

an

genes tn

catalyzes

enLyme

the as

and (8).

was

13 , tn

all

protean

operon

Y,

cluster

(5-9)

colt

E.

The

6,

are

sequence

cloned

In

(tr,

subunits

Itnkage

of

reversibly.

subunits

the

for

A’i‘Pase

was

the

ustng

found

codtng

structural

genes

at

the

level

of

nucleottde

the

pap

operon

has

yet

been

sequence

of

50:

I)ase

tdenttfted. In patrs

the

upstream

and

found

DNA

RNA

gene

to

a

codtng

for

for

a

I4K details)

found of

protean, ; -Mr.

also

gene

transcription

showed

that

for

by functtonal

functton coded wetght.

568

for

vttro

the

14K

protein using

the

the

DNase

A

adjacent

to a

novel

I

possible a

sate

footprtnttng

sequence the

a

sequence

Furthermore,

promoter

by

the

operon.

tdenttfted.

determtncd

a protean molecular

0006-291X/82/140568-08$01.00/0 CopFri,rhi 0 1982 b-v Academic F’ress. Inc. A II rrghl.7 o/ reprohrcrion in an-v form reserved.

the

In -___

another

unknown

DNA

promoter was

was

RNA

of

sequence actrve

transcrtptton

also

the

terminal

thts

polymerase-binding We

determtned

sequence.

functtonally of

t IO).

Abbrevtations: (see text

amtno

promoter

containing

sttc(si

tcchnrque

we

the

typical

segment

tntttatton

study,

from a

corresponds

for

present

pap reading

for

operon. frame.

a

Vol. 107, Nom. 2, 1982

BIOCHEMICAL

AND BIOPHYSICAL

pap D H F E 14Ko cb8 ~~~~-&&&i H

lip

HHB

B

A

c

RESEARCH COMMUNICATIONS

B

G coding

E

Ii

E

E.coli

from

DNA

Hindll Hpa

I

Hoe

II

Hho

I

Hinf

I

Sau 3A Taq I I

pAT1 , pKY 159-16 I

I

Q

2

1

4 base

pairs

6

8

X 100

F1g. 1 Organlzatlon of the pap (uric 1 ape l-0” and DNA sequent 1ng strategy. The dIrection of transiript’on of the gene cluster 1s shown at the top of the figure. ‘The coding frame of each gene with Its nomenclature (pap) (5) and coding subunit are shown above the -__ E.co11 DNA. Cleavage sites for endonucleases are as follows: E, EcoRI; H, HIndIll; B, BarnHI; The cleavage maps wtth HaelI, Hhal , fiinfl, Sau3A and Taql HP. .-Hpal. __ are also shown. Arrows lndlcate the sequenced D-segments with their dIrectIons and approxlmatr lengths. PlasmIds pATl and pKY159-16 cover the regions shown. The scale shown at the bottom corresponds to the numbers of nucleotlde rcsldues in k’~g. 2.

MATERIALS

AND

METHODS

Preparation of plasmids and their segments: Hybrid plasmids pKY159-16 (8) and pAT1 (11) were used in the present study. The DNA segments used for sequencing, in vitro transcription and DNase I footprinting exr eriment 5 were prepared by digesting plasmid DNA with various restriction endonucleases (Takara Shuzo Co., Japan). Determination of the DNA sequence: DNA fragments prepared by the sequencing strategy (Fig. 1) were phosphorylated at the 5 end with 32I’-Y-ATP and TL-polynucleotide kinase ( Boehringer-Mannheim 1. The DNA sequence was determined by the method of Maxam and Gilbert (12). In vitro transcription : Various DNA segments derived from the promoter .region were transcribed in vitro with RNA polymerase from E. coli by the prcceduro described previously (13). About 3 ug of DNA -and 1 u g of purified E.coli RNA polymerase holoenzyme (New England Biolabs. 1 were -__ mi>ed in 50 u 1 of reaction mixture consisting of 40 mM Tris-HCl, pH 7.9, 10 mM MgCl 0.1 mM EDTA, 1 mM DTT, 50 mM KCl, 12.5 % glycerol, 0.5 mM ATP, 0.T mM IJTP, 50 ~JM GTP, 0.39 uM 32P-~-GTP (Amersham) and incubated for 2 hr at 37 C. The reaction was terminated by heating the reaction mlxture for 3 min. The sizes of the RNAs thus synthesized were analyzed by polyacrylamide gel electrophoresis (8 % w/v acrylamide, 8 M urea) and subsequent autoradiography. DNase I footprinting: The experimental procedure was that of Galas and Schmitz (10). A DNA segment was phosphorylated at the 5 end with 32I’-Y-ATP and TL-polynucleotide kinase. About 3 ug of a phosphorylated DNA segment was digested with various amounts of pancreatic DNase I 569

BIOCHEMICAL

Vol. 107, No. 2, 1982

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

(Worthington) in 50 ~1 of solution (20 mM Tris-HCl, pH 7.9, 50 mM KCl, 0.1 mM EDTA, 0.1 mM DTT, 5 % glycerol) in the presence of 10 mM CaC12, 13 pg of purlfred RNA polymerase for 30 set at 25 C. Then 150 1.11 of a containing 0.1 M EDTA and 50 ug/ml solution of 0.3 M sodium acetate, The mixture of DNA fragments thus tRNA was added to stop the reaction. electrophoresis prepared was subjected to polyacrylamide and gel autoradiography. RESULTS DNA

sequence We

of

amino

Two box”

were

found

The drrection as

an

--In

vitro

that

active

To

a

250 gene

14K

the

(E

+

of

adjacent

protean

of

of

and

480

14K

pap

the

to --pap

RNA

of

the

polymerase)

(A

+

8)

protein,

operon

the

operon

sequences

sate

the the

DNA

consensus

D)

for

described

operon: of

recognition

the

as

whether DNA

by

transcripts

and

(14)

rn

Ftg.

2.

has

the

same

was

identified

below.

120

usrng

a

exist

of for

(Ftg.

3,

the

DNA

in

product the

the

of

segments indicating about

that

both

in of

The most

the the

5’

end

cases

nucleotides

d

57

operon of

and

mRNA

in

determined downstream

concluded

that 492,

Fig.

from the 2).

the initiatron

If

this

site IS

the 570

shorter

RNA

of

(A)

is

located

the

“Pribnow of

case,

3) or

d

IS

segment, for was

promoter the

same

as

15).

guanlne

(G)

about

residue

four

box”

to

(14). A

transcrrpt

c 3),

C)

active

(1,

and

used

(transcript

transcript the

a (Fig.

transcription (Frg.

by

different

the

an

the

estimated

was

that

14K

Further-

The

When

the

than

carrying

segment,

the

promoters

template. were

sites.

of found

for

segments).

shorter

adenine

of

active

respectively

suggests

and end

d

c

dlrection

1s

gene

the

A,

the

previously

--E.coli so far

the two

segments

and

result the

carrying

of

and

nucleottde

estimated

comprised

were

promoter

than

sizes

segment),

that

DNA

B have

This

d).

part

are

in vitro -__ of the

were

of

c,

to

the

transcripts

a,

transcripts

segment

pap

3,

sequence

nucleotldes,

transcripts

using

(Fig.

segments

3,

a

respective

transcripts

shorter

(Fig.

the

the

approximately

synthesrzed

(b

read-through

for

nucleotide

transcription,

because

the

DNA

and

DNA

subjected

transcripts, B)

indicate

non-specific

of

for

site results

segment

coded

57

exists

b

major

long

promoter

segment,

srzes

the

Two

the

and

(transcript

nucleotlde

regions

the

portions

polymerase

3). 85

These

for

coding

analyzing

615

b) .

expected

more,

(Fig. and

in was

sequences

RNA

A)

found

both

analyzed.

candidates

promoters

purified

(transcript template

protein

two

carrying

a

were

about

the

segment

transcription

(positron

(a

transcription

promoter,

the

to

about to

for

determine

that

region

pap

sequence

transcription:

active,

two

-35

the

for

gene similar

closer

as

the

positrons

(A+B)

for long

sequences

at

one

of

and

DISCUSSION

region

505-nucleotide

portion

2).

“Pribnow

promoter

a

terminal

(Fig.

we

the

determined

AND

is

In seven

Therefore, possibly

should

G be

127

Vol. 107. No. 2, 1982

8lOCHEMlCAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

100

GAAAATAAGTCATTAlGT~TATCAGTCTGCT~?CGGCGCTAAGAACCATCATiGGCTGTTAAAACATTATT~AATGTCAATGGGTGGTTTi CTTTTATTCAGTAAT'CACTTTTATAGTCAGRCQT~TTTAGCCGCGATTCTTGG~CGACAATTTTGTAATAA~TTTACAGTTACCCACCAAAA

200

G TGTTGTGTAAATGTC,RTTTj\TTAAAACAGTATCTGTTTT;AGACTGAAATATCATAAAC;TGCAAAGGCATCATTTGCC;\AGTA~TAAATATGCTGTGZ ACAACACATTTACAGTAAATAATTTTGTCATAGRC~~~CTTTATAGTATTTGAACGTTTCCGTAGTACATTTATTTATACGACACG

E

F

300

D

GCGAACATU:GCAAT,I\TGT~TCTWV\GCACGCTTTATCiiCCAGTGTTTACGCGTTATT3ACAGTTTTTCAT~TC~~AGGGTTAG~~~GTCG~ CGCTTGTACGCGTTATACACTAGACTTCGTGCGAAATAGTGGTCACATGCGCAATAAATGTCAAAATCGTCTTTTCAGCG

400

C AATTGTATGCACTGG~TATTTACATTTATTCAC~TTTT~CTACTTATTGT~TCACGGGGGCGCACCGjATAArrTGAC TTAACATRCGTGACCTSTTTATAAArrTGTAAATAAGTGGAAAACCGATGAATAAC~ACTTTAGTGCCCCCGCGTGGCATATT~CT~C~CT

A

500

B 600

700

800

CGCATTT~X&IAGC'IT GCGTAAACCGCTTCQ1A eAlaPhe

817

:lyyCluAla

1:1g. 2 DNA sequence of the promoter of the pap operon and flanktng ~__ l‘eglo”. The DNA sequence tn the antisense strand 1s shown wtth the ~ieducecl amtno actd sequence. The numbers of restdues shown on the right correspond to the scale tn Ftg. 1. A and D, a sequence recogntzed by RNA l’olymerase f-35 regtonl ; B and E, the “Prtbnnw box” ; C, f 7 ) a restdue < orrespondtng to the 5’ end of mRNA of the pap operon. The arrow Indtcates the dtrectton of transcription ; F, a residue correspondtn2 to the !, ’ end of the newly tdenttfted RNA of unknown functton. ; G, a possible termtnator sequence for the RNA. ‘Thts sequence 1s stmtlar to that found In several genes for which termtnatton 15 dependent on the rho factor. The IINA sequence after posttton 389 tn Ftg. 2 was determlned Independently by (;ay and Walker by the dtdeoxynucleottde method (19). Our seauence agrees lylth thetrs. We reported the DNA sequence after posttton 506 p’reviousl;(8), l)ut several nuclcotlde restdues between posItIon 560 and 817 were revised in the present study.

and

62

nucleotide

temljlates.

These

transcrtpts

(120

valtles may

for be

stranded

tie

to

the

tnltlation

(an

of

a

and

well

segments

with

marker

3, 1.

transcript

Thus A.

571

M)

found

G

--in between

synthesized

migrations (a

sense (positton

as

in

difference and

between

(Fig. strand

respectively,

those The

calculated

difference

of

d

long).

transcripts

antisense sate

c

nucleotide

sltght as

the

agreed 63

a

used RNA

with

numbers and sizes

due DNA

transcribed to

the

long

the

--in of

the

strand)

492)

vitro

and is

vitro single that

concluded

of

Vol. 107, No. 2, 1982 M

BIOCHEMICAL a

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

bed

abcde

-as

f

B

C 500

b < L 0

0

L 250 base

--a--500

I 615

04

pairs

3

F1g. 3 In vitro transcrlptlon of various DNA segments carrying promoter -__ regions. Various portlons (a-d) of the DNA segment carrying the promoter regions used for in vitro transcrlptlon are shown at the bottom of the r1gure. The cleavage sites correspond to those In F1g. 1. P and arrows Indicate the promoter site and the dIrectIon of transcrlptlon, respectively. The same amount of each DNA segment (adlusted by molecular weight of each about was Incubated with a RNA polymerase as segment, 3 P.2) Sample5 described in the Materials and Methods. we r-e subjected to polyacrylamtde gel electrophoresls (8 % (w/v) acrylamide. 8 RI urea) and autoradlography. ‘The letters (a-d) at the top of the figure correspond to the DNA template shown at the bottom. M lndlcatcs a size-marker. The 1~ segment was labeled at the 5’ end with 32Ky-ATP and TL-polynucleotlde Half the klnase and was digested with restrIctIon endonuclease Haell. segment with the Hlndll site was recovered after gel clectrophoresls. This segment was subjected to chemical cleavage speclflc to the G reslduc and applied on gel ab a size-marker. Numbers on the left and numbers at the the G residues from the Hlndll site (Fig. 1) and the right Indicate apprOXlmate 51zes of maJOr transcripts (A, B and c‘) based on the marker. respectively. One or two minor, but relatively 5tron.q bands adjacent to each maJOr transcript (A, B and Cl were observed. These bands may have appeared because termlnatlon In each ~‘35~ IS not spcclflc. Fig. L DNase I lIpa site (posItIon c( 1 end dnd dlge>tcd

footprlntlr1.q analyst\. A DNA segment 1) to the tl~ndIl1 sltc lpL>\lt.lon 61:) with HaelI. llalf the se,qmcnt with

572

cxrendlng was labeled Hlndll

from at site

the the was

BIOCHEMICAL

Vol. 107, No. 2, 1982 A

possible

(posttion

initiation

2851.

tion,

a

160 from

I

size

terminator

trarscript to

(or

Binding

the

the

of

To

determine

pap

‘operon of

4)

and

region

became

(FL!:.

51.

(about

2841 of

region

in

position expected

we

from

about

extending

3,

a 1.

genes

Thus

A

transcrip-

that

Fig.

found

or

around with

nucleottdes,

in

The

which

believe

that

position

-8.5

160

(-1.5,

susceptible

was

reported

indicate

i-hat RNA

the

residues

for

The

results located

the

the

yet

been

4

the in

binding -27 the

on

-27 the

-501

lac

DNase

-84

noted

that

protected

RNA

(17)

polymerase.

polymerase fi-lactamase

the

promoter

became

more

These

the

the

region

the

of

I

residue,

protected

in

to

residues

region,

to

within

binding

extruded

presence

protected

the

residue

RNA

the

of

be

to

4801

these

+12

should

and

of are

It

I

DNase

residue on

The

of

residues

position

results

from

adjacent -49

of

outside

results of

complex

DNA.

operon:

described

for

-40, to

-26 I

5.

below.

presence

in

The

of

determined

the

that

was

t13)

that

and

pap

upstream

prolnoter

-27,

in

lower

4).

Fig.

promoter

we

(about

much

(Fig.

in

and

around

polymerase

Promoter

I

the

intensities

suggesting

polymerase,

-89

more

DNase

DNase

RNA

-17,

DNase

box”

were

operon:

active,

The

“Pribnow

discussed to

by

absence,

by

pap in

is

attack

4601

the

polymerase

promoter

summarized

residues

and

RNA

the

of

for

analysis).

its

attack

six

to

of

position

site

(161

susc.eptible

promoter

from

in

are

It

protnoter

Fig.

a

(14).

the

including

binding the

site

footprint

than

residues

not

85

the

that

I

(positlons

six

21,

(position

direction

in

those

segment

binding

protected

from

for

the

G

consistent

factor

in

DNA

region

-:he

residues and

DNA

(DNase

analysis

print

exc<*pt

a

sequences

protected

foot

found

to

is the

was

rho

confirm

polymerase

pos:,ibly

has

the

the

--35

RNA

werl:

was

polymerase

and

in

the

of

by

RNA

polymerase

(PI:.

analyze

(about

on

coded

B

region

transcript

RESEARCH COMMUNICATIONS

245).

sequence

of

the

depends is

not

This

similar

site

RNA

2).

is

B

244

did

sequence

termination

transcript

sequence

(Fig. of

of

we

terminator

region

the

site

Although

typical

(G

AND BIOPHYSICAL

above from

pap

operon,

determined.

indicated the

gene although We

found

that for

the the

the several

sequence 14K

A and

protein,

complete similar

is

mRNA

of

sequences

B

(Fig.

the the

real operon to

continued

ncubatcd

for 30 SEC at 25 C wlrh various amount of DNase 1 (a and b, 2 c and d, 4 pq/ml) In the presence (a and ci or absence Cd and ,,) of RNA polymerase. Samples were subjected to polyacrylamtde gel ‘?lectrophoresls (15 % (w/v) acrylamtde, 8 M urea) and autoradlography. The labeled DNA segment used for footprintlng was cleaved at the specific 51tc fo.C + T (e) or G (f) and applied to gel as a size marker. Numbers lndlcates the ,n the right correspond to residues In Fig. 2. The arrow .uggested lnltlatlon site of transcrIptIon.

Jg/ml

;

573

the

Vol. 107, No. 2, 1982

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

rftc UA A4 A.U Ad lACAC tA*CAA LIA UA

2

U 'A

-100

-90

-JO

-80

-60

i E u c A AVUGACAU G AAUAAUUUU AU C,G A.U AdJ AU AU AA WI

-50

GAAAAGTCG~AATTGTATGCACTG~AA~.rATTTAAA CTTTTCAGCGTT?~~~TACGTGACCTTTTTATAAATTTGTAAATAAGTGGAAAACCGATG 11 -

450

P [email protected]~GAtCGCTTTTTGiTGCTTGACT? AATAACAAACTTTAEIGCC_CC_CGC~T~GCATATTAAACTGGCGAAAAACTAC~ACTGAG -A -40

05

-30

-20

-10

510 5'

t10

+1

GikGCCA

3'

m

F1g.

5

Summary of D~Nase 1 footprIntIng experiments. The DNA sequence promoter of the pap operon protected from DNase I dIgestIon in of RNA polymerase 1s shown (underlIned with flanking Numbers above the sequence lndlcate residues, taking the first sequences. residue of mRNA as +I. Numbers on the right correspond to those in Fig. “Prlbnow box” 1. The (TATAATT) and -35 region (TTGAAA) are shown in boxes. The arrow lndlcates the dIrectton of transcrlptlon. Markers ( A 1 lndlcate enhanced dIgestIon by DNase I. The broken line lndlcates the region of partial digestlon. around the the presence

F1g. 6 transcribed transcribed (posztlon

“Prlbnow

P0551ble secondary structure of a 86 nucleotlde long RNA from a eerie newlv found ,n this studv. The RNA shown 1s from a DNA segment iposItIon 159-;LL). The G residue 2LL) 1s taken as the inltlatlon sate. c,

box”

wlthin

corresponding for

-35

the

because

Mu that

operon.

However:

which

in

the

DNA

and in

phage

operon.

More

gene

of

each

for

above,

tRNA

rule

suggested

IS

transcribed

strong

out

polar the

the

as effect

on

In -I_

pap

gene

a

slngIe

(17).

of

a

the vitro

have

the

cluster unit,

site

weak

we for

the

promoter(s

consensus

1,

sequence

transcrlptlon

operon

a

Therefore,

promoter

from

the

necessarily that

existence

experiments of

not

unique

different

portion

do

been

are

apparently

detailed

coding

tRNA,

a B

they

are

using required

for

promoter(s).

its

to

15

weak

described

and

cannot

from a

has

had A

we

identified

structure

It

but

ATPase lnsertlon

sequence

of

size

operon,

(8).

sequences

segments

As

region

the

detection

A new

pap

proton-translocating

believe

II-I

the

a small we

transcript. its

RNA:

found

a

(Fig.

gene

adjacent

Although

the

RNA

structure

is

different

secondary (18)

novel

6).

It

has

been

(86

reported

to

the

pap

nucleotides) from

IS

the that

operon slmllar

characterlstlc a

gene

for

the

Vol. lQ7, No. 2, 1982 -Mt-

:!5,000

differs

protein In

determIne

BIOCHEMICAL

size the

is from

real

located the

product

AND BIOPHYSICAL around

mRNA

of

and

function

this the

RESEARCH COMMUNICATIONS

region

(20).

protein. of

this

It newly

However,

will

be

this

RNA

interesting

Identlfled

to

gene.

Acknowledgements Wo are grateful to suggestIons on experlmental
Drs.

T. Seklya, procedures. the Ministry of 1:oundatlon.

M. Seiko, This work Education,

and was Science

H. Yoshlkawa supported In and Culture

for part of

REFERENCES 1.

:: 4. 5. 6. 7. 8. 9.

10. 11. 12. 13. 14.

15. 16. 17. 18.

19. x3 . 21.

M., and Kanazawa , H. (1980) Curr. Top. Bioenerg., IO, 181-215 F1111ngame, R.H. (1981) Curr. Top. Bioeneg., 11, 3.5-106 Kanazawa, H., Mlki, T., Tamura, F., Yura, T., and Futal, M. (1979) Proc. Natl. Acad. Scl. U.S.A., 76. 1126-1130 Kanazawa, H., Tamura, F., Mabuchi, K., Mlkl, ‘I‘., and Futal, M. (1980) Proc. Natl. Acad. !%I. U.S.A., 77, 70057009 Kanazdwa, H., Mabuchi, K., Kayano, T., l‘amura, F‘., and I:utal. hi. (1981) Blochem. Blophys. Res. Commun., 100, 219-22.5 MabL.chl, K., Kanazawa, Ii., Kayano, T., and P’utai, M. (1981) Blochem. Rlophys. Res. Commun., 102, 172-179 Kanazawa, H., Kayano, ‘1‘. , hla buchl , K.. and P‘utal, hl. (1981) Blochem. Biophys. Res. Commun., 103, 6OL-612 Kanazawa. H., Mabuchl, K., Kayano, ‘I’., Nouml, T., Seklya, T., and Futdl, M. (1981 1 Biochem. Blophys. Res. Commun., 103, 613-620 Kanazawa, H., Kayano, T., Klyasu, T., and Futdl, hl. ( 1982) Blochem. Blophys. Res. Commun., 105, 1257-1264 Gala,;. D.J., and Schmltz, A. (1975) Nucleic Acid Res., 5. 3157-3170 FEnS Tamura Le’tt 1;. ,,,rng;;a. li., ‘l‘suchlya, ‘I’. , and Futai, M. (1981 1 FutaL,

Maxam, A.‘, and Gilbert, W. (1977) F’roc. Nati. Acad. Sci. 1l.S.A.. 5hO-564 74. Kupper, H., Seklya, T., Rosenberg. M., Eagan, 1.. and i,andy. A. (197:;) Nature, 273, 423-428 Rosenberg, M., and Court, D. 11979) Ann. Rev. Genet.. 13, X19-351 Down~e, ].A., Gibson, F., and Cox, G.B. (1979) Ann. Rev. Elochem., 48, io:i-1.31 G.N. Russcl I, D.R., and Bennett, (1981) Nucleic Acid Kei., ‘1, 251 i--25,73 (1979) Nucleic Acid Res., 6, 111-137 Schmltz, A., and Galas, D.J. Glbion Ractcrl,o,.F. ,13po;;;zj36] .A., Cox, J.B.. and Radlck, J. (1978) ]. Gauss, D.Il., Gruter, F., and Sprlnzl. hl. (1979) Nucleic G, rl-t-44 von Mcyenberg, K., and Hansen, k’.G. (1980) ICN-UC1.A LIolccular and Cellular Biology, 19, 137-159 and Walker, ].A. (19811 Nucleic Acid Res., N.1.. Gay,

Acid

Res.,

Symposia 9,

3919-395

on