Polyphasic characterization of mung bean (Vigna radiata L.) rhizobia from different geographical regions of China

Polyphasic characterization of mung bean (Vigna radiata L.) rhizobia from different geographical regions of China

Soil Biology & Biochemistry 40 (2008) 1681–1688 Contents lists available at ScienceDirect Soil Biology & Biochemistry journal homepage: www.elsevier...

641KB Sizes 5 Downloads 45 Views

Soil Biology & Biochemistry 40 (2008) 1681–1688

Contents lists available at ScienceDirect

Soil Biology & Biochemistry journal homepage: www.elsevier.com/locate/soilbio

Polyphasic characterization of mung bean (Vigna radiata L.) rhizobia from different geographical regions of China Jiang Ke Yang a,1, Tian Ying Yuan b,1, Wei Tao Zhang b, Jun Chu Zhou b, You Guo Li b, * a b

College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 2 September 2007 Received in revised form 31 January 2008 Accepted 3 February 2008 Available online 1 May 2008

Polyphasic characterization of 54 indigenous mung bean (Vigna radiata L.) rhizobia from different geographic regions of China was determined by analyzing the variability of 16S rRNA gene RFLP, 16S–23S rRNA gene Intergenetic Spacer (IGS) RFLP, G-C rich RAPD and phenotype assays. Based on these characteristics, mung bean rhizobia were clustered into four groups. Group I comprised 16 slow-growing isolates from a variety of geographic regions. This group was genetically distinct from Bradyrhizobium japonicum and Bradyrhizobium liaoningense, and may represent a new species. Group II was composed of 18 isolates, which could be sub-divided into two sub-groups that were respectively related to B. japonicum and B. liaoningense. Group III comprised 12 isolates from South China and clustered together with Bradyrhizobium elkanii. Group IV formed a miscellany of 8 fast-growing isolates variously related to the genera Sinorhizobium, Rhizobium and Mesorhizobium. Ó 2008 Elsevier Ltd. All rights reserved.

Keywords: Mung bean Rhizobia 16S rRNA gene RFLP IGS RFLP RAPD Phenotype

1. Introduction Mung bean (Vigna radiata L.) is an important legume of Asian origin, now widely cultivated throughout Asia, Australia, New Zealand and Africa. It is a valuable green manure crop for improving soil fertility, and its sprouts and starch are also popular health foods. The association of mung bean rhizobia with plants is a critical factor. Inoculation of rhizobia with a high capacity of nodulation and nitrogen fixation is an established practice and agronomic technique (Hadad and Loynachan, 1985; Rangarajan and Purushothaman, 1987). In the past, rhizobia isolated from mung bean were generally ascribed to the ‘‘cowpea miscellany’’ (Allen and Allen, 1981). Strains of this heterogeneous group consisted of uncharacterized slowgrowing rhizobia (Bradyrhizobium) from tropical and subtropical legume species of Vigna unguiculata, Phaseolus lunatus, Arachis hypogaea, and Macroptilium atropurpureum (Trinick and Hadobas, 1989; Thies et al., 1991). Currently, there are six named species of Bradyrhizobium (Jordan, 1982; Kuykendall et al., 1992; Xu et al., 1995; Yao et al., 2002; Rivas et al., 2004; Vinuesa et al., 2005). However, recent investigations on Bradyrhizobium isolated from a variety of legumes or non-legumes plants confirmed that this genus has several other * Corresponding author. Tel.: þ86 27 8728 1685; fax: þ86 27 8728 0670. E-mail address: [email protected] (Y.G. Li). 1 Equal contribution. 0038-0717/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.soilbio.2008.02.002

species (Yang et al., 2005, Ormeno-Orrillo et al., 2006; Wang et al., 2006; Lafay et al., 2006). Bradyrhizobia are outstandingly adaptable. They are important in soil and the rhizosphere (Vinuesa et al., 1998; Han et al., 2005), and also occur among aquatic bacteria that form stem nodules on Aeschynomene species (So et al., 1994; Willems et al., 2000), and as endophytes in rice (Chaintreuil et al., 2000). Because of its ecological versatility, mung bean is widely cultivated in various climate and geographical regions of China, playing an important role in local economy and sustainable agriculture. Although it is established practice to use mung bean rhizobia as inoculants, knowledge of the diversity and phylogeny of rhizobia that nodulate mung beans is scanty. In this study, various molecular and phenotypic typing approaches were used to study the indigenous mung bean rhizobia isolated from different geographical regions of China to generate their polyphasic characteristics. Such systematical studies not only elucidated their phylogenetic relationships, but may provide valuable microbial resources for legume cultivation. 2. Materials and methods 2.1. Bacterial strains and DNA extraction A total of 54 indigenous rhizobia were captured from root nodules of mung bean cultivars from 16 soil samples collected from eight regions of China (Table 1), using standard procedures (Vincent, 1970). Single colonies were cultured and maintained on Yeast extract Mannitol Agar (YMA). Nodulation abilities of the

1682

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

Table 1 Strains used in this study Strains

Host plants

Geographic origins

16S rRNA genotypea

16S rRNA gene RFLP patternsb

IGS RFLP patternsa

LYGL1 LYGL2 LYGL3, LYGL4 LYGL5 LYGL6 LYGL7 LYGL8 LYGL9, LYGL10, LYGL11 LYGL14 XJL5, XJL6, XJL10, XJL11, XJL13, XJL15, XJL17 XJL9 XJL2 XJL3 XJL4 HDL1 HDL2, HDL3 HDL5 SCL1 SCL2 SCL4 SCL5 SCL12 GXL1 GXL2 GXL3 GXL7, GXL8 GXL10 GXL11 GZL1 GZL2 GZL4, GZL5, GZL6, GZL7, GZL8, GZL9, GZL10 NJL1 NJL2 NJL3 SJZL1 SJZL2 SJZL4 Bradyrhizobium japonicum USDA6T USDA110 USDA122 Bradyrhizobium liaoningense 2281T Bradyrhizoibum elkanii USDA76T, USDA46 USDA86, Sinorhizobium fredii USDA205T Sinorhizobium medicae USDA1037T Sinorhizobium meliloti USDA1002T Rhizobium leguminosarum USDA2370T Rhizobium etli CFN42T Rhizobium galegae HAMBI540T Mesorhizobium huakuii USDA4779T Mesorhizobium tianshense USDA3592T Mesorhizobium loti NZP2213T

Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata Vigna radiata

Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Lianyungang, North China Xinjiang, Northwest China Xinjiang, Northwest China Xinjiang, Northwest China Xinjiang, Northwest China Xinjiang, Northwest China Handan, North China Handan, North China Handan, North China Sichuan, Southeast China Sichuan, Southeast China Sichuan, Southeast China Sichuan, Southeast China Sichuan, Southeast China Guangxi, South China Guangxi, South China Guangxi, South China Guangxi, South China Guangxi, South China Guangxi, South China Guangzhou, South China Guangzhou, South China Guangzhou, South China Nenjiang, Northeast China Nenjiang, Northeast China Nenjiang, Northeast China Shijiazhuang, North China Shijiazhuang, North China Shijiazhuang, North China

I I I X I I I II I II I V V II II II I II II I II XI I IV III IV IV XV XV I III XI I XI I I I

AABB AABB AABB BCAC AABB AABB AABB AAAA AABB AAAA AABB BCEC BCEC AAAA AAAA AAAA AABB AAAA AAAA AABB AAAA BCAD AABB AACA ACCA AACA AACA CDDC CDDC AABB ABCA DEEE AABB DEEE AABB AABB AABB

1 9 12 39 10 7 13 15 14 20 1 36 37 24 15 16 11 23 21 5 21 40 20 25 26 27 28 32 32 6 39 43 8 44 4 3 2

Glycine max Glycine max Glycine max

Japan Japan United States

II II II

AAAA AAAA AAAA

19 17 18

Glycine max

China

II

AAAA

22

Glycine max Glycine max

United States United States

III III

ACCA ACCA

30 31

Glycine max

China

X

BCAC

38

Medicago truncatula

United States

VIII

BCDC

41

Medicago sativa

United States

IX

BCDE

42

Phaseolus vulgaris

United States

VI

DCEC

46

V

BCEC

45

Galega orientalis

Finland

VII

DCDD

47

Astragalus sinicus

China

XII

CCFD

33

Glycyrrhiza pallidiflora

China

XIII

CDEF

34

Lotus corniculatus

New Zealand

XIV

DCFD

35

a

The 16S rRNA genotype and IGS RFLP patterns represent combination of restriction patterns obtained by enzymes used. b Each letter refers to a restriction pattern obtained with enzymes HaeIII, HhaI, HinfI, and MspI, respectively, and the restriction pattern of B. japonicum USDA 110 was assigned AAAA pattern.

strains were tested by plant inoculation assay on their original host plants. Sixteen representative strains of the genera of Rhizobium, Bradyrhizobium, Sinorhizobium, and Mesorhizobium were included in this study (see Table 1).

For total DNA extraction, rhizobial strains, cultured in Yeast extract – Mannitol (YM) liquid medium at 28  C for 48 h were harvested. The pellets were washed twice with TE buffer (Tris 10 mM, EDTA 1 mM, NaCl 50 mM, pH 8.0) and then subjected to

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

total DNA extraction by the hexadecyltrimethyl ammonium bromide (CTAB) method (Wilson, 1989). 2.2. Phenotypic tests Phenotypic characteristics (listed in Table 2), included NaCl tolerance, sole carbon or nitrogen sources utilization, intrinsic antibiotic resistance, and acid or alkali production and were determined mainly as described by Yang et al. (2005). For numerical analysis, the phenotypic features of bacteria were coded in the binary system (1 for positive and 0 for negative) and the similarity was calculated by simple matching (SM) method, and grouped by the Unweighted Pair Group Method Average (UPGMA) algorithm. 2.3. 16S rRNA gene PCR-RFLP Primers fD1 (50 -CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC30 ) and rD1 (50 -CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG30 ), which correspond to Escherichia coli 16S rRNA gene positions 8–27 and 1524–1540 respectively were used for PCR amplification in a Thermocycler controller (MJ Research Inc.) as described previously (Weisburg et al., 1991). Restriction enzyme fingerprints Table 2 Phenotypic characteristics of mung bean rhizobia grouped by RAPD Characteristics

Group I

Group II

Group III

Group IV (n ¼ 8)

Ia Ib IIa IIb IIIa IIIb (na ¼ 8) (n ¼ 8) (n ¼ 6) (n ¼ 12) (n ¼ 5) (n ¼ 7) NaCl tolerance (%) 0.5 0.8

 

 

 

þ 5

Intrinsic antibiotic resistance Ampicillin (50) 6 Erythromycin (20) 6 Gentamicin (20) 1 Kanamycin (20) 4 Nalidixic acid (50) þ Neomycin (30) þ Rifampin (15) 7 Spectinomycin (30) þ Streptomycin (20)  Tetracycline (15) 3

(mg ml1) þ 3 þ 3 þ 2 þ 3 þ þ 6 3 4 5 5 4 4 4 þ þ

þ 7 þ þ 7 þ 4 4  þ

þ þ  þ þ þ þ   þ

þ þ 3 5 5 þ 1 þ 3 6

þ þ 6 þ þ þ þ 5 þ þ

Carbon source utilization Glycerol þ D-Fructose 2 Lactose  Galactose þ Xylose 2 Sucrose þ Dextrine 3 Mannitol þ Inositol 2 Sorbitol þ

þ   þ 2 þ  þ  þ

þ 1 2 þ þ 5  þ  þ

þ   þ þ þ  þ  þ

þ   þ    þ  þ

þ  3 þ 4 5  þ  5

þ 5 þ þ 6 þ þ þ þ þ

Nitrogen source utilization 2 L-Lysine 3 L-Methionine  L-Phenylalanine  L-Proline þ L-Serine þ L-Tryptophan  L-Tyrosine þ KNO3 þ (NH4)2SO4 6 Peptone þ

  1   þ  þ þ þ þ

1  3  2 þ  5 þ 5 þ

     þ  þ þ þ þ

       þ þ þ þ

    3 þ  þ þ 6 þ

3 4 þ  3 þ











þ

þ 

L-Leucine

a b c

of 100 ng PCR DNA digested with HaeIII, HhaI, HinfI, and MspI (Promega) were recorded by Gel Image System (Kodak, Inc.) after the fragments were separated on 3% (w/v) agarose gels at 80–85 mV for approximately 2.5 h. 2.4. 16S–23S rRNA gene ITS PCR-RFLP Primer pHr (TGCGGCTGGATCACCTCCTT) corresponding to positions 1518–1541 of 16S rRNA gene, and p23SRO1 (GGCTGCT TCTAAGCCAAC) corresponding to positions 1069–1052 of 23S rRNA gene of E. coli were used for PCR amplification. PCR was carried out in 100 ml reaction mix and the PCR was done as described by Deya et al. (1995) except the annealing temperature was 62  C. Aliquots of 100 ng PCR products were digested with 5 U restriction endonucleases and RFLP patterns were recorded as above. 2.5. G-C rich RAPD G-C rich primers P5 (50 -TCG GAG TGG CC-30 ), P22 (50 -CTA GGC GTC G-30 ), P25 (50 -CGG AGA GTA C-30 ), P30 (50 -CGA AGC CT-30 ), P58 (50 -CGG GAG ACC-30 ), p64 (50 -CCA GGC GCA A-30 ), and primer combinations (P5 þ P22, P25 þ P30, and P58 þ P64) were used to generate the rapid amplified genome fingerprints. PCR was carried out in a 25 ml reaction volume with the amplified procedure, 94  C 1 min, 38  C 1 min, 72  C 1 min, for 35 cycles. An aliquot of 100 ng PCR products was loaded into the 1% (w/v) agarose gel. After electrophoresis and ethidium bromide staining, the RAPD patterns were recorded. 2.6. Clustering and evolutionary analysis

3b 

1 

Bromothynol blue reactionc

1683



The band patterns of RFLP and G-C rich RAPD genomic fingerprinting analysis were converted into a two-dimensional binary matrix through a binary scoring system, the similarities being evaluated by Simple Matching (SM) coefficient. A dendrogram was constructed from the distance matrix by UPGMA algorithm, and displayed by TREE program with the NTSYS software package, version 2.1 (Applied Biostatistic Inc.). 3. Results 3.1. 16S rRNA gene PCR-RFLP

The number of studied strains. The number of the strain with positive reaction. ‘‘þ’’, secrete Hþ on BTB plate; ‘‘’’, secrete OH on BTB plate.

þ þ þ þ

Sections of 1.5 kb of the 16S rRNA gene from mung bean rhizobia and reference strains were amplified by PCR and then digested by endonucleases HaeIII, HhaI, HinfI and MspI to generate RFLP patterns of 16S rRNA genes (Table 1). A dendrogram was generated by UPGMA algorithm based on the combined restriction patterns (Fig. 1). HaeIII divided mung bean rhizobia into slow-growing and fast-growing groups. Slow-growing rhizobia were further divided into genotype I, II, III and IV by HhaI, HinfI and MspI. Genotype I consisted of sixteen mung bean rhizobia. RFLP patterns manifested that this group was genetically distinct from the reference strains. Genotype II comprised eighteen mung bean rhizobia isolated from various geographical regions and the reference strains of Bradyrhizobium japonicum and Bradyrhizobium liaoningense. Genotype III and IV consisted of twelve strains isolated from Guangzhou and Guangxi in South China, and clustered with the reference strains of Bradyrhizobium elkanii. Although the number of tested fast-growing rhizobia is limited, they still exhibited certain diversity and comprised genotype V, VI, X, XI and XV. Genotype V and VI are phylogenically related to Rhizobium etli CFN42 and Rhizobium leguminosarum USDA2037 respectively. Genotype X and XI are related to Sinorhizobium fredii USDA205, and strains of genotype XV belong to genus of Mesorhizobium.

1684

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

Fig. 1. Dendrogram generated from the 16S rRNA gene RFLP patterns of mung bean isolates and reference rhizobia grouped by UPGMA. Brackets show numbers of strains with the same 16S rRNA genotype.

3.2. 16S–23S rRNA gene IGS PCR-RFLP The 16S–23S rRNA gene Intergenetic Spacer (IGS) of all mung bean rhizobia and reference strains were amplified by PCR with the primers of pHr and p23SRO1. All rhizobia tested produced a band ranging from 1900 bps to 2100 bps. After digestion with four enzymes, diverse RFLP band patterns were observed and 47 IGS RFLP patterns were generated (Table 1). A dendrogram was constructed by analyzing the similarity between different RFLP patterns generated by four restriction endonucleases (Fig. 2). At 58% similarity, mung bean rhizobia were clustered into slow- and fast-growing group. Slow-growing rhizobia could be further divided into IGS I, II, III and IV groups. Group IGS I consisted of nine rhizobia from different geographical regions. Together with strains in IGS II, which consisted of seven strains from North China, they belonged to 16S rRNA gene genotype I. Group IGS III and IV were clustered with B. japonicum and B. liaoningense respectively. IGS III comprised six isolates and three reference strains of B. japonicum USDA6, USDA100 and USDA122. IGS IV consisted of twelve mung bean rhizobia and B. liaoningense 2281. Most of them were isolated from Xingjiang, China. Group IGS V comprised seven isolates and the reference strains of B. elkanii. Eight fast-growing isolates were clustered with the reference strains of Mesorhizobium loti NZP2213, S. fredii USDA205 and R. etli CFN42.

similarity of 52%. Slow-growing rhizobia were divided into I, II and III groups at the 70% similarity. They could be further divided into Ia, Ib, IIa, IIb, IIIa and IIIb subgroups at higher similarity. Eight fast-growing rhizobia were respectively clustered into genera of Mesorhizobium, Sinorhizobium and Rhizobium. 3.4. Phenotypic characteristics The phenotypic characteristics of 54 mung bean isolates were determined, and the main features differentiating every cluster were listed in Table 2. Fast-growing rhizobia were clustered into Group IV. Strains in this group showed highest NaCl tolerance and could utilize most of the carbon and nitrogen sources to produce acid. In contrast, slow-growing rhizobia all produced alkali. Their spectrum of intrinsic antibiotic resistance and the range of carbon and nitrogen sources utilized were relatively narrow, and most of them failed to grow on the YM agar medium with 0.8% NaCl. There still existed differences within the group identified as bradyrhizobia. Strains of Group I could use most of the carbon and nitrogen sources including glycerol, galactose, sucrose, mannitol, sorbitol, L-proline L-serine L-tyrosine, KNO3, (NH4)2SO4 and peptone, and retained resistance to most of the antibiotics. From group I to group III, the tolerance to NaCl become weaker, the spectrum of intrinsic antibiotic resistance and the range of sole carbon and nitrogen sources gradually became narrower.

3.3. G-C rich RAPD 4. Discussion RAPD analysis of isolated rhizobia and the reference strains were conducted by using G-C rich single primer of P5, P22, P25, P30, P58, P64, and three primer combinations of P5 þ P22, P25 þ P30 and P58 þ P64. The RAPD results showed powerful resolution for genomic DNA fingerprinting and almost every strain exhibited a unique band pattern. Fingerprints from single primer and double primer sets were combined and transferred into a binary matrix to generate dendrogram by UPGMA algorithm (Fig. 3). According to the dendrogram, isolated strains were also clustered into slow-growing and fast-growing rhizobia at the

Compared with traditional numerical taxonomy, polyphasic characterization not only supplied the morphological, physiological and biochemical information, but also generated more fundamental genetic information that indicated the evolutionary history of bacteria. In this study, four assays are used to generate both the phenotypic characteristics and the genetic polymorphic information on ribosomal RNA operon (rrn) and genome of mung bean rhizobia isolated from different geographical regions of China to elucidate their diversity and phylogenetic relationship.

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

1685

Fig. 2. Dendrogram generated from the 16S–23S rRNA gene IGS RFLP patterns of mung bean rhizobia and reference strains grouped by UPGMA.

4.1. Diversity of mung bean rhizobia Although the diversity of other main subgroups of the cowpea miscellany were gradually resolved (Zilli et al., 2004; Yang et al., 2005), the phylogenetic characterization of mung bean rhizobia was still not be systematically determined (Yokoyama et al., 2006). In this study, slow-growing mung bean rhizobia exhibited abundant diversity. IGS RFLP analysis revealed that bradyrhizobia tested

contained 32 IGS genotypes, which could be clustered into five groups. IGS Group III, IV and V related to B. japonicaum, B. liaoningense and B. elkanii respectively, while IGS Group I was distinct from the reference strains, and may possibly represent an uncharacterized slow-growing rhizobia species. Further study on typical phenotypes and other genetic characteristics such as G þ C mol% and DNA–DNA homology will be needed to clarify their taxonomic status. Moreover, although the fast-growing rhizobia are a minority of mung bean

1686

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

Fig. 3. Dendrogram generated from the RAPD patterns of mung bean rhizobia and reference strains of Bradyrhizobium, Rhizobium, Mesorhizobium and Sinorhizobium grouped by UPGMA. The open line indicates the 0.70 similarity coefficient.

rhizobia, they still exhibited certain diversity and separately correspond to genera of Rhizobium, Sinorhizobium and Mesorhizobium. 4.2. Relationship between rhizobia biodiversity and ecological factors Host plants and geographical origin are two important factors to affect the diversity and phylogeny of rhizobia. Establishment of

nodulation is a complex procedure in which the molecular recognition between rhizobia and host plants is a critical step in determining the host range of rhizobia (Freiberg et al., 1997). Strains like M. huakuii has strict bacterial host specificity can only nodulate Astragalus sinicus (Cheng et al., 2006), while some others like NGR234 nodulate a very broad host range of plant (Pueppke and Broughton, 1999). Previous studies on peanut and cowpea rhizobia have identified several groups of rhizobia phylogenetically

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

distinct from the identified references (Yang et al., 2005; Zhang et al., 2007). Initially comparative analysis between these strains and strains of group I in this study revealed that they may be phylogenetically related (data not shown). Geographical origin is another important factor to affect the composition and biodiversity of indigenous soil rhizobia. Strains restricted to a specialized ecological niche generally exhibit distinctive phenotype and genotype. In this study, the geographical peculiarity was exhibited by tested strains. Group III are solely consisted of strains from South China (Guangzhou and Guangxi), and the majority of the strains from Lanyungang, Handan and Xingjiang were respectively clustered into group Ib, IIa and IIb. As report by Peng et al. (2002), fast-growing rhizobia isolated from Xinjiang, Northwest China showed special characteristics and could be described into S. xinjiangense. In this study, several fast-growing strains were isolated from this region, and the polyphasic characteristics determined indicated they are related to S. fredii. While considering S. fredii is tightly related to S. xinjiangense, their phylogenetic status cannot be definitely determined in this study. 4.3. Clustering variation of strains It was noticed that the classification status of several strains varied in different assays. In the IGS RFLP assay, strain LYGL6 is in group II, while in the RAPD assay, it divergent from other strains in this group and clustered into RAPD group Ia, unlike others in group Ib. The explanation for these variations could be the nonsynchronous evolution between rrn operon and total DNA. A further reason could be that the resolution capacity is varied among different assays. 16S rRNA gene RFLP supplied a rapid approach to classify rhizobia into different genotypes, while the information of intraspecies provided is relatively limited and insufficient to distinguish their phylogenetic placement (Fox et al., 1992). 16S–23S rRNA gene IGS contains more variation and revealed considerable profile heterogeneity among intraspecies or interspecies (Gurtler and Stanisich, 1996). RAPD fingerprinting reflected the variation of the genome, and can reveal the difference even between two strains, while the fingerprint profiles generated might have been affected by pseudo-positive bands due to the low stringency PCR condition. 4.4. Conclusions Polyphasic characterization demonstrated that mung bean rhizobia from different geographical regions of China exhibit rich diversity. Some strains were ascribed to identified genera and species, but others belong to novel, as yet uncharacterized groups. Phenotypic and genetic characteristics determined in this study could be useful reference data for comparable studies on the cowpea miscellany, and the rhizobia that we collected may also be have potential as legume inoculants to improve plant productivity and soil fertility. Acknowledgments We thank Prof. Andrew Johnston for advice on the writing of the manuscript. The work was granted by Chinese High-tech Developing Program 2007AA05Z417, Chinese R & D Infrastructure and Facility Development Program 2005DKA21208-6 and Open Grant of State Key Laboratory of Agricultural Microbiology, HAU, China. References Allen, O.N., Allen, E.K., 1981. The Leguminosae: A Source Book of Characteristics. Uses and Nodulation. The University of Wisconsin Press, USA.

1687

Chaintreuil, C., Giraud, E., Prin, Y., Lorquin, J., Ba, A., Gillis, M., de Lajudie, P., Dreyfus, B., 2000. Photosynthetic bradyrhizobia are natural endophytes of the African wild rice Oryza breviligulata. Applied and Environmental Microbiology 66, 5437–5447. Cheng, G.J., Li, Y.G., Zhou, J.C., 2006. Cloning and identification of opa22, a new gene involved in nodule formation by Mesorhizobium huakuii. FEMS Microbiology Letters 257, 152–157. Deya, A.A.M., Odelson, D.A., Hickey, R.F., Tidje, J.M., 1995. Bacterial community fingerprinting of amplified 16S and 16S–23S ribosomal DNA gene sequences and restriction endonuclease analysis (ARDRA). In: Akkermans, D.L., van Elsas, J. D., de Bruijn, F.J. (Eds.), Molecular Microbial Ecology Manual. Kluwer Academic Publishers, Dordrecht 3.3.2, 1-8. Fox, G.E., Wisotzkey Jr., J.D., Jurtshuk, P.H., 1992. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. International Journal of Systematic Bacteriology 42, 166–170. Freiberg, C., Fellay, R., Bairoch, A., Broughton, W.J., Rosenthal, A., Perret, X., 1997. Molecular basis of symbiosis between Rhizobium and legumes. Nature 387, 394–401. Gurtler, V., Stanisich, V.A., 1996. New approaches to typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 142, 3–16. Hadad, M.A., Loynachan, T.E., 1985. Abundance and characterization of cowpea miscellany Rhizobium from Sudanese soils. Soil Biology and Biochemistry 17, 717–721. Han, S.Z., Wang, E.T., Chen, W.X., 2005. Diverse bacteria isolated from root nodules of Phaseolus vulgaris and species within the genera Campylotropis and Cassia grown in China. Systematic and Applied Microbiology 28, 265–276. Jordan, D.C., 1982. Transfer of Rhizobium japonicum Buchanan 1980 to Bradyrhizobium gen. nov., a genus of slow-growing root nodule bacteria from leguminous plants. International Journal of Systematic Bacteriology 32, 136–139. Kuykendall, L.D., Saxena, B., Devine, E.E., Udell, S.E., 1992. Genetic diversity in Bradyrhizobium japonicum Jordan 1982, and a proposal for Bradyrhizobium elkanii sp. nov. Canadian Journal of Microbiology 38, 501–505. Lafay, B., Bullier, E., Burdon, J.J., 2006. Bradyrhizobia isolated from root nodules of Parasponia (Ulmaceae) do not constitute a separate coherent lineage. International Journal of Systematic and Evolutionary Microbiology 56, 1013–1018. Ormeno-Orrillo, E., Vinuesa, P., Zuniga-Davila, D., Martinez-Romero, E., 2006. Molecular diversity of native bradyrhizobia isolated from Lima bean (Phaseolus lunatus L.) in Peru. Systematic and Applied Microbiology 29, 253–262. Peng, G.X., Tan, Z.Y., Wang, E.T., Reinhold-Hurek, B., Chen, W.F., Chen, W.X., 2002. Identification of isolates from soybean nodules in Xinjiang region as Sinorhizobium xinjiangense and genetic differentiation of S. xinjiangense from Sinorhizobium fredii. International Journal of Systematic and Evolutionary Microbiology 52, 457–462. Pueppke, S.G., Broughton, W.J., 1999. Rhizobium sp. strain NGR234 and R. fredii USDA257 share exceptionally broad, nested host ranges. Molecular PlantMicrobe Interaction 12, 293–318. Rangarajan, M., Purushothaman, A.S., 1987. Successful inoculation of Vigna radiata (L) Wilczek grown in rice fallow soil containing indigenous cowpea rhizobia. FEMS Microbiology Letters 45, 85–88. Rivas, R., Willems, A., Palomo, J.L., Garcia-Benavides, P., Mateos, P.F., MartinezMolina, E., Gillis, M., Velazquez, E., 2004. Bradyrhizobium betae sp. nov. isolated from roots of Beta vulgaris affected by tumour-like deformations. International Journal of Systematic and Evolutionary Microbiology 54, 1271–1275. So, R.B., Ladha, J.K., Young, J.P., 1994. Photosynthetic symbionts of Aeschynomene spp. form a cluster with bradyrhizobia on the basis of fatty acid and rRNA analyses. International Journal of Systematic Bacteriology 44, 392–403. Thies, J.E., Bohlool, B.B., Singleton, P.W., 1991. Subgroups of mung bean miscellany: symbiotic specificity within Bradyrhizobium spp. for Vigna unguiculata, Phaseolus lunatus, Arachis hypogaea, and Macroptilium atropurpureum. Applied and Environmental Microbiology 57, 1540–1545. Trinick, M.J., Hadobas, P.A., 1989. Effectiveness and competition for nodulation of Vigna unguiculata and Macroptilium atropurpureum with Bradyhrizobium from Parasponia. Canadian Journal of Microbiology 35, 1156–1163. Vincent, J.M., 1970. A manual for the practical study of root-nodule bacteria. In: International Biological Program Handbook. Blackwell Scientific Publications, Ltd., Oxford, pp. 73–97. Vinuesa, P., Rademaker, J.L.W., de Bruijn, F.J., Werner, D., 1998. Genotypic characterization of Bradyrhizobium strains nodulating endemic woody legumes of the Canary islands by PCR-Restriction Fragment Length Polymorphism analysis of genes encoding 16S rRNA (16S rDNA) and 16S–23S rDNA intergenic spacers, Repetitive Extragenic Palindromic PCR genomic fingerprinting, and partial 16S rDNA sequencing. Applied and Environmental Microbiology 64, 2096–2104. Vinuesa, P., Leon-Barrios, M., Silva, C., Willems, A., Jarabo-Lorenzo, A., PerezGaldona, R., Werner, D., Martinez-Romero, E., 2005. Bradyrhizobium canariense sp. nov., an acid-tolerant endosymbiont that nodulates endemic genistoid legumes (Papilionoideae: Genisteae) from the Canary Islands, along with Bradyrhizobium japonicum bv. genistearum, Bradyrhizobium genospecies alpha and Bradyrhizobium genospecies beta. International Journal of Systematic and Evolutionary Microbiology 55, 569–575. Wang, F.Q., Wang, E.T., Zhang, Y.F., Chen, W.X., 2006. Characterization of rhizobia isolated from Albizia spp. in comparison with microsymbionts of Acacia spp. and Leucaena leucocephala grown in China. Systematic and Applied Microbiology 29, 502–517. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, J.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173, 697–703.

1688

J.K. Yang et al. / Soil Biology & Biochemistry 40 (2008) 1681–1688

Willems, A., Doignon-Bourcier, F., Coopman, R., Hoste, B., de Lajudie, P., Gillis, M., 2000. AFLP fingerprint analysis of Bradyrhizobium strains isolated from Faidherbia albida and Aeschynomene species. Systymatic and Applied Microbiology 23, 137–147. Wilson, K., 1989. Preparation of genomic DNA from bacteria. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Srtruhl, K. (Eds.), Current Protocols in Molecular Biology. Greene Publishing Associates/WileyInterscience, New York 2.4.1-2.4.5. Xu, L.M., Ge, C., Cui, Z., Li, J., Fan, H., 1995. Bradyrhizobium liaoningense sp. nov., isolated from the root nodules of soybeans. International Journal of Systematic Bacteriology 45, 706–711. Yang, J.K., Xie, F.L., Zou, J., Zhou, Q., Zhou, J.C., 2005. Polyphasic characteristics of bradyrhizobia isolated from nodules of peanut (Arachis hypogaea) in China. Soil Biology and Biochemistry 37, 141–153.

Yao, Z.Y., Kan, F.L., Wang, E.T., Wei, G.H., Chen, W.X., 2002. Characterization of rhizobia that nodulate legume species of the genus Lespedeza and description of Bradyrhizobium yuanmingense sp. nov. International Journal of Systematic and Evolutionary Microbiology 52, 2219–2230. Yokoyama, T., Tomooka, N., Okabayashi, M., Kaga, A., Boonkerd, N., Vaughan, D.A., 2006. Variation in the nod gene RFLPs, nucleotide sequences of 16S rRNA genes, Nod factors, and nodulation abilities of Bradyrhizobium strains isolated from Thai Vigna plants. Canadian Journal of Microbiology 52, 31–46. Zhang, W.T., Yang, J.K., Yuan, T.Y., Zhou, J.C., 2007. Genetic diversity and phylogeny of indigenous rhizobia from cowpea [Vigna unguiculata (L.) Walp.]. Biology and Fertility of Soils 44, 201–210. Zilli, J.E´., Valisheski, R.R., Filho, F.R.F., Neves, M.C.P., Rumjanek, N.G., 2004. Assessment of cowpea Rhizobium diversity in Cerrado areas of Northeast Brazil. Brazil Journal of Microbiology 35, 281–287.