Panencephalitic Creutzfeldt-Jakob disease in a Chinese family Unusual presentation with PrP codon 210 mutation and identification by PCR-SSCP

Panencephalitic Creutzfeldt-Jakob disease in a Chinese family Unusual presentation with PrP codon 210 mutation and identification by PCR-SSCP

JOURNALOFTHE NEUROLOGICAL SCIENCES ELSEVIER Journal of the Neurological Sciences 143 (1996) 176- I80 Shortreport Panencephalitic Creutzfeldt-Jako...

1MB Sizes 0 Downloads 2 Views

JOURNALOFTHE

NEUROLOGICAL SCIENCES

ELSEVIER

Journal of the Neurological Sciences 143 (1996) 176- I80

Shortreport

Panencephalitic Creutzfeldt-Jakob disease in a Chinese family Unusual presentation with PrP codon 210 mutation and identification by PCR-SSCP Woei-Cherng Shyu a’”,Yaw-Don Hsu a, Ming-Ching Kao b, Wen-Long Tsao b ‘ Deportment of Neurology, Tri-Serrice General Horpita[ and National Defense Medical Center, No. 8, Sec. 3, Tingchow,Rd., Taipei, Taiwan, R.O.C. b Department qfBiochemi.rtn, Tri-Sercice General Hospital and National [email protected] Medical Center, Taipei, Taiwan, R.O.C. Received 27 December 1995; revised 10 April 1996; accepted 21 April 1996

Abstract A point mutation at codon 210 (GTT to ATT) of the priori protein gene on chromosome 20 was found in a 48-year-old CJD-affected woman of a Chinese family. This affected woman had an early onset and long-duration form of CJD. Serial magnetic resonance image (MRI) analysis of this woman showed severe brain atrophy, prominent diffuse white matter degeneration, and subsequent mineralization of basal ganglia and thalamus. MR spectroscopy ([H) analysis elucidated the absence of peaks of choline, creatine and N-acetylaspartate. Using polymerase chain reaction and single-strand confirmational polymorphism (PCR-SSCP) techniques, presymptomatic diagnosis of the second son of this woman showed that he has a similar codon mutation of priori gene as his mother. Keyords; Creutzfeldt-Jakob disease; Codon 210 mutation; PCR-SSCP; MRI/MRS (’ H); White matter degeneration

1. Introduction Creutzfeldt-Jakob disease (CJD) is illness and is in general fatal within a characterized by an accumulation in the mal isoform of amyloid protein known

a rare dementing few months. It is brain of an abnoras ‘priori protein’

(PrP). PrPSc results from a post-translational modification of a cellular isoform (PrPc) which is correlated with the development of human transmissible spongiform encephalopathy (Beckman et al., 1985). Two point mutations at codon 178 (Asp – > Asn) (Brown et al., 1992b) and codon 200 (Glu – > Lys) (Chapman et al., 1993), and several other mutations of the PrP gene (Goldfarb et al., 1991) have been shown to be linked to familial CJD. Although a new point mutation at codon 210 of the PrP gene have been reported on a Libyan Jew (Ripoll et al., ]993) and an Italian family (Pocchiari et al., 1993),they have not been described in Asians with familial CJD. Here we present a point mutation at codon 210 of the human PrP gene in a Chinese family affected by CJD. Furthermore, it is of utmost importance to detect CJD at

“ Corresponding author. Fax: +886 (2) 365-2339.

either symptomatic or presymptomatic stage by non-invasive methods, including magnetic resonance image/spectroscopy (1H) (MRI/MRS). In addition, molecular approaches such as polymerase chain reaction and single strand confirmational polymorphism (PCR-SSCP) also provide a simple and easy test for clinical diagnostic services. In this report, we apply PCR-SSCP and DNA sequencing techniques to analyze the mutation of the PrP gene and use MRI/MRS to correlate with the neuropathological findings of a CJD-affected patient in a Chinese family.

2. Materials and methods 2.1. Case report A 48-year-old female developed vomiting and poor appetite during one month. At the time of admission, she had motor clumsiness and dystonic movement of hands. Neurological examination showed poor calculation, and sluggish judgement to person and place in mental performance. The deep tendon reflex was exaggerated on four limbs without Babinski’s sign. Myoclonic jerk and muscu-

0022-510X\96/$ 15.00 Copyright 0 1996 Elsevier Science B.V. All rights reserved. PII S0022-5 10X(96)O0 198-O

W.-C. Sh?,uet al. /Journol of the Neurological Sciences 143 (1996) 176-180

177

Fig. 1. Axial MRI obtained three months after onset showed increased signal intensity at the head of caudate nucleus, putamen and thalamus in proton density (SE 3000/30). (A) After one year of onset, MRI demonstrated marked brain atrophy, diffuse white matter degeneration including U-fiber and hypointensity signal at basal ganglia and thining cortex (B).

lar rigidity developed in all limbs. After two months of admission, the clinical presentation deteriorated to global aphasia and she was bed-ridden. The electroencephalogram

(EEG) demonstrated a generalized pattern with theta-delta background slowing activity and periodic synchronized sharp ( 1/s) discharge. Cranial MRI (1.5T Picker) revealed increased signal intensity at the basal ganglia and thalamus in T2-weighted image (T2WI) and proton density (PD) (Fig. 1A). One year later, repeated MRI of the patient showed severe atrophic brain and prominently dilated ventricles. Diffuse increased signal intensity over bilateral white matter including U-fiber was found in T2WI and PD. Otherwise, decreased signal intensity at basal ganglia, thalamus and dentate nucleus were found (Fig. IB). Neuropathology by open brain biopsy of temporal lobe exhibited severe loss of neurons, hypertrophic glial reaction and vacuolar-spongiform changes in gray matter. White matter was also involved with severe spongiosis and hypertrophic glial proliferation. The greater intensity of blueness on PerI’s stain represented the highest concentration of ferric iron in cortical areas. Two years following the onset of illness, the patient lived at a chronic-care unit, and remained in a vegetating state. At this time, we examined the MRI/MRS (( H), which demonstrated absence of peaks of creatine (cr), choline (cho), and N-acetylaspartate (NAA). Clinical diagnosis of CJD of this patient was confirmed by the criteria described previously (Brown et al., 1986). The offsprings of this patient (I-2) included a 23-year-old male (II-3) and two other siblings (Fig. 2A), who received

extensive genetic counseling. In spite of genetic analysis at that stage, these siblings were normal on physical examination and were without any known mental or cognitive disabilities. Informed consent was obtained from healthy members of this family.

AI 1

%-

2

178

w’,-(;, .y/7\;L1tt d./’OLOWOW/

(?f’t/?e N?llt.()/()gi(cl/ ,y(itll(t,V/d .{(/yy6)

176–180

Table 1 Primers used for PCR simplification of PrP gene fragments Amplified fragment A B c D

JC- 1 JC-2 JC- 1 JC-4 JC-5 JC-2 JC-3 JC-6

Sequence of primers (5’-3’)

Site of amplified region M

Size of amplified fragment

CCAAGCTTATGGCGAACCTTGGCTGC CCGAATTCTCCCACTATCAGGAAGATG CCAAGCTTATGGCGAACCTTGGCTGC CGGCTTGTTCCACTGACTGTG CGACTGCGTCAATATCACAATC CCGAATTCTCCCACTATCAGGAAGATG CCGAGTAAGCCAAAAACCAAC GTGCACAAAGTTGTTCTGGTTG

lst–759th

775 bp

Ist–306th

314 bp

531th–75%h

237bp

304th–53 1th

228 bp

‘ Position ofnucleotide was used according to KretzschmaretaL (1986)

2.2. Genetic studv

Genomic DNA was extracted from peripheral blood leukocyte by standard methods. The PrP gene ORF was amplified by polymerase chain reaction (PCR) as described (Kretzschmar et al., 1986). The PCR reactions were carried out for 30 cycles in an automated thermal cycler (Perkin-Elmer-Cetus). The cycle conditions were set at 95°C for 1.5 rein, 53°C for 1.5 rein, and 72°C for 2 min. The primer pairs, JC-1 and JC-2 (Table 1), were designed to include 5’-HindIII and EcoR1 linkers. respectively. The 775-bp PCR amplified product (fragment A) corresponding to the PrP gene ORF was eluted from agarose gel by JETSORB Gel Extraction Kit (Genomed Inc., USA). Then purified PCR DNA fragments were cleaved with HindIII and EcoR1 and subcloned into the same sites of bacteriophage M13mpl 8 vector. The complete DNA sequences from three independent recombinant clones were determined by using the Sequenase version 2.0 kit (United State Biomedical, Cleveland). Sequencing primers used were JC-1, JC-4, and JC-6 (Table 1). PCR-SSCP analysis of the PrP gene mutation was performed according to the methods of Orita et al. (1989) with slight modifications. The sequences of the PCR primer pairs (JC- l/JC-4, JC-5/JC-2, and JC-3/JC-6) and their corresponding amplified DNA fragments (fragment B, C, and D, respectively) were shown in Table 1. PCR reactions were performed in 50 PI reaction volumes containing 500 ng of genomic DNA, 20 pmol of each primer, 20 KM of each dNTP, 2 I-Llof [CX-35S] dATP ( > 1000 Ci/mmol, 10 mCi/ml; Amersham), and 2 units of DynazymeTM.Cycle conditions were the same as described above. Five microIiters of each PCR product were mixed with 5 W1 of loading buffer (96Yc formamide, 20 mM EDTA, 0.0570 bromophenol blue and 0.0570 xylene cyanol). The mixture was heated at 95°C for 10 min followed by cooling on ice. An aliquot of 5 I-L]of preparations was immediately applied to a 692 non-denaturing polyacrylamide gel containing 10’7oglycerol. Electrophoresis was performed at 30 W for 2–4 h at 4°C. Finally, the gel was dried and exposed to X-ray film for 12– 16 h with an intensifying screen.

3. Results The coding region of the PrP gene from this Chinese family was analyzed by the PCR-SSCP method. PCRamplified regions and their sizes of products were shown in Table 1. No abnormal pattern of the PCR fragments B and D were detected in either the specimens from healthy individuals or in those from patient with CJD. However, in mother (I-2) and the second son (II-3), the fragment C revealed frequent alteration in the electrophoretic mobility of single strand DNA compared with the normal controls (Fig. 2B). We next performed DNA sequence analysis to confirm the existence of the mutation in the PCR-amplified products and used SSCP technique to examine the nature of the mutation. The results revealed that the altered conformation of single-strand DNA (fragment C) and its electrophoretic mobility was caused by a single nucleotide change from G to A (Fig. 3) leading to an amino acid alteration from valine to isoleucine at PrP gene codon 210

CJ D

Normal

Fig. 3. DNA sequencing of PCR amplified fragment C of CJD (mother and son) and normal control shows amino acid substitution (PrP codon 210, GTT– > ATT: Val– > Ile) as indicated by arrow.

W.-C. Shyu et al. /Journal of the Neurological Sciences 143 (1996) 176–180

(21OG -> 21OA). This codon mutation was found in both the patient and her second son. This point mutation does not create or delete any restriction enzyme cutting site that can be used for alternative detection of this change by RFLP. Furthermore, we tested homozygously for methionine at codon 129, and no mutation was observed. In addition, no deletions or insertions occurred between codon 51 and codon 91. 4. Discussion The pedigree of the Chinese family with CJD-affected patient is ~hown in Fig. 2. All members of the family have lived in Taiwan for generations while the parents and grandparents of the CJD-affected patient live in mainland China. Therefore, the clinical examinations of the parents and grandparents of the patient were impossible due to the geographical separation. We have presented a case of CJD patient from a Chinese family carrying a point mutation at codon 210 (GTT to ATT) of the PrP gene. This is the first known Chinese case of CJD in the family with PrP gene mutation. The affected woman has a notably earlier age of onset (48 y/o), presenting as insidious memory loss and myoclonus, a long duration of illness (24 months up to now), and the presence of periodic synchronized discharge in the electro-encephalogram (EEG). These clinical features are almost identical to those of CJD178AS” patients except for the periodic synchronized discharge in EEG (Goldfarb et al., 1992). Pocchiari et al. (1993) and Ripoll et al. (1993) reported that patients with CJD21011e showed an early age of onset but a short duration of illness (3.5 and 5 month’s duration, respectively). On the other hand, those with CJD200Lyshad an old age of onset with myoclonus or typical EEG findings. Therefore, these findings agree with the hypothesis that alteration in the primary structures of PrP results in the clinical and pathological features of priori disease (Kitamoto et al., 1992). Recently it has been reported that the appearance of Alzheimer’s disease is caused by amino acid substitution of valine to isoleucine in the ~-amyloid precursor protein ((3-APP) (Yoshioka et al., 1991). Although the codon 210 mutation produces a conservative amino acid change, this result reinforces the pathological significance of the codon 210 mutation in the formation of amyloid-like protein. The possibility of lack of the familial history of CJD is incomplete penetrance. The penetration quotient for the mutation at codon 200 seems to be less than 1007o (Brown et al., ]992a), which probably explains the phenomenon of skipped generation in codon 21011’families. Incomplete penetrance may also explain the occurrence of apparently sporadic cases (Su et al., 1993). The present patient is an apparently sporadic CJD case, but presymptomatic evaluation of her family member confirms the familial tendency. Nevertheless, more extensive genealogical investigations of other familial members are needed.

179

The involvement of the white matter degeneration was found in the CJD-affected woman using MRI approach. MRI is a more sensitive method than CT scans in the study of the white matter changes. The white matter degeneration usually spared the subcortical U-fiber in some causes of dementia including vascular factor, neurodegenerative disease and normal aging. Uchino et al. demonstrated that definite white matter degeneration with subcortical U-fiber involvement in patient with CJD was observed in high-field MRI (Uchino et al., 1991). Furthermore, according to the clinical examination and laboratory findings, we would rule out the diagnosis of leukodystrophy and subcortical familial sclerosis in our patient. MRI analysis of this woman patient showed hypointensity signal changes in basal ganglia and thalamus in serial follow-up studies. Although some reports had demonstrated the similiar findings in Halervorden-Spatz disease and Parkinson’s disease, it was previously undescribed in priori dementia patients. Indeed, increased iron deposition, shown by Perl’s stain, and absences of peaks of cr, cho and NAA in MRS were considered to develop after direct neuron cell injury (Cross et al., 1990). Mizutani et al. (1981) found that primary involvement of white matter with severe brain atrophy in CJD patient would demonstrate a longer clinical course. As a group, these cases were characterized by a higher family representation, a younger age at onset, and lower frequency of myoclonus and periodic EEG activity (Brown et al., 1984). Here, we presented a CJD with a mutation at codon 210 of PrP gene, a longer clinical course, and severe white matter degeneration without any neuronal activity in MRI/MRS. However, few reports discussed about the relationship between PrP gene and primary involvement of white matter in CJD patients. Inoue et al. reported a CJD case with a mutation at codon 200 (Inoue et al., 1994). The postmortem pathological examination of her aunt showed severe white matter degeneration with negative immunostaining of anti-PrP plaque. The total course of her illness was 9 months. Therefore, some controversial issues need further clinical and molecular investigations to clarify their relationships. The demonstration of pathogenic mutations in inherited neuro-degenerative and other diseases allows presymptomatic and prenatal diagnosis without the limitations of linked genetic markers that apply. The implications of presymptomatic diagnosis of priori disease are similar to those of high risk prediction in Huntigton’s disease. It is essential that individuals undergoing testing receive both extensive genetic counselings before the procedure and adequate follow-up afterward. Many coding alterations of PrP gene such as deletion and insertion have been found in inherited priori disease. Point mutation is the major pathogenic mutation among them. Therefore, the simple, fast and efficient method of PCR combined with SSCP technique is used to detect these nucleotide sequence polymorphisms.

180

W.-C. Shyu et al,/Journal qf the Neurological Sciences 143 (1996) 176–180

References Beckman JM, Kingsbury DT, McKinley MP, Bendheim PE, Prusiner SB. Creutzfeldt-Jakob disease: priori protein in human brain. N Engl J Med 1985; 312: 73–78. Brown P, Rodgers-Johnson P, Cathala F, Gibbs CJ, Gajdusek DC. Creutzfeldt-Jakob disease of long duration: clinicopathological characteristics, transmissibility, and differential diagnosis. Ann Neurol 1984; 16: 295–304, Brown P, Cathala F, Castaigne P, Gajdusek DC. Creutzfeldt-Jakob disease: clinical analysis of a conservative series of 230 neuropathologically verified cases. Ann Neurol 1986; 20: 597–602. Brown P, Galvez S, Goldfarb LG, Nieto A, Cartier L, Gibbs CJ, Gajdusek DC. Familial Creutzfeldt-Jakob disease in Chile is associated with codon 200 mutation of the PRNP amyloid precursor gene on chromsome 20. J Neurol Sci 1992a; 112: 65–67. Brown P, Goldfarb LG, Kovanen J, Haltia M, Cathala F, Sulima M, Gibbs CJ, Gajdusek DC. Phenotypic characteristics of familial Creutzfeldt-Jakob disease associated with codon 178‘s” PRNP mutation. Ann Neurol 1992b; 31: 282–285. Cross PA, Atalas SW, Grossman RI. MR evaluation of brain iron in children with cerebral infarction. AJNR 1990; 1I: 341–348. Chapman J, Brown P, Goldfarb LG, Arlazoroff A, Gajdusek DC, Korczyn AD. Clinical heterogeneity and unusual presentations of Creutzfeldt-Jakob disease in Jewish patients with the PRNP codon 200 mutation. J Neurol Neurosurg Psychiatry 1993; 46: 621-623. Goldfarb LG, Brown P, McCombie WR, Goldgaber D, Swergold GD, Wills PR, Cervenakova L, Baron H, Gibbs CJ, Gajdusek DC. Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene. Proc Natl Acad Sci USA 1991; 88: 10926–10930. Goldfarb LG, Brown P, Haltia M, Cathala F, McCombie WR, Kovanen J, Cervenakova L, Goldin L, Nieto A, Godec MS, Asher DM, Gajdusek DC. Creutzfeldt-Jakob disease cosegregates with the codon 178A’n PRNP mutation in families of European origin. Ann Neurol 1992; 31: 274–281.

Inoue I, Kitamoto T, Doh-Ura K, Shii H, Goto I, Tateishi J. Japanese family with Creutafeldt-Jakob disease with codon 200 point mutation of the priori protein gene. Neurology 1994; 44: 299–301. Kretzschmar HA, Stowring LE, Westaway D, Stubblebine WH, Prusiner SB, Dearmond SJ. Molecular cloning of a human priori protein cDNA. DNA 1986; 5: 3 15–324. Kitamoto T, Doh-Ura K, Muramoto T, Miyazono M, Tateishi J. The primary structure of the priori protein influence the distribution of abnormal priori protein in the central nervous system. Am J Pathol 1992; 141: 271–277, Mizutani T, Okumura A, Oda M, Shiraki H. Panencephalitic type of Creutzfeldt-Jakob disease: primary involvement of the cerebral white matter. J Neurol Neurosurg Psychiatry 1981; 44: 103–1 15. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutation and DNA polymorphism using the polymerase chain reaction. Genomics 1989; 5: 874–879. Pocchiari M, Salvatore M, Cutruzzolia F, Genuardi M, Allocatelli CT, Masullo C, Macchi G, Alema G, Galgani S, Xi YG, Petraroli R, Silvestrini MC, Brunori M. A new point mutation of priori protein gene in Creutzfeldt-Jakob disease. Ann Neurol 1993; 34: 802–807. Ripoll L, Laplanche JL, Salzmann M, Jouvet A, Planques B, Dussaucy M, Chatelain J, Beaudry P, Launay JM. A new point mutation in the priori protein at codon 210 in Creutzfeldt-Jakob disease. Neurology 1993; 43: 1934-1938. Su MS, Wang SJ, Chiang H, Wang JS, Tan YA, Fuh JL, Liu HC. Creutzfeldt-Jakob disease: report of a case of panencephalytic type and experience of a teaching hospital in Taiwan. Eur Neurol 1993; 33: 241-243. Uchino A, Yoshinaga M, Shiokama O, Hata H, Ohno M. Serial MR imaging in Creutzfeldt-Jakob disease. Neuroradiology 1991; 33: 364– 367. Yoshioka K, Miki T, Katsuya T, Ogihara T, Sakaki Y. The 7[7Val-Ile in amyloid precursor protein is associated with familial Alzheimer’s disease regardless of ethnic groups. Biochem Biophys Res Commun 1991; 178: 1141–1146.