Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration

Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration

Biochemical and Biophysical Research Communications xxx (xxxx) xxx Contents lists available at ScienceDirect Biochemical and Biophysical Research Co...

1MB Sizes 0 Downloads 1 Views

Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration Yasuyuki Momoi a, Akihiko Nishikimi a, Guangwei Du b, Tohru Kataoka c, Koko Katagiri a, * a

Department of Biosciences, School of Science, Kitasato University, 1-15-1 Kitasato, Minamiku, Sagamihara, Kanagawa, 252-0337, Japan Department of Integrative Biology & Pharmacology, University of Texas Health Science at Houston 6431 Fannin St, Houston, TX, 77030, USA c Division of Molecular Biology, Department of Biochemistry and Molecular Biology, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe, 650-0017, Japan b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 December 2019 Accepted 15 January 2020 Available online xxx

Integrin activation by Rap1-GTP is pivotal for lymphocyte trafficking. In this study, we show the phosphatidic acid (PA)-dependent membrane distribution of RA-GEF-1 and -2 (also known as Rapgef2 and 6), which are guanine nucleotide exchange factors for Rap1, plays important roles in lymphocyte migration. RA-GEF-1 associates with PA through 919e967 aa within CDC25 homology domain, and the deletion of this region of RA-GEF-1 inhibits chemokine-dependent migration. Chemokine stimulation induces temporal production of PA on the plasma membrane, which is not necessary for Rap1 activation, but the translocation of RA-GEFs. Thus, chemokine-dependent generation of PA is critical for lymphocyte migration through membrane localization of RA-GEFs. © 2020 Elsevier Inc. All rights reserved.

Keywords: Rap1 RA-GEF Lymphocyte Phosohatidic acid Migration Chemokine

1. Introduction Chemokine signaling coupled with Gai proteins activates leukocyte function associated-1 (LFA-1), a major integrin that mediates homing of lymphocytes to peripheral lymph nodes. In a previous study, we show that Rap1, which is rapidly activated by chemokines, is indispensable for LFA-1-dependent adhesion and migration of lymphocytes [1,2]. The RAPL (regulator of adhesion and cell polarization enriched in lymphoid tissues)-Mst1/2 (Mst)(mammalian Ste-20 like protein kinase) complex, downstream effectors of Rap1 are involved in Rap1-GTP-mediated migration [3,4]. Conversion between GTP- and GDP-bound states is controlled by guanine nucleotide exchange factors (GEFs) and GTPaseactivating proteins (GAP)s [5]. In particular, GEFs enhance the formation of the GTP-bound active conformation in response to upstream signals mediated by cell surface receptors such as

Abbreviations: (RA-GEF), Ras/Rap association-guanine nucleotide exchange factor; RA-GEF-1, (also termed PDZ-GEF1, Rapgef2); RA-GEF-2, (also termed PDZGEF2, Rapgef6). * Corresponding author. 1-15-1 Kitazato, minamiku, Sagamihara, Kanagawa, 2520344, Japan. E-mail address: [email protected] (K. Katagiri).

chemokine receptor. To date, various GEFs for Rap1 have been identified in mammalian cells [5]. RA-GEF-1 (also termed PDZGEF1 or Rapgef2) and RA-GEF-2 (also termed PDZ-GEF2 or Rapgef6) contains putative CNB (cyclic nucleotide-binding), REM (Ras exchange motif), PDZ (Postsynaptic density 95, PSD-95; Discs large, Dlg; Zonula occludens-1, ZO-1), and RA (Ras/Rap association) domains as well as the GEF catalytic domain [6e8]. Previous reports demonstrate that no specific cAMP/cGMP, apart from phosphatidic acid (PA) binds RA-GEFs [9]. PA has essential signaling roles, and is produced by several enzymes including phospholipase D (PLD) and DAG kinase (DGK) [10]. It has been proposed that the activation of PA-generating enzymes by external stimuli affects cell proliferation, survival, and migration. Fluorescently tagged protein domains that bind specifically to certain lipids have greatly advanced our understanding of dynamics and functions of PA [11]. Recent studies using a newly developed PA biosensor, phosphatidic biosensor with superior sensitivity (PASS), demonstrated that PA was generated at the plasma membrane by PLD2 in the presence of epidermal growth factor [12]. PLD2 has been proven to be mainly located at the plasma membrane using a mouse PLD2-specific monoclonal antibody [13]. PASS enables us to examine the role of PA during the dynamic changes of RA-GEF localization after chemokine stimulation. Here, we show that GPCR-dependent signaling induces PA

https://doi.org/10.1016/j.bbrc.2020.01.080 0006-291X/© 2020 Elsevier Inc. All rights reserved.

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

2

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

synthesis, and rapid recruitment of RA-GEFs to the plasma membrane through their binding to PA, which is critical for lymphocyte migration. 2. Materials and methods 2.1. Cell lines BAF-LFA1 cells (Ba/F3 cells expressing human LFA-1) has been described [14]. BAF-LFA1 cells have not been authenticated since fingerprint for Ba/F3 cells is not publicly available. HEK293T cells (RIKEN BRC, RCB2202; not independently authenticated) was cultured in DMEM supplemented with 10% fetal bovine serum and penicillin/streptomycin. All cell lines were tested for mycoplasma contamination by 4’,6-diamidino-2-phenylindole (DAPI) staining with negative results.

lentiviral vectors carrying GFP-PASS and RFP-PASS were subcloned into pCDH-CMV-MCS and pCDH-CMV-MCS-EF1-Puro (System Biosciences, Mountain View, CA), respectively. RA-GEF-2 transferred to a pFN21A vector was purchased from Kazusa. RA-GEF-2 cDNA was as subcloned into a pcDNA-flag vector. We mutated RA-GEF-2 by a single point replacement of serine with alanine at positions 1361 and 1365 using the KOD-Plus-mutagenesis kit (TOYOBO), and subcloned into pcDNA3.1-flag. The fidelity of all constructs were verified by sequencing. 2.4. Immunoprecipitation and immunoblot analysis HEK293T cells and BAF cells, or mouse T lymphocytes were lysed in buffer (1% Nonidet P-40, 150 mM NaCl, 25 mM Tris-HCl [pH 7.4], 10% glycerol, 2 mM MgCl2, 1 mM phenylmethylsulfonylfluoride, 1 mM leupeptin, and 0.1 mM aprotinin). Cell lysates were subjected to immunoblotting [1].

2.2. Antibodies and reagents 2.5. Pull-down assays Fluorescence-conjugated anti-RFP (MBL), anti-Rap1 (BD Biosciences), anti-flag (Wako), anti-Halo (Promega), b-actin and peroxidase-conjugated goat anti-rat, rabbit or -mouse IgG (Cell Signaling) were used for immunoblotting (1:1000). Mouse CXCL12 was purchased from R&D Systems. 1e2 mM CAY10594 (PLD2 inhibitor) (Cayman Chemical) was used for examination of their roles in chemokine-dependent translocation of RA-GEFs. N-((4-(4,4difluoro-5-(2-thienl)-4-bora-3a,4a-diaza-s-indacene-3-yl) phenoxy) acetyl) sphingosine (BODIPY TR ceramide) and CellMask Deep Red Plasma membrane stain (Invitrogen) were used for staining of the golgi complex and plasma membrane.

Rap1-GTP was pulled down with a glutathione S-transferase (GST)-RBD of RalGDS fusion protein, respectively [15]. Briefly, 107 cells were lysed in ice-cold lysis buffer (1% Triton X-100, 50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 10 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 1 mM leupeptin, and 0.5 mM aprotinin) and incubated for 1 h at 4  C with GST-fusion proteins coupled to glutathione agarose beads. The beads were washed three times with lysis buffer and subjected to immunoblot analysis using an anti-Rap1 antibody. Immunoblotting of total cell lysates (5  104 cells) was also performed.

2.3. DNA constructs and transfection

2.6. Lymphocyte migration on ICAM-1

The cDNA encoding mouse RA-GEF-1 was amplified by PCR using the following primers (restriction sites are underlined): forward 50 ggaattcgaaatggctttccttgtgcg-30 and reverse 50 -tagcggccgccaaacagcagacacttgttc-3’. The amplified cDNA was subcloned into a pcDNA-flag vector. Deletion mutants of RA-GEF-1 were generated from a pcDNARA-GEF-1-FLAG construct using inverse PCR. The following oligonucleotides and their corresponding complimentary strands were used. For deletion of PDZ domain (residues 383e468): 50 -gctaaagccaaacgaagaaaagaacttctgacgaga-3’. For deletion of RA domain (residues 606e697): 50 -actcctgacttgccagatgaaacgctttgctcagat-3’. For deletion of GEF domain (residues 714e966): 50 -agccaaatctccctccttaatgccaaaaagctgtat-3’. For deletion of amino acids 847e918: 50 ctgtttgatccttccagattcaggactcggaagaag-3’. For deletion of amino acids 919e967: 50 - atggaccctgcccttatggatgcccagatggctcgg-3’. For deletion of C-terminal region (967e1494): 50 -aatgccaaaaagctgtattggc ggccgctcgaggac-3’. To generate expression constructs of PDZ, RA, and GEF domain, we amplified each domain by PCR and subcloned into BamHI/EcoRI site of pcDNA-GFP vector. The primers used were as follows: PDZ domain, forward 50 - gcggatcctgtgcagctaaagccaaacg-30 and reverse 50 -ggaattcttaagacaatctcgtcagaagtt-3’; RA domain, forward 50 -gcggatcccctgacttgctgcagtcaca-30 and reverse 50 -ggaattcttaatctgagcaaagcgtttctg-3’; CDC25-HD domain, forward 50 gcggatcccgagagagccaaatctccct-30 and reverse 50 -ggaattcttaaggattcttgggcaatgtgc-3’. Wild-type RA-GEF-1 cDNA was fused to GFP or mCherry. An enhanced green fluorescent protein-PA biosensor with superior sensitivity (EGFP-PASS) was generated as previously described [12]. A nuclear export sequence (NES) derived from protein kinase A inhibitor a (PKI-a) was added between EGFP and Spo20-PABD (PA-binding domain) cloned into pEGFP-C1. PASS tagged with monomeric GFP or RFP (mGFP or mRFP) was generated by replacing EGFP in the EGFP-PASS with mGFP and mRFP. The

Migration on ICAM-1 was performed as previously described using a DT dish (Bioptecs Inc.) with immobilized recombinant human or mouse ICAM-1Fc (0.5 mg/ml) [4]. A total of 2  105 cells were loaded onto the ICAM-1-coated dish. Phase-contrast images were obtained using an Olympus Plan Fluor DL 10  /0.3NA objective every 15 s for 10e15 min at 37  C using a heated stage for DT dishes (Bioptechs Inc.). The frame-by-frame displacements and lymphocyte velocities were calculated by automatically tracking individual cells using MetaMorph software (Molecular Devices). In each field, 50 randomly selected cells were manually tracked to measure the median velocity and displacement from the starting point. 2.7. Confocal microscopy and time-lapse imaging Non-adherent cells incubated with or without chemokine were fixed in suspension and immobilized on poly-L-lysineecoated slides before staining. Confocal images (TCS, SP8, Leica) were obtained using a 63  objective lens [16]. Time-lapse confocal images were also obtained in multitrack mode. Line profiles of the confocal images were obtained with ImagePro software (MediaCybernetics). 2.8. Lipid binding assay Lipids (a mixture of phosphatidylcholine, phosphatidylethanolamine and phosphatidic acid) were incubated in TBS (20 mM Tris-HCl, 0.15 M NaCl, pH 7.5) at 37  C for 30 min followed by vigorous vortexing for 10 min [17]. The liposomes were precipitated at 18,000g for 10 min and washed twice with ice-cold TBS. HEK293T cells transfected with the specified plasmid DNAs were suspended in 0.5 ml of extraction buffer (TBS supplemented with 1 mM EDTA, 1 mM PMSF, and 0.005% NP-40) and sonicated on ice. Insoluble debris was removed by centrifugation at 18,000 x g

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

for 5 min at 4  C. The lysate (100 ml) was diluted with the extraction buffer to make 1 ml of solution and mixed with liposomes (200 mg). The mixture was incubated for 2 h at 4  C and washed twice with ice-cold extraction buffer followed by centrifugation at 18,000 g at 4  C. The binding proteins were immunoblotted using anti-flag antibody. In some experiments, protein-lipid interaction was analyzed using PIP beads (Echelon Biosciences). The cell extract was mixed with PIP beads in the presence of 0.25% NP-40 and incubated for 2 h at 4  C under rotary agitation. The beads were washed with the extraction buffer containing 0.25% NP-40 three times and subjected to immunoblotting.

2.9. Measurement of cellular PA BAF/LFA-1 cells were metabolically labeled with [32P] orthophosphate (3.7 mBq/ml) by incubating in modified Krebs Ringer buffer (10 mM HEPES, 136 mM NaCl, 5 mM KCl, 5.5 mM glucose, 1 mM CaCl2, 0.1% BSA). Labeled cells were stimulated with CXCL12 for the indicated times. Phospholipids were extracted and

3

separated by thin layer chromatography as described previously [18]. After separation, phospholipids were visualized with a BAS1800 bioimaging analyzer.

2.10. Generation of RA-GEF-1-deficient BAF cells by the CRISPR/ Cas9 system The guide sequence ‘TGTAGCATCACCAGCGACTC’ targeting Exon2 of the mouse RA-GEF-1 gene was cloned into pX330 (Addgene #42230). pCAG-EGxxFP was used to examine efficiency of the target DNA cleavage by the guide sequence and Cas9 activity. The resultant guide sequence was cloned into GFP expressing plasmid DNA pX458 (Addgene #48138). The pX458 plasmid was transfected into BAF cells. 24 h after transfection, cells were sorted GFP-high population, followed by limiting dilution. Expression of full length RA-GEF-1 protein in each isolated clone was tested by immunoblotting with anti-RA-GEF-1 antibody (Novusbio NBP106549) The sequence of the primer used were as follows: RAGEF-1 Exon2, Forward: 50 - ccGGATCCcattttgtgacttgggttaatag -30

Fig. 1. PA binding directly to RA-GEF-1 and RA-GEF-2. (A) RA-GEF-1 binds to PA through the CDC25-HD. (Top) Domain architecture of RA-GEF-1. CNB-L, cyclic nucleotide bindinglike; REM, Ras exchange motif; PDZ, PSD95, DlgA, Zo-1; RA, Ras/Rap association; CDC25-HD, CDC25 homology domain: C, C-terminal region. (Bottom, left) Extracts from HEK293T cells expressing flag tagged RA-GEF-1-WT or its deletion mutants were pulled down (PD) with PA-containing lipid vesicles. A representative of three independent experiments is shown (Bottom, right) Glutathione S-transferase (GST) fusion proteins encoding each domain of RA-GEF-1-WT were pulled down with PA-containing lipid vesicles. The ability to bind to PA was assayed for each indicated domain of RA-GEF-1-WT. A representative of three independent experiments is shown. (B) RA-GEF-1 does not bind PI. The extracts from HEK293T cells expressing flag-tagged RA-GEF-1-WT was pulled down with phosphatidyl inositol (PI)-containing lipid vesicles. The extracts from HEK293T cells was pulled down with PIP-, PIP2- or PIP3-containing lipid vesicles. (C) Extract from HEK293T cells expressing Halo-tagged RA-GEF-2-WT was pulled down with PA-containing lipid vesicles. A representative of three independent experiments is shown. (D) (Left) Extracts from HEK293T cells expressing GFP-tagged RA-GEF-1-WT,919e967 or CDC25-HD mutant were pulled down with PA-containing lipid vesicles (Right) GTP-bound Rap1 was analyzed by a pull-down assay using GST-Ral-GDSRBD. HEK293T cells expressing GFP-tagged RA-GEF-1-WT, 919e967 or CDC25-HD mutant were lysed and subjected to the pull-down assay. Bound Rap1 and total Rap1 were detected by immunoblotting with an anti-Rap1 antibody.

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

4

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Fig. 2. The association of RA-GEF-1 with PA is required for cell migration. (A) (Top) Systematic overview of the gene targeting strategy. Position of the single guide RNA target site of exon 2 is indicated by an underline. (Bottom)(Left) Immunoblot with anti-RA-GEF-1 of total cell lysates from control or the knockout cells via CRISPR/Cas9-mediated genome editing is shown. (Bottom)(Right) GTP-bound Rap1 was analyzed by a pull-down assay using GST-Ral-GDS-RBD. Control or the knockout cells were stimulated with CXCL12 for the indicated times. (B) (Top) Immunoblot with anti-RA-GEF-1 of total cell lysates from control, knockout cells (), which were overexpressed with wild-type (WT) or D919e967 RA-GEF-1. (Middle) Displacement of control, knockout (), WT or D919e967 RA-GEF-1expressing knockout cells were measured on ICAM-1 in the presence or absence of CXCL12. *1P < 0.001 versus control cells, *2P < 0.001 versus the knockout cells, *3P < 0.001 versus WT RA-GEF-1-expressing knockout cells. (Bottom) Representative tracks of knockout cells (), wild-type (WT) or D919e967 RA-GEF-1- expressing knockout cells on the ICAM-1 in the presence of CXCL12 are shown. Each. line represents a single-cell track. Each bar graph represents the means ± SEM.

Fig. 3. Chemokine stimulation-dependent PA production is not involved in Rap1 activation. (A) (Left) An autoradiograph of thin layer chromatography. 32P-labeled BAF/ LFA-1 cells were stimulated with CXCL12 for the indicated times. Phospholipids were. extracted and separated on the TLC pate. Arrow indicates the spots corresponding to PA. (Right) Results are expressed as the fold-increase of PA (%) taking the control values as 1. (B) GTP-bound Rap1 was analyzed by a pull-down assay using GST-Ral-GDS-RBD. Mouse T cells treated with or without CAY10593 were stimulated with 100 nM of CCL21 at the indicated times, lysed and subjected to the pull-down assay. Bound Rap1 and total Rap1 were detected by immunoblotting with an anti-Rap1 antibody. (C) Distribution of RA-GEF-1 and PASS before or after CXCL12 stimulation. Series of Z-stack images of CXCL12-stimulated cells at 1.5-㎛ intervals from the glass surface are shown. Scale bar, 5 ㎛.

Exon 2 of RA-GEF-1 from edited clones was PCR amplified and verified by sequencing.

2.11. Statistical analysis and Reverse: 50 - ccGAATTCctggtaacagcgcagccgtag -3’. Exon2 of RAGEF-1 guide sequence: Forward: 50 - CACCTGTAGCATCACCAGCGACTC -30 and Reverse: 5’ e AAACGAGTCGCTGGTGATGCTACA -3’.

Statistical analysis was performed using two-tailed Student’s ttest. P values less than 0.05 were considered significant.

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

3. Results 3.1. RA-GEFs bind to PA, which is necessary for LFA-1/ICAM-1dependent migration A previous study suggests that PA is generated through the hydrolysis of phosphatidylcholine by PLD in response to chemokines [19]. Since in Rap1GEFs, RA-GEF-1 was reported to bind PA [9], we examined the interaction of RA-GEF-1 with phospholipids such as PA, phosphatidylinositol 4-monophosphate (PIP), phosphatidylinositol 4,5-diphosphate (PIP2) and phosphatidylinositol 3,4,5-triphosphate (PIP3). Although no binding was found when HEK293T cell lysates containing flag-RA-GEF-1 were incubated with lipid vesicles composed solely of phosphatidylcholine and phosphatidylethanolamine, RA-GEF-1 bound to PA-containing vesicles (Fig. 1A). PIP, PIP2 and PIP3 did not bind RA-GEF-1 (Fig. 1B). As shown in Fig. 1A, the PA binding was almost totally abolished by deleting the CDC (cell division cycle) 25 homology domain (CDC25-HD), which includes GEF catalytic domain. Consistently, the CDC25-HD of RA-GEF-1 interacted directly and selectively with PA in a concentration dependent manner (Fig. 1A). RA-GEF-2 also bound to PA-containing vesicles in a concentration dependent manner (Fig. 1C). Although DCDC25-HD of RA-GEF-1 reduced GEF activity for Rap1, deletion of amino acids 919e967 (D919-967) within CDC25-HD of RA-GEF-1 mostly reduced the association with PA, which did not affect Rap1 activation (Fig. 1D). These results suggest that PA functions as a lipid anchor by binding directly to RA-GEF-1. To examine whether the binding of PA with RA-GEF-1 is involved in the promotion of cell migration, we knocked out RAGEF-1 in BAF/LFA-1 cells using CRISPR/Cas9-mediated genome editing, and introduced wild-type or D919-967 mutant of RA-GEF-1 into the knockout cells. As shown in Fig. 2A, endogenous protein expression of RA-GEF-1 was abolished in clonal cell line generated by using a single-guide targeting exon 2 of RA-GEF-1. In the knockout cells, chemokine-dependent Rap1 activation was reduced to less than 30% of control cells (Fig. 2A), although RA-GEF-2 and another Rap1GEF might compensate for a loss of RA-GEF-1. Migration of RA-GEF-1-knockout cells on ICAM-1 was severely impaired (Fig. 2B). The expression of exogenous WT RA-GEF-1 rescued impaired migration of the knockout cells, whereas overexpression of D919-967 mutant of RA-GEF-1 failed to recover it (Fig. 2B). These results suggest that PA plays important role in cell migration through the binding with RA-GEFs. As shown in Fig. 3A, we confirmed PA was increased 1e3 min at the peak after the stimulation. We examined the role of PA on GEF activity against Rap1 of RA-GEFs using CAY10593. CAY10593 did not inhibit Rap1 activation in BAF cells after stimulation with chemokine (Fig. 3B). These results indicate that the interaction of PA and RA-GEFs is not involved in chemokine-dependent increase of GEF activity to Rap1. Next, we explored whether PA generation is critical for subcellular localization of RA-GEF-1. As shown in Fig. 3C, RA-GEF-1 and PASS were co-localized at the distinct region of plasma membrane in chemokine-stimulated cells, although they were present at discrete sites in unstimulated cells, suggesting that PA defines the redistribution of RA-GEFs at the plasma membrane after the stimulation. 3.2. PA-dependent translocation of RA-GEFs to the plasma membrane after chemokine stimulation To clarify RA-GEF-1 translocates to the plasma membrane in PAdependent manner with chemokine stimulation, we examined

5

whether subcellular localization of RA-GEF-1 is influenced by CAY10594 and deletion of PA-binding domain. To this ends, we introduced GFP-fusion protein of WT, DCDC25-HD or D919-967 RAGEF-1 into BAF/LFA-1 cells (Fig. 4A). We used BODIPY TR ceramide as a marker of the golgi complex and CellMask Deep Red Plasma membrane stain as the plasma membrane (Fig. 4A). WT RA-GEF-1 was mainly located at the perinuclear region in unstimulated cells, and translocated to the plasma membrane with CXCL12 stimulation (Fig. 4A). Treatment with CAY10594 had little effect on the perinuclear localization of RA-GEF-1 in unstimulated cells, but suppressed its translocation to the plasma membrane (Fig. 4A). D919-967 or DCDC25-HD mutants of RA-GEF-1 also demonstrated defective recruitment to the plasma membrane after CXCL12 stimulation (Fig. 4A). RA-GEF-2 also translocated to the plasma membrane with CXCL12 stimulation in PA-dependent manner (Fig. 4B). These data suggest that PA is required for the translocation of RA-GEFs to the plasma membrane. 4. Discussion In this study, we demonstrate that PA production by PLDs play an important role in chemokine-stimulated cell migration by regulating the distribution of RA-GEFs. Furthermore, we found that the interaction RA-GEFs with PA regulates the translocation of RA-GEFs to the plasma membrane, but not control the GEF activity of RA-GEFs. These results suggest that PA-dependent RAGEFs localization is critical for the directional movement of T cells. PA is the product of phosphatidylcholine hydrolysis by activating phospholipases D 1 and 2 with chemokine stimulation. PLDs are reported to play important roles in the adhesion and migration of phagocytes such as macrophages [20,21]. Although Type I phosphatidylinositol-4-phosphate 5-kinase and Arp3 are suggested to be activated by PA and induce actin reorganization or nucleation [22,23], regulatory mechanisms of PLDs in cell adhesion are not fully elucidated. In lymphocytes, PA is produced on the plasma membrane by chemokine stimulation, and associates with RA-GEFs to influence their translocation to the plasma membrane. Thus, PA is critical for Rap1-GTP conversion on the plasma membrane, and facilitates lymphocyte migration in cooperation with the regulation of actin cytoskeletal dynamics. In this paper, we show that RA-GEFs are major Rap1GEFs. However, approximately 30% of Rap1 activation was remaining in RA-GEF-1-deficient BAF cells via GPCR-mediated signaling. In addition to RA-GEF-2, Abl-crk pathway might compensate for Rap1 activation through C3G in RA-GEF-1-deficient cells [24e26]. Intriguingly, DCDC25-HD RA-GEF-1 did not move to the plasma membrane, but was also diffusely distributed in the cytoplasm in unstimulated cells. Wild-type RA-GEF-1 was accumulated at the perinuclear region, and treatment with CAY10594 inhibited the translocation of wild-type RA-GEF-1, but did not affect its perinuclear localization in unstimulated cells. CDC25-HD region might include the domain necessary for the localization of RA-GEF-1 in the intracellular membrane such as endosomes or vesicles. This present study sheds new light on the role of phosphatidic acid in lymphocyte migration. Previous our reports demonstrated that deficiency of Rap1 or downstream effectors of Rap1, RAPL and Mst1 lead to the development of autoimmune diseases [27e29]. Regulation of Rap1 activation by chemotactic factors is essential for prevention of lymphopenia to induce homeostatic proliferation in lymph nodes. In this study, restricted control of localization of RAGEFs might be an important mechanism to regulate immune responses in vivo and prevent autoimmune diseases.

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

6

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

Fig. 4. The distribution of RA-GEFs at the plasma membrane is dependent on PA. (A) (Top, Left) Immunoblots with anti-GFP of total cell lysates from BAF cells transfected with wildtype, DCDC25-HD or D919e967 RA-GEF-1-GFP. Actin is a loading control. A representative of three independent experiments is shown. (Right) The frequency of cells showing the accumulation of wild-type, CDC25-HD or D919-967 RA-GEF-1-GFP on the plasma membrane in the presence or absence of CXCL12, with or without CAY10594 (n ¼ 20 cells). Increases of more than fivefold in the staining intensity of RA-GEF-1 on the one side of the membrane compared to the peak value of intensity on the remaining sides of the

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080

Y. Momoi et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx

7

membrane were considered to have polarized distribution of the RA-GEF-1. Each bar graph represents the means ± SEM. *1P < 0.001, *2P < 0.002 versus untreated WT cells. (Bottom) Confocal microscopic analysis of the localization of wild-type or mutants of RA-GEF-1-GFP in BAF cells that were untreated (left) or treated (right) with 100 nM CXCL12 for 5 min in the presence or absence of CAY10594 is shown. BODIPY TR ceramide (red) and CellMask Deep Red Plasma membrane stain (blue) were used as a marker of the golgi complex and the plasma membrane, respectively. DIC, differential interference contrast. Line profiles of RA-GEF-1 intensity along the arrows (XeY, a-b,c-d, e-f) are shown below. The red arrows show the peak of RA-GEF-1 on the plasma membrane, perinuclear region or cytoplasm in this axis. Scale bar, 5 ㎛. (B) (Left)(Top) Immunoblots with anti-GFP of total cell lysates from BAF cells transfected with WT RA-GEF-2-GFP. Actin is a loading control. A representative of three independent experiments is shown. (Left)(Bottom) The frequency of cells showing the accumulation of RA-GEF-2 on the plasma membrane in the presence or absence of CXCL12, with or without CAY10594. Increases of more than fivefold in the staining intensity of RA-GEF-2 on the one side of the membrane compared to the peak value of intensity on the remaining sides were considered to have patches of RA-GEF-2. *P < 0.001 versus CXCL12-stimulated WT cells without CAY10594. (Right top)Confocal microscopic analysis of the localization of WT RA-GEF-2-GFP in BAF cells that were unstimulated or stimulated with 100 nM CXCL12 for 5 min in the presence or absence of CAY10594 is shown. DIC, differential interference contrast. (Right bottom) Line profiles of RA-GEF-2 intensity along the arrows (XeY, a-b, c-d) are shown below. The red arrows show the peak of RA-GEF-2 on the plasma membrane, perinuclear region or cytoplasm in this axis. Scale bar, 5 mm. . (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Author contributions M.Y. and K$K designed, performed experiments, and wrote the paper. A.N. performed the experiments. G.D. and T.K. contributed to the preparation of essential materials and commented on the experiments and paper. Declaration of competing interest The authors declare no conflicts of interest associated with this manuscript. Acknowledgements This work was supported by Japan Society for the Promotion of Science KAKENHI 19K07612, All Kitasato Project study (AKPS), Private University Research Branding Project and R01 grant (HL119478) . References [1] K. Katagiri, M. Hattori, N. Minato, T. Kinashi, Rap1 functions as a key regulator of T-cell and antigen-presenting cell interactions and modulates T-cell responses, Mol. Cell Biol. 22 (2002) 1001e1015. [2] Y. Ebisuno, K. Katagiri, T. Katakai, Y. Ueda, T. Nemoto, H. Inada, J. Nabekura, T. Okada, R. Kannagi, T. Tanaka, M. Miyasaka, N. Hogg, T. Kinashi, Rap1 controls lymphocyte adhesion cascade and interstitial migration within lymph nodes in RAPL-dependent and -independent manners, Blood 115 (2009) 804e814. [3] K. Katagiri, A. Maeda, M. Shimonaka, T. Kinashi, RAPL, a Rap1-binding molecule that mediates Rap1-induced adhesion through spatial regulation of LFA1, Nat. Immunol. 4 (2003) 741e748. [4] K. Katagiri, T. Katakai, Y. Ebisuno, Y. Ueda, T. Okada, T. Kinashi, Mst1 controls lymphocyte trafficking and interstitial motility within lymph nodes, EMBO J. 28 (2009) 1319e1331. [5] M. Gloerich, J.L. Bos, Regulating Rap small G-proteins in time and space, Trends Cell Biol. 21 (2011) 615e623. [6] S.E. Bilasy, T. Satoh, S. Ueda, P. Wei, H. Kanemura, A. Aiba, T. Terashima, T. Kataoka, Dorsal telencephalon-specific RA-GEF-1 knockout mice develop heterotopic cortical mass and commissural fiber defect, Eur. J. Neurosci. 29 (2009) 1994e2008. [7] K. Maeta, H. Edamatsu, K. Nishihara, J. Ikutomo, S.E. Bilasy, T. Kataoka, Crucial role of Rapgef2 and Rapgef6, a family of guanine nucleotide exchange factors for Rap1 small GTPase, in: Formation of Apical Surface Adherens Junctions and Neural Progenitor Development in the Mouse Cerebral Cortex, eNeuro, vol. 3, 2016. [8] Y. Yoshikawa, T. Satoh, T. Tamura, P. Wei, S.E. Bilasy, H. Edamatsu, A. Aiba, K. Katagiri, T. Kinashi, K. Nakao, T. Kataoka, The M-Ras-RA-GEF-2-Rap1 pathway mediates tumor necrosis factor-alpha dependent regulation of integrin activation in splenocytes, Mol. Biol. Cell 18 (2007) 2949e2959. [9] S.V. Consonni, P.M. Brouwer, E.S. van Slobbe, J.L. Bos, The PDZ domain of the guanine nucleotide exchange factor PDZGEF directs binding to phosphatidic acid during brush border formation, PloS One 9 (2014), e98253. [10] J.J. Shin, C.J. Loewen, Putting the pH into phosphatidic acid signaling, BMC Biol. 9 (2011) 85. [11] M. Lu, L.W. Tay, J. He, G. Du, Monitoring phosphatidic acid signaling in breast cancer cells using genetically encoded biosensors, Methods Mol. Biol. 1406

(2016) 225e237. [12] F. Zhang, Z. Wang, M. Lu, Y. Yonekubo, X. Liang, Y. Zhang, P. Wu, Y. Zhou, S. Grinstein, J.F. Hancock, G. Du, Temporal production of the signaling lipid phosphatidic acid by phospholipase D2 determines the output of extracellular signal-regulated kinase signaling in cancer cells, Mol. Cell Biol. 34 (2014) 84e95. [13] G. Du, P. Huang, B.T. Liang, M.A. Frohman, Phospholipase D2 localizes to the plasma membrane and regulates angiotensin II receptor endocytosis, Mol. Biol. Cell 15 (2004) 1024e1030. [14] K. Katagiri, M. Hattori, N. Minato, S. Irie, K. Takatsu, T. Kinashi, Rap1 is a potent activation signal for leukocyte function-associated antigen 1 distinct from protein kinase C and phosphatidylinositol-3-OH kinase, Mol. Cell Biol. 20 (2000) 1956e1969. [15] K. Katagiri, M. Shimonaka, T. Kinashi, Rap1-mediated lymphocyte functionassociated antigen-1 activation by the T cell antigen receptor is dependent on phospholipase C-gamma1, J. Biol. Chem. 279 (2004) 11875e11881. [16] K. Katagiri, M. Imamura, T. Kinashi, Spatiotemporal regulation of the kinase Mst1 by binding protein RAPL is critical for lymphocyte polarity and adhesion, Nat. Immunol. 7 (2006) 919e928. [17] A. Nishikimi, H. Fukuhara, W. Su, T. Hongu, S. Takasuga, H. Mihara, Q. Cao, F. Sanematsu, M. Kanai, H. Hasegawa, Y. Tanaka, M. Shibasaki, Y. Kanaho, T. Sasaki, M.A. Frohman, Y. Fukui, Sequential regulation of DOCK2 dynamics by two phospholipids during neutrophil chemotaxis, Science 324 (2009) 384e387. [18] N. Ninomiya, K. Hazeki, Y. Fukui, T. Seya, T. Okada, O. Hazeki, M. Ui, Involvement of phosphatidylinositol 3-kinase in Fc gamma receptor signaling, J. Biol. Chem. 269 (1994) 22732e22737. [19] A. Montresor, M. Bolomini-Vittori, L. Toffali, B. Rossi, G. Constantin, C. Laudanna, JAK tyrosine kinases promote hierarchical activation of Rho and Rap modules of integrin activation, J. Cell Biol. 203 (2013) 1003e1019. [20] N. Lehman, M. Di Fulvio, N. McCray, I. Campos, F. Tabatabaian, J. GomezCambronero, Phagocyte cell migration is mediated by phospholipases PLD1 and PLD2, Blood 108 (2006) 3564e3572. [21] J. Gomez-Cambronero, M. Di Fulvio, K. Knapek, Understanding phospholipase D (PLD) using leukocytes: PLD involvement in cell adhesion and chemotaxis, J. Leukoc. Biol. 82 (2007) 272e281. [22] A.N. Roach, Z. Wang, P. Wu, F. Zhang, R.B. Chan, Y. Yonekubo, G. Di Paolo, A.A. Gorfe, G. Du, Phosphatidic acid regulation of PIPKI is critical for actin cytoskeletal reorganization, J. Lipid Res. 53 (2012) 2598e2609. [23] F. Speranza, M. Mahankali, K.M. Henkels, J. Gomez-Cambronero, The molecular basis of leukocyte adhesion involving phosphatidic acid and phospholipase D, J. Biol. Chem. 289 (2014) 28885e28897. [24] L.P. Malherbe, D. Wang, Tyrosine kinases EnAbling adaptor molecules for chemokine-induced Rap1 activation in T cells, Sci. Signal. 5 (2012) pe33. [25] J.J. Gu, C.P. Lavau, E. Pugacheva, E.J. Soderblom, M.A. Moseley, A.M. Pendergast, Abl family kinases modulate T cell-mediated inflammation and chemokineinduced migration through the adaptor HEF1 and the GTPase Rap1, Sci. Signal. 5 (2012) ra51. [26] Y. Huang, F. Clarke, M. Karimi, N.H. Roy, E.K. Williamson, M. Okumura, K. Mochizuki, E.J. Chen, T.J. Park, G.F. Debes, Y. Zhang, T. Curran, T. Kambayashi, J.K. Burkhardt, CRK proteins selectively regulate T cell migration into inflamed tissues, J. Clin. Invest. 125 (2015) 1019e1032. [27] K. Katagiri, Y. Ueda, T. Tomiyama, K. Yasuda, Y. Toda, S. Ikehara, K.I. Nakayama, T. Kinashi, Deficiency of Rap1-binding protein RAPL causes lymphoproliferative disorders through mislocalization of p27kip1, Immunity, 34 24-38. [28] Y. Ueda, K. Katagiri, T. Tomiyama, K. Yasuda, K. Habiro, T. Katakai, S. Ikehara, M. Matsumoto, T. Kinashi, Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus, Nat. Commun. 3 (2012) 1098. [29] S. Ishihara, A. Nishikimi, E. Umemoto, M. Miyasaka, M. Saegusa, K. Katagiri, Dual functions of Rap1 are crucial for T-cell homeostasis and prevention of spontaneous colitis, Nat. Commun. 6 (2015) 8982.

Please cite this article as: Y. Momoi et al., Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2020.01.080