Overexpression of the arginine decarboxylase gene promotes the symbiotic interaction Medicago truncatula-Sinorhizobium meliloti and induces the accumulation of proline and spermine in nodules under salt stress conditions

Overexpression of the arginine decarboxylase gene promotes the symbiotic interaction Medicago truncatula-Sinorhizobium meliloti and induces the accumulation of proline and spermine in nodules under salt stress conditions

Journal of Plant Physiology 241 (2019) 153034 Contents lists available at ScienceDirect Journal of Plant Physiology journal homepage: www.elsevier.c...

1MB Sizes 0 Downloads 0 Views

Journal of Plant Physiology 241 (2019) 153034

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Overexpression of the arginine decarboxylase gene promotes the symbiotic interaction Medicago truncatula-Sinorhizobium meliloti and induces the accumulation of proline and spermine in nodules under salt stress conditions

T

Javier Hidalgo-Castellanosa, Ana Sofia Duqueb, Alvaro Burgueñoa, José A. Herrera-Cerveraa, ⁎ Pedro Fevereirob,c, Miguel López-Gómeza, a b c

Departamento de Fisiología Vegetal, Facultad de Ciencias, Universidad de Granada, Campus de Fuentenueva s/n, Granada, Spain Plant Cell Biotechnology Lab, Instituto de Tecnologia Química e Biológica António Xavier (Green-it Unit), Universidade Nova de Lisboa, Oeiras, Portugal Departamento Biologia Vegetal, Faculdade de Ciências da Universidade de Lisboa, Campo Grande, Portugal

A R T I C LE I N FO

A B S T R A C T

Keywords: Polyamines Salt stress Symbiosis Nitrogen fixation Medicago truncatula

Legumes have the capacity to fix nitrogen in symbiosis with soil bacteria known as rhizobia by the formation of root nodules. However, nitrogen fixation is highly sensitive to soil salinity with a concomitant reduction of the plant yield and soil fertilization. Polycationic aliphatic amines known as polyamines (PAs) have been shown to be involved in the response to a variety of stresses in plants including soil salinity. Therefore, the generation of transgenic plants overexpressing genes involved in PA biosynthesis have been proposed as a promising tool to improve salt stress tolerance in plants. In this work we tested whether the modulation of PAs in transgenic Medicago truncatula plants was advantageous for the symbiotic interaction with Sinorhizobium meliloti under salt stress conditions, when compared to wild type plants. Consequently, we characterized the symbiotic response to salt stress of the homozygous M. truncatula plant line L-108, constitutively expressing the oat adc gene, coding for the PA biosynthetic enzyme arginine decarboxylase, involved in PAs biosynthesis. In a nodulation kinetic assay, nodule number incremented in L-108 plants under salt stress. In addition, these plants at vegetative stage showed higher nitrogenase and nodule biomass and, under salt stress, accumulated proline (Pro) and spermine (Spm) in nodules, while in wt plants, the accumulation of glutamic acid (Glu), γ-amino butyric acid (GABA) and 1-aminocyclopropane carboxylic acid (ACC) (the ethylene (ET) precursor) were the metabolites involved in the salt stress response. Therefore, overexpression of oat adc gene favours the symbiotic interaction between plants of M. truncatula L-108 and S. meliloti under salt stress and the accumulation of Pro and Spm, seems to be the molecules involved in salt stress tolerance.

1. Introduction Legumes are important players for the sustainability of ecosystems as well as for the agricultural practices due to their capacity to fix atmospheric nitrogen in symbiosis with soil diazotrophic bacteria known as rhizobia, which induce the formation of root nodules (Graham and Vance, 2003). However, legumes are classified as salt-sensitive crop species and their productivity is particularly affected under salinity because nodular nitrogenase activity, responsible for symbiotic nitrogen fixation, decreases upon exposure to saline conditions (Aranjuelo et al., 2014; Araújo et al., 2015).

Under salt stress conditions plants tend to accumulate polyamines (PAs), a set of low molecular weight aliphatic compounds with two or more amine functional groups (Hussain et al., 2011). The most common forms of PAs are putrescine (Put), spermidine (Spd) and spermine (Spm), although root nodules of legumes contain a high variety of PAs some of which are nodule specific and synthesized by the rhizobia (Fujihara, 2009). Among the nodule specific PAs, homospermidine (Homspd) is the most abundant in nodules of Medicago spp. found mainly in the bacteroidal fraction (López-Gómez et al., 2014) and cadaverine (Cad) the most responsive to salt stress (Jancewicz et al., 2016). Depending on the plant species, amino acids arginine and/or

Abbreviations: GABA, γ-Amino butyric acid; ADC, arginine decarboxylase; ACC, 1-aminocyclopropane carboxylic acid; Cad, cadaverine; CAT, catalase; DAO, diamine oxidase; ET, ethylene; Glu, glutamic acid; Homspd, Homospermidine; PAs, polyamines; PAO, polyamine oxidase; Pro, proline; Put, putrescine; Spd, spermidine; Spm, spermine ⁎ Corresponding author. E-mail address: [email protected] (M. López-Gómez). https://doi.org/10.1016/j.jplph.2019.153034 Received 7 May 2019; Received in revised form 16 August 2019; Accepted 16 August 2019 Available online 27 August 2019 0176-1617/ © 2019 Elsevier GmbH. All rights reserved.

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

2. Material and methods

ornithine are the Put precursors through the activity of ornithine decarboxylase (ODC; EC 4.1.1.17) and arginine decarboxylase (ADC; EC 4.1.1.19), respectively (Alcazar et al., 2010). The biosynthetic route via ADC involves the production of the intermediate agmatine (Agm) followed by two successive steps catalysed by agmatine iminohydrolase (AIH, EC 3.5.3.12) and N-carbamoylputrescine amidohydrolase (CPA, EC 3.5.1.53). Put is converted to Spd via Spd synthase (SPDS; EC 2.5.16) by the addition of aminopropyl groups provided by decarboxilated S-adenosylmethionine (dcSAM), which is also precursor for the synthesis of ethylene (ET). However, the modulation of PA contents in plants not only depends on their synthesis, but also on their degradation by diamine oxidases (DAO, EC 1.4.3.6) and polyamine oxidases (PAO, EC 1.5.3.3). DAO and PAO are thought to play a major role in plant responses to stress through the production of H2O2, considered a signalling molecule orchestrating several physiological processes (Gupta et al., 2016). In addition, the production of amino acids such as proline (Pro) and γ-amino butyric acid (GABA), involved in the salt stress response as osmolites, is related with PAs synthesis and catabolism (Su and Bai, 2008) (Cvikrova et al., 2012). (Fig. 1S). Medicago truncatula Gaertn. (barrel medic) is an attractive model for studying plant-microbe symbiotic interactions and nodule formation (Ané et al., 2008). M. truncatula is an autogamous diploid (2n = 16) annual plant, with prolific seed production and a relatively small and sequenced genome (Young et al., 2011). These characteristics together with a rapid life cycle and the amenability to genetic manipulation are considered excellent for plant model systems (Chang et al., 2016). The positive effect of exogenous PA treatments in M. truncatula-S. meliloti symbiosis, by reducing the oxidative damage induced under salt stress conditions, were recently reported by López-Gómez et al. (2017). In agreement with this, overexpression of ADC has been shown to increase tolerance to environmental stresses reviewed by Duque (2013), Minocha et al. (2014), including salt stress tolerance. However, the study of salt stress effects in M. truncatula-S. meliloti symbiosis, using transgenic plants with altered PA contents, have never been accomplished and can provide new insights into the role and regulatory function of PAs in the legume-rhizobia interaction. In this work, we studied whether the modulation of PAs in nodulated M. truncatula transgenic plants was favorable under salt stress conditions, when compared to wild type plants. For this purpose, we characterized the symbiotic phenotype of a homozygous M. truncatula cv. Jemalong plant line (L-108) constitutively expressing the oat adc gene (Araujo et al., 2004). A special emphasis was placed on the nodulation and nitrogen fixation parameters due to the positive correlation observed between the concentration of nodular PAs and the nitrogenase activity (Lahiri et al., 2004). Since PA catabolism is crucial in regulating PA levels in cells (López-Gómez et al., 2014), other parameters related to salt stress adaptation and PA catabolism were also studied. Thereby, the correlation between M. truncatula free PA levels, nitrogenase activity, H2O2 and amino acids Glu, Pro and GABA have been evaluated and discussed in this work. The results obtained suggest that the expression of the adc gene promotes the symbiotic interaction M. truncatula-S. meliloti under salt stress conditions, since the nodule number incremented in the L-108 transgenic line. The results also support that the accumulation of Pro and Spm in the nodules of the L-108 plants, would be the mechanism involved in the observed salt stress tolerance.

2.1. Biological material and growth conditions In this study, the T2 transgenic homozygous M. truncatula Gaertn. (cv. Jemalong) line L-108 expressing the oat arginine decarboxylase (ADC, GeneBank Accession No. X56802) under the control of the 35S CaMV promoter with duplicate enhancer regions and a 35S terminator (2 × 35S-Adc-t35S) was used. A detailed description of the constructs, the Agrobacterium-mediated transformation of M. truncatula M9-10a embryogenic line, as well as the molecular analysis of stably transformed plants and of the T2 homozygous plants obtained can be found in Araujo et al. (2004) and Duque et al. (2016). Transgenic M. truncatula L-108 plants presented higher leaf accumulation of putrescine, spermidine and norspermidine compared to control M9-10a plants, under the conditions tested by Duque et al. (2016). In the present work, non-infected embriogenic M9-10a plants were used as control (wt). M. truncatula seeds were scarified by immersion in concentrated H2SO4 for 5 min, washed with sterile water, surface sterilized by immersion in NaClO 50% (v/v) plus Tween-20 for 10 min and germinated onto 1.0% water-agar plates 5 days at 4 °C to synchronize the germination, and then placed at 25 °C in the darkness for 2 days to complete germination (López-Gómez et al., 2014). M. truncatula seedlings were transferred to sterile vermiculite:perlite (3:1) and watered with a modified nitrogen free (Puppo and Rigaud, 1975) nutrient solution. Two days later, the seedlings were inoculated with S. meliloti 1021 strain (c. 109 cell ml−1) grown in TY medium (Beringer, 1974). Plants, in individual pots of about 200 ml, were grown in a controlled environmental chamber with a 16/8 h light-dark cycle, 23/18 °C day night temperature, relative humidity 55/65% and photosynthetic photon flux density (400–700 nm) of 450 μmol m−2 s−1 supplied by fluorescent lamps. Six weeks after sowing, plants were subjected to salt stress by the addition of 75 mM NaCl to the watering nutrient solution while control plants were watered with a NaCl-free nutrient solution. At harvest time, eight weeks after sowing, nitrogenase activity was measured as indicated below and nodules and leaves were frozen at −80 °C for further analyses.

2.2. Adc gene expression analyses For the oat adc gene expression analysis, leaves, roots and nodules of 8 week old control plants were used, while for endogenous M. truncatula adc gene expression analysis, nodules of control plants and plants treated with 75 mM NaCl 2 weeks before harvest were used. Total RNA was extracted using an RNeasy plant mini kit (MachereyNagel, Düren, Germany) followed by treatment with RNase-Free DNaseI (Ambion, Austin Texas, USA) for genomic DNA removal. First-strand cDNA was reverse transcribed from 1.5 μg of DNase-treated total RNA. All DNase-treated total RNA samples were denatured at 65 °C for 5 min followed by quick chill on ice in 12 μL of reaction mixture containing 0.5 μg oligo-dT adapter primers and 1 μl of 10 mM deoxy-nucleotide triphosphate. After the addition of 4 μL of 5x First-Strand buffer, 1 μL of RNase OUT ribonuclease inhibitor and 2 μL of 0.1 M dithiothreitol (DTT), the reaction was preheated at 37 °C for 3 min before the addition of 1 μL (200 U) of iScript reverse transcriptase (Bio-Rad, California, USA). The reaction mixture was incubated at 42 °C for 50 min, followed

Table 1 Primer sequences used for RT-PCR amplification of Avena sativa and M. truncatula Adc cDNA and for M. truncatula elongation factor I (EFI) gene serving as internal reaction control. Gene

Oligonucleotide sequence

Product size

Oat ADC Mt ADC Mt EF1α

Fw 5´-GGCCTAGCTGGCTGTTAAT-3´ Rv 5´-GTCTACAAACCCAAGGACGAA-3´ Fw 5´-GTGACAGTGATGGGAAGATTGA-3´ Rv 5´-CACCCAAGAACATTCCCAGATA-3´ Fw 5´- GCACGCTCTTCTTGCATTTACT -3´ Rv 5´- GGGCTTGTCTGTGGGTCTCTT -3´

99 bp 108 bp 295 bp

2

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

by heat inactivation at 70 °C for 15 min. The resulted first strand cDNA were amplified using gene specific primers (Table 1) designed from the transcribed region of each gene and to have similar annealing temperature (primers for adc cDNA sequence region of Avena sativa are specie specific and do not amplify endogenous Mt adc sequence). The elongation factor I (EFI) gene was used as M. truncatula internal reaction control. PCR amplifications were performed in a 20 μL reaction mixture as follows: one cycle of 2 min at 94 °C, 35 cycle of 30 s at 94 °C, 30 s at 56 °C and 1 min at 72 °C and a final extension at 72 °C for 7 min. PCR products were electrophoretically separated in 1% (w/v) agarose gel. Real-time PCR (qPCR) was performed using a SYBR Green PCR Master kit containing the Platinum Taq DNA polymerase (Invitrogen) on an iCycler IQ thermocycler (Bio-Rad). PCR amplification mixtures contained 10 ng of template cDNA and 0.5 U of polymerase. The cycling conditions were chosen according to the manufacturer. They comprised 10 min polymerase activation at 95 °C and 35 cycles at 95 °C for 15 s, 55 °C for 30 s and 72 °C for 20 s. Results were quantified with the ΔΔCt method (Livak and Schmittgen, 2001). Transcript levels were normalised to elongation factor I (EFI) gene expression. Primer sequences for qPCR analysis of Mt adc cDNA are provided in Table 1.

supernatant were dansylated by mixing with 0.4 mL of dansyl chloride (prepared fresh in acetone, 10 mg/ mL) and 0.2 mL of saturated sodium carbonate. The mixture was incubated in darkness at room temperature overnight. Excess dansyl reagent was removed by reaction with 0.1 mL (100 mg/mL) of added proline, and incubation for 30 min. Dansylpolyamines were extracted in 0.5 mL toluene and the organic phase was evaporated and redissolved in 0.1 mL acetonitrile. Dansyl-polyamines were determined with HPLC (Agilent Technologies 1260) equipped with a reverse phase column (4.6 × 250 mm C18) according to Flores and Galston (1982). A relative calibration procedure was used to determine PA in the samples, using 1,7- diaminoheptane (HTD) as internal standard and PA standards amounts ranging from 0.3 to 1.5 nmol purchased from Sigma. Results were expressed as nmol g−1 fresh weight. 2.8. Determination of amino acids Nodule extracts were prepared in ethanol:chloroform:water (12:5:1) from 0.1 g of frozen material. The homogenate was centrifuged at 5500×g 10 min at 4 °C. The aqueous phase was separated and dried under a stream of N2 before resuspension in 50% (v/v) methanol:water solution. Amino acid derivation with AccQ Tag ultra-derivatization kit (Waters) reagents was conducted according to the manufacturer’s protocol. Briefly, 10 μL of either a standard amino acid mix solution, or a biological extract were mixed with 70 μL of borate buffer, and 20 μL of AccQ Tag reagent previously dissolved in 1.0 mL of ultra-reagent diluent. The reaction was allowed to proceed for 10 min at 55 °C. Liquid chromatographic analysis was performed on a Waters Acquity UPLC system, equipped with a binary solvent manager, an autosampler, a column heater, a photodiode array detector (PDA), and interfaced to a tandem quadrupole detector. The separation column was a Waters AccQ•Tag Ultra column (2.1 mm i.d. × 100 mm, 1.7 μm particles). The column heater was set at 55 °C and the mobile phase flow rate was maintained at 0.7 mL/min. Eluent A was 10% AccQ•Tag Ultra concentrate solvent A, and eluent B was 100% AccQ•Tag Ultra solvent B. The non-linear separation gradient was 0-0.54 min (99.9% A), 5.74 min (90.0% A), 7.74 min (78.8% A), 8.04–8.64 min (40.4% A), 8.73–10 min (99.9% A). A VanGuard™ Waters column (2.1 mm i.d. × 5 mm, 1.7 μm particles) was used as the guard column. One microliter of sample was injected for analysis. The PDA detector was set at 260 nm, with a sampling rate of 20 points/sec. Amino acids stardards purchased from Sigma ranging from 1 to 50 μmol were used for the quantification.

2.3. Determination of shoot and root dry weight The growth parameters shoot dry weight (SDW) and root dry weight (RDW) were obtained at harvest time, eight weeks after sowing, in leaves and roots, dried at 70 °C for 24 h. 2.4. Nodulation kinetics For the nodulation kinetics, M. truncatula plants were grown axenically onto filter paper in glass test tubes containing 10 ml of nitrogen-free (Rigaud and Puppo, 1975) nutrient solution. One week after sowing, each seedling was inoculated with a S. meliloti cell suspension (OD600 0.03). At the inoculation time, a solution of NaCl was added to reach 25 mM in order not to induce an osmotic shock in the seedlings. Nodule number was monitored during the following 26 days. 2.5. Light microscopy analysis Nodule samples of M. truncatula M9-10a and transgenic L-108 plants were fixed in formaldehyde, washed with distilled water, dehydrated through 10, 30, 50, 70, and 90% ethanol and three changes of 100% ethanol (30 min per step), and embedded in paraffin. Longitudinal and transversal sections of nodules (μm) were made using a KD-400 vibration microtome (Kedee, Korea) and mounted on slides, deparaffinized with toluene, rehydrated in distilled water, and stained with toluidine blue (Mhadhbi et al., 2011).

2.9. Determination of DAO and PAO activities Diamine oxidase and polyamine oxidase activities were determined by measuring the generation of H2O2, a product of the oxidation of PAs, as described by (Xu et al., 2011), with some modifications. Plant material (0.5 g) was homogenized in 100 mM potassium phosphate buffer (pH 6.5). The homogenate was centrifuged at 10,000×g for 20 min at 4 °C. The supernatant was used for enzyme assay. The reaction mixture contained 2.5 mL of potassium phosphate buffer (100 mM, pH 6.5), 0.2 ml of 4-aminoantipyrine/N,N-dimethylaniline reaction solutions, 0.1 mL of horseradish peroxidase (250 U/mL), and 0.2 ml of the enzyme extract. The reaction was initiated by the addition of 0.15 mL of 20 mM Put for DAO determination and 20 mM Spd + Spm for PAO determination. The H2O2 evolution was monitored spectrophotometrically at 555 nm optical density measurement and the activity was expressed as μmol of H2O2 per mg of protein per min.

2.6. Nitrogen fixation Nitrogenase activity (E.C. 1.7.9.92) was measured in an open-flow system as the representative H2-evolution using an electrochemical H2 sensor (Qubit System Inc., Canada) in nodulated roots (Witty and Minchin, 1998). Apparent nitrogenase activity (ANA, rate of H2 production in air) was determined under N2:O2 (80%:20%) with a total flow of 0.4 L min−1. Total nitrogenase activity (TNA) was determined under Ar:O2 (79%:21%). Nitrogen fixation rate (NFR) was calculated as (TNA-ANA)/3. Standards of high purity H2 were used to calibrate the detector. 2.7. Determination of free polyamines in leaves and nodules

2.10. H2O2 quantification PA levels in leaves and nodules were determined as described by López-Gómez et al. (2017). Briefly, 0.2 g of fresh tissue was homogenized with 0.6 mL of 5% (v/v) cold perchloric acid (PCA) and centrifuged (3,000xg, 5 min, 4 °C) for the extraction. 0.2 mL aliquots of the

Quantitative analysis of H2O2 was performed spectrophotometrically after reaction with KI (Alexieva et al., 2001). The reaction mixture consisted of 0.5 mL 0.1% trichloroacetic acid (TCA) leaf 3

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

extract supernatant, 0.5 mL of 100 mM potassium-phosphate buffer and 2 mL reagent (1 M KI w/v in fresh double-distilled water H2O). The blank probe consisted of 0.1% TCA in the absence of leaf extract. The reaction was developed for 1 h in darkness and absorbance measured at 390 nm. The amount of H2O2 was calculated using a standard curve prepared with known concentrations of H2O2.

2.11. Determination of catalase activity Catalase activity (CAT) was assayed by the method of Aebi (1984). Nodules (0.2 g) were homogenized in 2.5 mL 100 mM potassium phosphate buffer (pH 7) 100 mM EDTA, 0.1% (v:v) Triton X-100 and 10% (w:w) polyvinylpolypyrrolidone. The homogenate was centrifuged at 27,000 x g for 20 min at 4 °C, and the supernatant was used for the enzyme assay. The reaction mixture contained 50 mM potassium phosphate buffer (pH 7), 0.1% (v:v) Triton X-100 and 10.5 mM H2O2. The decrease in the absorbance at 240 nm was recorded for 3 min by spectrophotometry and the activity was expressed as μmol of H2O2 per mg of protein per min.

2.12. Experimental design and statistical analysis The pot experiment was arranged in a completely randomized design with totally 60 plants per treatment. In the nodulation kinetic, 20 plants per treatment were monitored (n = 20). The data were subjected to an analysis of two-way ANOVA with genotype as one factor and salt treatment as the other using the SPSS 24 software and significant differences between treatments were determined by Fisher's LSD test (P ≤ 0.05). For comparing one factor between two groups (e.g. control and salt stress L-108) a t-test was used (P ≤ 0.05). Determinations of PAs, enzymes activities, amino acids and H2O2 were performed in 20 plants for each determination (n = 3). Nitrogen fixation and growth parameters were determined in 10 plants. Mean values ± SE (standard error) bars are represented.

Fig. 1. (A) Expression analyses of oat adc gene in leaves (L), roots (R) and nodules (N) of M9-10a and L-108 inoculated with S. meliloti 1021. 10 μl of the RT-PCR product was loaded on each lane and separated by electrophoresis on 1% (w/v) agarose gel. Elongation factor I (EFI) was used as internal reaction control. (B) Quantitative RT-PCR analysis of M. truncatula adc gene in nodules of M. truncatula plants inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are mean +SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

3.3. Symbiosis establishment and nodule organogenesis is stimulated in plants overexpressing the oat adc gene

3. Results

Symbiosis establishment in the M9-10a and the L-108 under salt stress conditions was compared for 26 days with a nodulation kinetic in which nodule number was monitored upon inoculation with S. meliloti 1021 (Fig. 3). The first nodules were visible after 5 days. Under unstressed conditions the nodule number in L-108 was significantly higher at day 5 and 26, with differences of 50% and 30%, respectively. Under salt stress conditions the nodulation was delayed, with almost no nodules visible after 5 days, and a reduction of 50% of the nodule number 26 days after inoculation in both genotypes relative to unstressed plants. However, from day 12 onwards, nodule number in salts stressed plants was always higher in L-108 than in M9-10a plants. Nodule samples, obtained from unstressed plants of the nodulation kinetic (at 26 days), were histologically analysed by light microscopy observation of longitudinal and transversal sections (Fig. 4). Nodules showed the characteristic developmental zones of indeterminate nodules along the longitudinal edge in both genotypes with apical meristem, infection zone, fixation zone and senescence zone; differing in the meristematic and infection regions that were more extended in the L-108 plants compared to the M9-10a. In the transversal sections of the nodules, a similar bacteroidal density can be observed in the fixation zone of the M9-10a nodules compared to the transformed plants.

3.1. Oat adc gene is expressed in all plant organs Expression of the oat adc gene was tested by RT-PCR in leaves (L), roots (R) and nodules (N) of transgenic L-108 plants. The absence of amplification was confirmed in control M9-10a plants. As shown in Fig. 1(A), the results confirm that the transgene was expressed in all L108 plant organs tested. In addition, the expression of the endogenous adc gene of M. truncatula was analysed in the parental and the transgenic line (B) under control and salt stress conditions displaying an increment of about 100% (1-fold) by the salinity in both genotypes.

3.2. Shoot growth is promoted by the overexpression of adc gene under salt stress conditions The growth parameters shoot dry weight (SDW) and root dry weight (RDW) shown in Fig. 2 denote different effects of adc overexpression under control condition. Regarding SDW there were no statistically significant differences between L-108 and M9-10a under control conditions. However, under salt stress conditions the overexpression of adc incremented SDW 24% in L-108 plants relative to the wt, although no significant differences are detected between control and salt stressed plants for each genotype. Regarding RDW a decrease of 37% was observed in L-108 compared to the wt. Nevertheless, no effect of salinity could be observed in root growth for any of the genotypes when comparing to unstressed conditions.

3.4. Nitrogen fixation is favoured by the oat adc gene overexpression Parameters related with symbiosis and nitrogen fixation displayed in Fig. 5 showed an increment in L-108 plants in comparison with M94

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

Fig. 2. Shoot dry weight (SDW) and root dry weight (RDW) of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 10). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

However, under salt stress conditions, Put level was significantly higher in L-108 (66%) and in contrast, Spd levels were significantly lower (25%), when compared to control M9-10a plants.

10a, when plants were not subjected to salt stress conditions. Nodule fresh weight (NFW) incremented by 40% in the L-108 line relative to the wt and nodule number (NN) was duplicated. Nitrogenase activity per plant (NFR) in unstressed conditions was also incremented by 35% in L108 plants compared with M9-10a. However, under salt stress conditions no significant differences were found in NFR, NN and NFW between L-108 and M9-10a plants due to the remarkable reduction observed in these parameters in L-108 plants by the salinity.

3.6. Polyamines oxidation behaves differently in response to salinity in M910a and L-108 plants Diamine oxidase activity (DAO) is significantly higher in nodules of the L-108 plants (15%) relative to M9-10a under unstressed conditions; however, polyamine oxidase (PAO) is about 40% lower in L-108 compared to the M9-10a (Fig. 8). Under salt stress conditions, DAO and PAO behaved differently in M9-10a and L-108 plants. In M9-10a DAO was not altered, while PAO was inhibited 38% and, by the contrary, in L-108 DAO was inhibited 60% but PAO was not altered.

3.5. Spd, Spm and HomSpd levels under salt stress were higher in nodules of L-108 plants Under control conditions the level of PAs in nodules did not show differences between M9-10a and L-108 plants; except for Cad which was approximately reduced to 50% in L-108 compared to M9-10a (Fig. 6). The salt stress in M9-10a caused a decline in nodule PAs content with reductions of 1.5, 4, 2.5 and 4.3 fold in Put, Spd, Spm and Homspd, respectively. On the contrary, in L-108 only a significant reduction could be detected in Spd and Homspd when compared with the control L-108 plants (as indicated by the asterisk *), while a statistically significant increment of 1.8 fold in Spm relative to L-108 control plants was observed (*). The leaves of line L-108 under unstressed conditions presented 12% higher Spd levels when compared with the M9-10a; whereas Spm level was 34% lower. Regarding the Put content no statistical difference was detected between L-108 and M9-10a unstressed plants (Fig. 7).

3.7. H2O2 incremented in nodules of plants overexpressing adc gene The H2O2 concentration in nodules of L-108 was 32% higher compared to M9-10a in control conditions; but under salt stress, no significant differences in H2O2 concentration between both genotypes was observed (Fig. 9). This increment of H2O2 in the L-108 compared to the M9-10a, under unstressed conditions, was concomitant with a 25% reduction of the catalase activity (Fig. 10) and could also be related to the increment of DAO activity (Fig. 8).

Fig. 3. Nodulation kinetic of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021. Data are means ± SE (n = 20). Mean values followed by the same letter within a day do not differ (p < 0.05) using the LSD test. 5

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

variation was observed in the Glu concentration in nodules of L-108 while in M9-10a plants, the Glu concentration increased 20% by the salinity. Regarding Pro concentration, in M9-10a plants no variation was detected by the imposed salinity, although Pro concentration in M9-10a nodules was double than in L-108 plants under control conditions. In L-108 plants Pro increased 2.8 fold under salinity. The concentration of GABA did not show differences between the L-108 and wt plants under unstressed conditions and, interestingly, under salinity conditions, only in the M9-10a an increment of 1.5 fold could be detected, while no variation was observed in L-108 plants. As observed for GABA, the ACC increased 30% by the imposed salinity in nodules of M9-10a, but no differences were detected for the L-108. Overall, the nodule levels of all amino acids differed significantly in control M9-10a and transformed L-108 plants under salt stress conditions.

4. Discussion The relationship between the levels of PAs and the capacity to tolerate salt stress in plants have been previously studied (JiménezBremont et al., 2007; Podlešáková et al., 2019; Campestre et al., 2011; Espasandin et al., 2018; López-Gómez et al., 2017). Two of the approaches employed consist in the loss of function mutations of polyamine oxidase genes (Zarza et al., 2017), or the overexpression of genes encoding enzymes involved in PA biosynthesis as reviewed by Hussain et al. (2011) and Minocha et al. (2014). In both cases, enhanced tolerance to salt stress among others, suggests that the increase in PA levels is effective against different types of stresses (Fariduddin et al., 2013). However, complex relationships between PAs, amino acids, hormones and signal molecules such as H2O2 make difficult to establish a direct relationship between the levels of PAs and abiotic stress tolerance, since the pool of PAs is dynamic and undergo rapid interconversions (Gupta et al., 2016; Podlešáková et al., 2019). In this work, the effect of the overexpression of the oat adc gene in the symbiosis between M. truncatula and S. meliloti under salt stress and control conditions has been studied. Initially, we observed that shoot growth was enhanced in L-108

Fig. 4. Light micrographs of sections of nodules of M. truncatula M9-10a and L108 inoculated with S. meliloti 1021. In the longitudinal sections of the nodules of M9-10a (A) and L-108 (C) are distinguished the meristematic region (I), the infection region (II), the fixation zone (III) and the senescent area (IV). B and D correspond to the transversal section of the fixation zone of nodules of M9-10a and L-108, respectively. Bars=500 μm.

3.8. Nodule amino acids levels under salt stress differ in the M9-10a and L108 plants In Fig. 11, the level of amino acids in nodules under control and salt stress conditions are shown. In unstressed conditions, the concentration of amino acid Glu increased 35% in nodules of the L-108 plants related to the M9-10a, however, under salt stress conditions no significant

Fig. 5. Nitrogen fixation rate (NFR), nodule number (NN) and nodule fresh weight (NFW) of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 10). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

6

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

Fig. 6. Polyamines content (Put, putrescine; Cad, cadaverine; Spd, spermidine; Spm, spermine; Homspd, homospermidine) in nodules of M. truncatula M9-10a and L108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test. Asterisk indicates significant differences between control and salt stressed L-108 plants t-test.

wt (Figs. 6 and 7). The increment in the nodule number of L-108 plants under unstressed conditions was confirmed in the pot experiment in which increments in the nodule number (NN) and biomass (NFW) were detected as well (Fig. 5). Interestingly, together to the nodule biomass, an increment in the nitrogen fixation rate (NFR) per plant was also observed, which was rather associated to a higher nodule biomass than to an increment of the functioning efficiency. In that sense, a correlation between the concentration of PAs in nodules and nitrogenase activity has been previously reported (Lahiri et al., 2004), which is supported by our data since under control conditions no increment in major PAs concentration in nodules of the L-108 plants, compared to M9-10a, could be detected (Fig. 6). In this regard, nodule histological analysis shows an increment in the nodular meristematic region (Fig. 4) that has been reported to be produced by an increment in the Put levels in the root cortex, with an induction of cell division (Alcazar et al., 2010). Indeed, an increment in the adc expression and PAs levels has been associated with an increment in the root meristematic activity in Arabidopsis (Mark et al., 1998). Under salt stress conditions, all the

plants under salt stress conditions relative to M9-10a (Fig. 2), which could be related to the increment in the Put levels in leaves possibly due to its growth regulatory capacity by inducing DNA replication and cell division (Alcazar et al., 2010). In addition, the improved photosynthetic parameters observed in M. truncatula L-108 under water deficit conditions (Duque et al., 2016), may also be contributing to shoot growth in this specific salt stress condition. The nodulation process was monitored and in plants overexpressing the oat adc gene we observed an increment in the nodule number at the beginning and the end of the nodulation kinetic (Fig. 3). In soybean the increment in the number of nodules has been associated with the involvement of shoot PAs in nodule number regulation (TerakadoTonooka and Fujihara, 2008; Terakado et al., 2006). Under salt stress conditions, from day 12 onwards, the L-108 plants presented always higher nodule number than M9-10a plants (Fig. 3), which may be explained by the higher levels of some PAs in the nodules of the transgenic plants (namely Spd, Spm and Homspm), as well as by the higher Put and Spm levels detected in leaves in such conditions, compared to

7

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

Fig. 7. Polyamines content (Put, putrescine; Spd, spermidine; Spm, spermine) in leaves of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

2007) and H2O2 (Campestre et al., 2011) which displayed an increment in the nodules of plants constitutively expressing the adc gene (Fig. 9). H2O2 itself acts as a signal molecule involved in the alleviation of various abiotic stresses and contributes to plant growth under salt stress conditions (Tanou et al., 2014). H2O2 accumulation in nodules of the L108 plants could be explained in part by a reduction in the catalase activity (Fig. 10) and in addition could also be correlated with DAO induction (Fig. 8), as previously reported in an experiment in which DAO activity was specifically inhibited (Hidalgo-Castellanos et al., 2019). Morover, catalase activity was also inhibited by salinity, as previously reported in nodules of M. sativa and Phaseolus vulgaris (Tejera García et al., 2007). Glu is considered a central metabolite for nitrogen metabolism in the nodule since most of the assimilated N is incorporated to this amino acid before it is redistributed to form other amino acids and N-rich compounds including PAs, with physiological roles in stress responses (Majumdar et al., 2016). For that reason, Glu was analysed showing different patterns in nodules of the M9-10a and L-108 plants, where the level of Glu was higher compared to wt plants, and no differences between control and salt stressed plants were detected (Fig. 11). In a

symbiotic parameters shown in Fig. 5 were more negatively affected in the transformed plants than in the wt; despite of the higher levels of PAs in nodules of L-108 and the similar induction of the endogenous adc gene expression level in such conditions (Fig. 1B). This would indicate that the tolerance to salinity of the nodule metabolism rather than be associated to a higher PAs levels in the nodule would be related to an enhanced PAs turnover (Zapata et al., 2004), which has been previously reported in cold stress responses (Zhuo et al., 2018). For that reason, PAs catabolic enzymes DAO and PAO were analysed (Fig. 8) showing a correlation between the inhibition of DAO activity by the salinity in L108 plants with the increments in Spm level in nodules. However, Put did not accumulate in such conditions, which could be related with its conversion in Spm. The endogenous M. truncatula adc gene expression induction by the salinity (Fig. 1B) was similar for L-108 and wt, and did not provoked an increment in PAs levels in nodules, which might be related with the existence of post-transcriptional regulation mechanism (López-Gómez et al., 2016) and also supports PAs oxidation as regulatory mechanism. In addition to the contribution to PAs homeostasis, PAs oxidation is involved in the formation of important molecules contributing to the abiotic stress responses such as GABA (Xing et al.,

Fig. 8. Diamino oxidase (DAO) and polyamine oxidase (PAO) activities in nodules of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test. 8

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

previous work it was shown that higher Put production caused an increased flux of Glu into PAs with enhancement in Glu production via additional nitrogen and carbon assimilation (Page et al., 2016). These results would support the differences found in Glu levels between the M9-10a and L-108 plants, considering the increment in NFR observed in L-108. Under stress conditions, Glu was not limiting, probably by the complex relationship between nitrogen and carbon metabolism that would provide an extra source of this amino acid (Majumdar et al., 2016). However, in such conditions N seemed to be relocated in a way that favoured Pro accumulation in L-108 plants, as previously reported in Lotus tenuis overexpressing the adc gene (Espasandin et al., 2018) and in cold stress response of M. falcata plants overexpressing PAs biosynthetic genes (Zhuo et al., 2018). In addition to Pro, Spm also accumulated under salinity in plants over expressing the adc gene (Fig. 6), which can be considered a positive response taking into account the protecting role of both molecules in such conditions, and the role of Spm as indicator of salt tolerance (Chen et al., 2019; López-Gómez et al., 2014). On the contrary, GABA accumulated in nodules of the wt plants, which might be related with a higher transformation of Glu to GABA. The different amino acids accumulation patterns in L-108 and wt plants under salinity indicate that PAs accumulation does not seem to prevail, being rather amino acids such as Pro and GABA the defence mechanisms involved in the salt stress response, as previously reported (López-Gómez et al., 2014; Hatmi et al., 2015; Xing et al., 2007; Pál et al., 2018). In addition, the amino acidic ET precursor ACC, was analysed since PAs and ET compete for the common substrate S-adenosyl methionine. Only in wt plants, the level of ACC incremented by the salinity, while in the L-108 no variation was detected (Fig. 11), which might be related with a higher competition in such conditions with the PAs biosynthetic pathway due to the increment in the nodule Spm level that could exert an antagonistic effect over the ACC accumulation as previously reported in M. sativa plants under salinity (Palma et al., 2013).

Fig. 9. Hydrogen peroxide (H2O2) content in nodules of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

5. Conclusion The increment in the expression of the adc gene increased the nodule biomass by favouring the root colonization and/or nodule organogenesis which led to an increment in the NFR per plant. Regarding the nodule metabolism, L-108 plants under salt stress accumulated higher amounts of Spm and Pro in nodules while in M9-10a plants, the accumulation of Glu, GABA and ACC seems to involved in the salt stress response.

Fig. 10. Catalase activity (CAT) in nodules of M. truncatula M9-10a and L-108 inoculated with S. meliloti 1021 under control (white bars) and salt stress conditions (grey bars). Data are means ± SE (n = 3). Mean values followed by the same letter do not differ (p < 0.05) using the LSD test.

Fig. 11. Concentration of amino acids glutamate (Glu), γ-amino butyric acid (GABA), 1-aminocyclopropane carboxylic acid (ACC) and proline (Pro) in nodules of M. truncatula M9-10a and L-108 expressed in μmol gFW−1. Mean values followed by the same letter do not differ (P < 0.05) using LSD test. 9

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

Acknowledgements

engineered abiotic and biotic stress tolerance in plants. Biotechnol. Adv. 29 (3), 300–311. Jancewicz, A.L., Gibbs, N.M., Masson, P.H., 2016. Cadaverine’s functional role in plant development and environmental response. Front. Plant Sci. 7 (870). Jiménez-Bremont, J.F., Ruiz, O.A., Rodríguez-Kessler, M., 2007. Modulation of spermidine and spermine levels in maize seedlings subjected to long-term salt stress. Plant Physiol. Biochem. 45 (10), 812–821. Lahiri, K., Chattopadhyay, S., Ghosh, B., 2004. Correlation of endogenous free polyamine levels with root nodule senescence in different genotypes in Vigna mungo L. J. Plant Physiol. 161 (5), 563–571. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25 (4), 402–408. López-Gómez, M., Hidalgo-Castellanos, J., Iribarne, C., Lluch, C., 2014. Proline accumulation has prevalence over polyamines in nodules of Medicago sativa in symbiosis with Sinorhizobium meliloti during the initial response to salinity. Plant Soil 374 (1–2), 149–159. López-Gómez, M., Hidalgo-Castellanos, J., Lluch, C., Herrera-Cervera, J.A., 2016. 24Epibrassinolide ameliorates salt stress effects in the symbiosis Medicago truncatulaSinorhizobium meliloti and regulates the nodulation in cross-talk with polyamines. Plant Physiol. Biochem. 108, 212–221. López-Gómez, M., Hidalgo-Castellanos, J., Muñoz-Sánchez, J.R., Marín-Peña, A.J., Lluch, C., Herrera-Cervera, J.A., 2017. Polyamines contribute to salinity tolerance in the symbiosis Medicago truncatula-Sinorhizobium meliloti by preventing oxidative damage. Plant Physiol. Biochem. 116, 9–17. Majumdar, R., Barchi, B., Turlapati, S.A., Gagne, M., Minocha, R., Long, S., Minocha, S.C., 2016. Glutamate, ornithine, arginine, proline, and polyamine metabolic interactions: the pathway is regulated at the post-transcriptional level. Front. Plant Sci. 7 (78). Mark, W., Kimberly, E., Marie, P.R., Russell, M., 1998. Arginine decarboxylase (polyamine synthesis) mutants of Arabidopsis thaliana exhibit altered root growth. Plant J. 13 (2), 231–239. Mhadhbi, H., Djebali, N., Chihaoui, S., Jebara, M., Mhamdi, R., 2011. Nodule senescence in Medicago truncatula-Sinorhizobium symbiosis under abiotic constraints: biochemical and structural processes involved in maintaining nitrogen-fixing capacity. J. Plant Growth Regul. 30 (4), 480–489. Minocha, R., Majumdar, R., Minocha, S.C., 2014. Polyamines and abiotic stress in plants: a complex relationship. Front. Plant Sci. 5. Page, A.F., Cseke, L.J., Minocha, R., Turlapati, S.A., Podila, G.K., Ulanov, A., et al., 2016. Genetic manipulation of putrescine biosynthesis reprograms the cellular transcriptome and the metabolome. BMC Plant Biol. 16, 113 -13. Pál, M., Tajti, J., Szalai, G., Peeva, V., Végh, B., Janda, T., 2018. Interaction of polyamines, abscisic acid and proline under osmotic stress in the leaves of wheat plants. Sci. Rep. 8 (1), 12839. Palma, F., López-Gómez, M., Tejera, N.A., Lluch, C., 2013. Salicylic acid improves the salinity tolerance of Medicago sativa in symbiosis with Sinorhizobium meliloti by preventing nitrogen fixation inhibition. Plant Sci. 208 (0), 75–82. Podlešáková, K., Ugena, L., Spíchal, L., Doležal, K., De Diego, N., 2019. Phytohormones and polyamines regulate plant stress responses by altering GABA pathway. N. Biotechnol. 48, 53–65. Puppo, A., Rigaud, J., 1975. Indole-3-acetic-acid (IAA) oxidation by leghemoglobin from soybean nodules. Physiol. Plantarum 35 (3), 181–185. Rigaud, J., Puppo, A., 1975. Indole-3-acetic-acid catabolism by soybean bacteroids. J. Gen. Microbiol. 88 (June), 223–228. Su, G.X., Bai, X., 2008. Contribution of putrescine degradation to proline accumulation in soybean leaves under salinity. Biol. Plantarum 52 (4), 796–799. Tanou, G., Ziogas, V., Belghazi, M., Christou, A., Filippou, P., Job, D., Fotopoulos, V., Molassiotis, A., 2014. Polyamines reprogram oxidative and nitrosative status and the proteome of citrus plants exposed to salinity stress. Plant Cell Environ. 37 (4), 864–885. Tejera García, N.A., Iribarne, C., Palma, F., Lluch, C., 2007. Inhibition of the catalase activity from Phaseolus vulgaris and Medicago sativa by sodium chloride. Plant Physiol. Biochem. 45 (8), 535–541. Terakado-Tonooka, J., Fujihara, S., 2008. Involvement of polyamines in the root nodule regulation of soybeans (Glycine max). Plant Root 2, 46–53. Terakado, J., Yoneyama, T., Fujihara, S., 2006. Shoot-applied polyamines suppress nodule formation in soybean (Glycine max). J. Plant Physiol. 163 (5), 497–505. Witty, J.F., Minchin, F.R., 1998. Hydrogen measurements provide direct evidence for a variable physical barrier to gas diffusion in legume nodules. J. Exp. Bot. 49 (323), 1015–1020. Xing, S.G., Jun, Y.B., Hau, Z.W., Liang, L.Y., 2007. Higher accumulation of γ-aminobutyric acid induced by salt stress through stimulating the activity of diamine oxidases in Glycine max (L.) Merr. roots. Plant Physiol. Biochem. 45 (8), 560–566. Xu, Y., Shi, G.X., Ding, C.X., Xu, X.Y., 2011. Polyamine metabolism and physiological responses of Potamogeton crispus leaves under lead stress. Russ. J. Plant Physiol. 58 (3), 460–466. Young, N.D., Debellé, F., Oldroyd, G.E.D., Geurts, R., Cannon, S.B., Udvardi, M.K., Benedito, V.A., Mayer, K.F.X., Gouzy, J., Schoof, H., Van de Peer, Y., Proost, S., Cook, D.R., Meyers, B.C., Spannagl, M., Cheung, F., De Mita, S., Krishnakumar, V., Gundlach, H., Zhou, S., Mudge, J., Bharti, A.K., Murray, J.D., Naoumkina, M.A., Rosen, B., Silverstein, K.A.T., Tang, H., Rombauts, S., Zhao, P.X., Zhou, P., Barbe, V., Bardou, P., Bechner, M., Bellec, A., Berger, A., Bergès, H., Bidwell, S., Bisseling, T., Choisne, N., Couloux, A., Denny, R., Deshpande, S., Dai, X., Doyle, J.J., Dudez, A.-M., Farmer, A.D., Fouteau, S., Franken, C., Gibelin, C., Gish, J., Goldstein, S., González, A.J., Green, P.J., Hallab, A., Hartog, M., Hua, A., Humphray, S.J., Jeong, D.-H., Jing, Y., Jöcker, A., Kenton, S.M., Kim, D.-J., Klee, K., Lai, H., Lang, C., Lin, S., Macmil, S.L., Magdelenat, G., Matthews, L., McCorrison, J., Monaghan, E.L., Mun, J.-H.,

This work has been funded by the Spanish Ministry of Economy and Competitiveness grant (AGL2013-4778-P) and the Andalusian research program (AGR-139). Duque AS acknowledges financial support from Fundação para a Ciência e Tecnologia (Lisboa, Portugal) through the research Grant SFRH/BPD/74784/2010. ITQB-UNL acknowledges funding from Fundação para a Ciência e Tecnologia, throughout the research unit GREEN-it "Bioresources for Sustainability" (UID/Multi/ 04551/2013). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jplph.2019.153034. References Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121–126. Alcazar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., Carrasco, P., Tiburcio, A.F., 2010. Polyamines: molecules with regulatory functions in plant abiotic stress tolerance. Planta 231 (6), 1237–1249. Alexieva, V., Sergiev, I., Mapelli, S., Karanov, E., 2001. The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ. 24 (12), 1337–1344. Ané, J.-M., Zhu, H., Frugoli, J., 2008. Recent advances in Medicago truncatula genomics. Int. J. Plant Genomics 2008, 256597. Aranjuelo, I., Arrese-Igor, C., Molero, G., 2014. Nodule performance within a changing environmental context. J. Plant Physiol. 171 (12), 1076–1090. Araujo, S.D., Duque, A., dos Santos, D., Fevereiro, M.P.S., 2004. An efficient transformation method to regenerate a high number of transgenic plants using a new embryogenic line of Medicago truncatula cv. jemalong. Plant Cell Tissue Organ Cult. 78 (2), 123–131. Araújo, S.S., Beebe, S., Crespi, M., Delbreil, B., González, E.M., Gruber, V., LejeuneHenaut, I., Link, W., Monteros, M.J., Prats, E., Rao, I., Vadez, V., Patto, M.C.V., 2015. Abiotic stress responses in legumes: strategies used to cope with environmental challenges. Crit. Rev. Plant Sci. 34 (1-3), 237–280. Beringer, J.E., 1974. R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol. 84 (September), 188–198. Campestre, M.P., Bordenave, C.D., Origone, A.C., Menéndez, A.B., Ruiz, O.A., Rodríguez, A.A., Maiale, S.J., 2011. Polyamine catabolism is involved in response to salt stress in soybean hypocotyls. J. Plant Physiol. 168 (11), 1234–1240. Chen, D., Shao, Q., Yin, L., Younis, A., Zheng, B., 2019. Polyamine function in plants: metabolism, regulation on development, and roles in abiotic stress responses. Front. Plant Sci. 9 (1945). Cvikrova, M., Gemperlova, L., Dobra, J., Martincova, O., Prasil, I.T., Gubis, J., Vankova, R., 2012. Effect of heat stress on polyannine metabolism in proline-over-producing tobacco plants. Plant Sci. 182, 49–58. Chang, C., Bowman, J.L., Meyerowitz, E.M., 2016. Field guide to plant model systems. Cell 167 (2), 325–339. Duque, A.S., Almeida, A.M., Bernardes da Silva, A., Marques da Silva, J., Farinha, A.P., Santos, D., Fevereiro, P., Araújo, S.S., 2013. Abiotic Stress Responses in Plants: Unraveling the Complexity of Genes and Networks to Survive. pp. 49–101. (Ed.). https://www.intechopen.com/books/. Duque, A.S., Lopez-Gomez, M., Kracmarova, J., Gomes, C.N., Araujo, S.S., Lluch, C., Fevereiro, P., 2016. Genetic engineering of polyamine metabolism changes Medicago truncatula responses to water deficit. Plant Cell Tissue Organ Cult. 127 (3), 681–690. Espasandin, F.D., Calzadilla, P.I., Maiale, S.J., Ruiz, O.A., Sansberro, P.A., 2018. Overexpression of the arginine decarboxylase gene improves tolerance to salt stress in Lotus tenuis plants. J. Plant Growth Regul. 37 (1), 156–165. Fariduddin, Q., Varshney, P., Yusuf, M., Ahmad, A., 2013. Polyamines: potent modulators of plant responses to stress. J. Plant Interact. 8 (1), 1–16. Flores, H.E., Galston, A.W., 1982. Analysis of polyamines in higher plants by high performance liquid chromatography. Plant Physiol. 69 (3), 701–706. Fujihara, S., 2009. Biogenic amines in Rhizobia and legume root nodules. Microbes Environ. 24 (1), 1–13. Graham, P.H., Vance, C.P., 2003. Legumes: importance and constraints to greater use. Plant Physiol. 131 (3), 872–877. Gupta, K., Sengupta, A., Chakraborty, M., Gupta, B., 2016. Hydrogen peroxide and polyamines act as double edged swords in plant abiotic stress responses. Front. Plant Sci. 7 (1343). Hatmi, S., Gruau, C., Trotel-Aziz, P., Villaume, S., Rabenoelina, F., Baillieul, F., Eullaffroy, P., Clément, C., Ferchichi, A., Aziz, A., 2015. Drought stress tolerance in grapevine involves activation of polyamine oxidation contributing to improved immune response and low susceptibility to Botrytis cinerea. J. Exp. Bot. 66 (3), 775–787. Hidalgo-Castellanos, J., Marín-Peña, A., Jiménez-Jiménez, S., Herrera-Cervera, J.A., López-Gómez, M., 2019. Polyamines oxidation is required in the symbiotic interaction Medicago truncatula–Sinorhizobium meliloti but does not participate in the regulation of polyamines level under salinity. Plant Growth Regul. 88 (3), 297–307. Hussain, S.S., Ali, M., Ahmad, M., Siddique, K.H.M., 2011. Polyamines: natural and

10

Journal of Plant Physiology 241 (2019) 153034

J. Hidalgo-Castellanos, et al.

Sci. 167 (4), 781–788. Zarza, X., Atanasov, K.E., Marco, F., Arbona, V., Carrasco, P., Kopka, J., Fotopoulos, V., Munnik, T., Gómez-Cadenas, A., Tiburcio, A.F., Alcázar, R., 2017. Polyamine oxidase 5 loss-of-function mutations in Arabidopsis thaliana trigger metabolic and transcriptional reprogramming and promote salt stress tolerance. Plant Cell Environ. 40 (4), 527–542. Zhuo, C., Liang, L., Zhao, Y., Guo, Z., Lu, S., 2018. A cold responsive ethylene responsive factor from Medicago falcata confers cold tolerance by up-regulation of polyamine turnover, antioxidant protection, and proline accumulation. Plant Cell Environ. 41 (9), 2021–2032.

Najar, F.Z., Nicholson, C., Noirot, C., O’Bleness, M., Paule, C.R., Poulain, J., Prion, F., Qin, B., Qu, C., Retzel, E.F., Riddle, C., Sallet, E., Samain, S., Samson, N., Sanders, I., Saurat, O., Scarpelli, C., Schiex, T., Segurens, B., Severin, A.J., Sherrier, D.J., Shi, R., Sims, S., Singer, S.R., Sinharoy, S., Sterck, L., Viollet, A., Wang, B.-B., Wang, K., Wang, M., Wang, X., Warfsmann, J., Weissenbach, J., White, D.D., White, J.D., Wiley, G.B., Wincker, P., Xing, Y., Yang, L., Yao, Z., Ying, F., Zhai, J., Zhou, L., Zuber, A., Dénarié, J., Dixon, R.A., May, G.D., Schwartz, D.C., Rogers, J., Quétier, F., Town, C.D., Roe, B.A., 2011. The Medicago genome provides insight into the evolution of rhizobial symbioses. Nature 480, 520. Zapata, P.J., Serrano, M., Pretel, M.T., Amorós, A., Botella, M.A., 2004. Polyamines and ethylene changes during germination of different plant species under salinity. Plant

11