Production of FK520 by Streptomyces tubercidicus

Production of FK520 by Streptomyces tubercidicus

ARTICLE IN PRESS Microbiological Research 163 (2008) 624—632 www.elsevier.de/micres Production of FK520 by Streptomyces tubercidicus Attila Ko ´nya...

266KB Sizes 4 Downloads 80 Views

ARTICLE IN PRESS Microbiological Research 163 (2008) 624—632

www.elsevier.de/micres

Production of FK520 by Streptomyces tubercidicus Attila Ko ´nya, Zsuzsanna Szabo ´, Ildiko ´ La ´ng, Istva ´n Barta, Ja ´nos Sala ´t IVAX Drug Research Institute Ltd., 1045 Budapest Berlini u `t 47-49, Hungary Received 15 February 2006; received in revised form 11 April 2006; accepted 6 October 2006

KEYWORDS FK520; Immunosuppressant; 31-O-demethylFK520 methyltransferase; Screening; Streptomyces tubercidicus

Summary The discovery of immunosuppressant compounds created the conditions for the successful transplantations. Effective immunosuppressant compounds were isolated from cultures of different microorganisms, among others macrolide type immunosuppressants, FK506 and FK520, were isolated from the fermentation broths of Streptomyces species. In this study a screening program was carried out to isolate microorganisms, which produce macrolide type immunosuppressant compounds. More than 40 000 actinomycete strains were investigated in the screening program comprising chemical, microbiological and PCR methods for the investigation of the cultures. Actinomycete strains with FK520 biosynthesizing ability were isolated in the program, which were identified as isolates of the Streptomyces tubercidicus species according to the taxonomical investigations. A part of the 31-O-demethylFK520 methyltransferase gene of the isolated S. tubercidicus was sequenced and it showed 88% homology to that of Streptomyces hygroscopicus. Till now strains of the Streptomyces hygroscopicus species were known to produce FK520 and this study proved that strains of other Streptomyces species have FK520 biosynthetic ability. & 2006 Elsevier GmbH. All rights reserved.

Introduction The number of transplantations has been increasing continuously, which was made possible by the application of immunosuppressant drugs in the therapy. Cyclosporine A was the first immunosuppressant compound with microbial origin, which was used in the therapy after transplantations Corresponding author. Tel.: +36 1 3993417;

fax: +36 1 3993356. E-mail address: [email protected] (A. Ko ´nya).

(Borel et al., 1976). Other immunosuppressive compound, produced by various strains of the Penicillium genus, is mycophenolic acid, the morpholinoethyl ester derivative of which is used in the therapy (Jekkel et al., 2001). Macrolide type immunosuppressive compounds with more advantageous properties were isolated from fermentation broth of Streptomyces species. One of them is FK506, which was isolated first from the culture of a strain of Streptomyces tsukubaensis in 1984 (Kino et al., 1987) and an other isolated compound with similar structure is FK520 (ascomycin), the bio-

0944-5013/$ - see front matter & 2006 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2006.10.002

ARTICLE IN PRESS Production of FK520 by Streptomyces tubercidicus

625

synthesis of which was described in Streptomyces hygroscopicus strains until now. The difference between the two immunosuppressant compounds is the group attached to the C-21 atom of the macrolide ring, which is an allyl group in case of FK506 and an ethyl group in case of FK520 (Fig. 1). The biosynthesis of the immunosuppressant rapamycin, the chemical structure of which is similar to that of FK506 and FK520, was described in S. hygroscopicus. The biochemical background of the biosynthesis of FK506 and FK520 and also the sequences of the genes taking part in it were also described (Motamedi et al., 1996; Motamedi and Shafiee, 1998; Wu et al., 2000, Takafumi et al., 2002). The polyketide part of the molecules is composed of acetate and propionate units, the pipecolate and the cyclohexile moieties are formed from lysine and shikimic acid and three methyl groups are incorporated into the molecule from methionine (Byrne et al., 1993). The determination of the genetic background of the FK520 biosynthesis made possible the modification of the FK520 gene cluster to produce 13-desmethoxy-13-methylFK520, the in vivo stability of which is higher compared to that of FK520 (Regentin et al., 2002). Till now the FK520 biosynthetic ability of the strains belonging to the S. hygroscopicus species was only described. The isolation of other FK506 or FK520 biosynthesizing microorganisms, the biosynthetic gene cluster of which are different from that of S. hygroscopicus provides additional possibilities

for the modification of the gene cluster and production of compounds with more advantageous properties. Although the strains of the Streptomyces genus produce a wide range of secondary metabolites, the biosynthesis of several bioactive compounds was described only by one or two species of the genus, for example avermectin (Streptomyces avermitilis), vancomycin (Streptomyces orientalis and Streptomyces toyocaensis), FK520 (S. hygroscopicus), FK506 (Streptomyces tsukubaensis), rapamycin (S. hygroscopicus), etc. In the case of secondary metabolites known to be produced only by one species, the isolation and description of other producer Streptomyces species is very interesting, because it creates the condition for the comparison of the biosynthetic genes and for the phylogenetic analyses. Genetic relationships among the known FK506 and FK520 producing species were investigated earlier (Garrity et al., 1993), but in that study only strains of the S. hygroscopicus species as FK520 producing microorganisms were compared. Here we described the isolation of strains belong to the Streptomyces tubercidicus species, which are able to produce FK520, the comparison of which with the earlier investigated FK520 or FK506 producer strains may result in interesting phylogenetic relationships.

Materials and methods Microorganisms Aspergillus niger IDR 721 and its FK506-FK520 resistant mutant IDR 722 were used as test organisms. The Aspergillus strains were maintained on MS agar slants (malt extract 1%, yeast extract 0.4%, glucose 0.4% and agar 2% in distilled water) at 25 1C. Actinomycete strains isolated from soil samples were maintained on Z agar slants (oat meal 2%, agar 2% in distilled water) at 28 1C. For direct comparison between our strains and type strain of S. tubercidicus the authentic strain DSMZ 42761 was used (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH).

Media

Figure 1. Chemical structure of FK506 and FK520.

Media used for the isolation of strains: Glycerol–glycine agar: glycerol 20 g, glycine 2.5 g, NaCl 1 g, K2HPO4 1 g, FeSO4  7H2O 0.1 g, MgSO4  7H2O 0.1 g, CaCO3 0.1 g, agar 15 g, distilled water 1000 ml, pH 7.0; Actinomycete isolation agar:

ARTICLE IN PRESS 626 Na-caseinate 2 g, asparagine 0.1 g, Na-propionate 4 g, K2HPO4 0.5 g, MgSO4  7H2O 0.1 g, FeSO4  7H2O 0.001 g, agar 15 g, glycerol (after melting) 5 g, distilled water 1000 ml, pH 8.1. Media used for the fermentation: FKA fermentation medium: soluble starch 4.5%, corn steep liquor 1%, yeast extract 1%, CaCO3 0.1%, in tap water, pH 6.8; KJ fermentation medium: glucose 2.5%, corn steep liquor 1.5%, pharmamedia 0.5%, CoCl2  2H2O 0.001%, CaCO3 0.3%, in tap water, pH 7.3. All media were sterilized at 121 1C for 25 min.

Isolation of strains from soil samples Soil samples were suspended in sterile distilled water and were spread on Petri dishes containing glycerol–glycine or Actinomycete isolation agar. The Petri dishes were incubated at 28 1C for 10 days. After the stereomicroscopic examinations all actinomycete colonies were isolated from the surface of the isolation plates on Z agar slants.

Taxonomic studies Strains were grown in accordance with methods adapted by the International Streptomyces Project (ISP) (Shirling and Gottlieb, 1966). Cultures were incubated at 28 1C for 14–21 days and were observed. Color codes (aerial mass) were assigned using the color wheels of ISP. For determination of micro- and macromorphological (cultural) characteristics and some biochemical properties we used the same media as Nakamura (1961). The utilization of nitrogen sources was examined by the method of Williams et al. (1983).

Mutagenic treatment Spores were washed from the agar slant of the A. niger IDR 721 strain with 5 ml sterile distilled water. This spore suspension was irradiated with ultraviolet light for 30–60 s or it was treated with 1 mg/ml N-methyl-N0 -nitro-N-nitrosoguanidine in 0.05 M phosphate buffer pH 8.0 at 28 1C for 20 min. After the mutagenic treatment the spores were centrifuged, washed with sterile distilled water and spread on MS agar containing 1 mg/ml FK506. After incubation at 25 1C for 7 days, colonies were isolated and their FK506 and FK520 resistance was investigated.

Fermentation procedure In test tubes: Spores were washed from the slant cultures with 2 ml sterile distilled water. Half

A. Ko ´nya et al. milliliter of this suspension was used to inoculate 5 ml fermentation medium signed FKA or KJ in test tubes. The strains were cultivated in rolling tube culture apparatus at 28 1C for 4 days. In shaken flasks: Spores were washed from the slant cultures with 5 ml sterile distilled water and this suspension was used to inoculate 100 ml fermentation medium signed FKA or KJ in 500 ml Erlenmeyer flask. The strains were cultivated on an orbital shaker operating at 250 rpm at 28 1C for 4 days.

PCR method The spores of the strains were washed from the surface of agar slant cultures. The spore suspension was incubated at 95 1C for 5 min and after centrifugation the supernatant of this solution was used as template in the PCR. The condition of the PCR was the following: 35 cycles of denaturation: 94 1C, 60 s; annealing: 50 1C, 90 s; elongation: 72 1C, 150 s. The PCR products were separated in 1.5% agarose gel.

Determination of FK520 and FK506 Thin layer chromatography The fermentation broth samples were examined by TLC using bioautographical detection. The fermentation broth sample was extracted with ethyl acetate. An aliquot of the ethyl acetate extract was spotted on a thin layer plate of silica gel 60 (Merck, Darmstadt), which was developed in isopropyl alcohol–benzene (15:85) or in methylene chloride–acetone (2:1). After drying the TLC plate was put on the surface of an agar plate inoculated with the spores of the A. IDR 721 test organism. After twenty minutes diffusion the thin layer plate was removed from the surface of the agar, then the latter was incubated at 37 1C for 24 hours. If the culture sample contained FK506 or FK520 a sharp inhibition spot (Rf ¼ 0.6, or Rf ¼ 0.5 depending on developing solvent) could be seen on the surface of the agar layer. If an inhibition spot (Rf ¼ 0.6 or Rf ¼ 0.5) appeared on the agar layer, the sample was investigated again with the above described method using the A. niger IDR 722 test organism (FK506 and FK520 resistant strain). Using this strain the inhibition spot did not appear if the sample contained FK506 or FK520. The immunosuppressant compounds could also be detected on the thin layer plate with the reagent of 1% Ce(SO4)2 in 10% sulfuric acid at 120 1C.

ARTICLE IN PRESS Production of FK520 by Streptomyces tubercidicus

627

HPLC method The fermentation broth was diluted two times with methanol. After shaking for 5 min with high frequency bath the samples were centrifuged and 10 ml from the supernatant phase was injected for HPLC analysis on a Novapack Nucleosil C18, 5 mm column (150  3.9 mm) eluted by gradient elution. Solvent A: acetonitrile-water (95:5) pH ¼ 2.0 (adjusted with H3PO4), solvent B: acetonitrile-water (40:60) pH ¼ 3.0 (adjusted with H3PO4). Gradient table: 0–2 min: solvent A 1%, solvent B 99%; 2–8 min: solvent A increased to 99%, solvent B decreased to 1%; 22–23 min: solvent A decreased to 1%, solvent B increased to 99%; 23–30 min: solvent A 1%, solvent B 99%. The flow rate was 1 ml/min, the detection was at 200 nm. Retention time of FK506 and FK520 was 12.8 and 11.5 min, respectively.

spp. were selected from the collection of our institute. The isolated strains were cultivated in fermentation media signed FKA or KJ and the fermentation broths were investigated by microbiological method, by thin layer chromatography and by HPLC. Microbiological detection was applied earlier for the detection of FK506 in the fermentation broths of microorganisms (Kahn et al., 1992). We also applied a highly specific microbiological method for the recognition of the presence of FK506–FK520 type immunosuppressant compounds in the culture of the strains. Two test organisms were used for the investigation of the fermentation broths, an FK506–FK520 sensitive fungal strain and its FK506–FK520 resistant mutant. By simultaneous application of these two test organisms, FK506–FK520 type immunosuppressant compounds can be detected selectively according to their growth. Fungal

Product isolation and identification from selected strains The active compounds were isolated from the fermentation broths by whole broth extraction with a mixture of ethyl acetate and methanol (10:1). After the evaporation of the extracts the crude product was consecutively chromatographed on five silica gel columns. The solvent systems used in the chromatography as eluents were the following: column no. 1: a step gradient of ethyl acetate in n-hexane; column no. 2: a step gradient of acetone in methylene dichloride; column no. 3: a mixture of chloroform and methanol (20:1); column no. 4: a mixture of chloroform and methanol (10:1); column no. 5: a mixture of methylene dichloride and acetone (7:3). After the chromatographic purification the obtained active substance were investigated with spectroscopic methods.

Results and discussion Screening program was carried out to isolate microorganisms, which produce FK506 or FK520 or other immunosuppressant compounds with similar structure. In the screening program actinomycete strains from the collection of the institute and isolated freshly from soil samples were investigated. Altogether more than 40 000 actinomycete cultures were isolated from soil samples collected in different geographical regions (countries of Europe, Australia, Sri Lanka, Madagascar, Mexico, Thailand, Alaska, etc.) and 1400 actinomycete strains, mostly Streptomyces

Figure 2. The PCR amplificated part of the 31-O-methyl transferase (fkbm) gene (464 bp); Lanes: 1–3: positive controls (strains of the FK520 producer S. tubercidicus); Lanes: 4–6: negative controls (random chosen strains from the screen); Lane 7: 50 bp step ladder standard.

ARTICLE IN PRESS 628

A. Ko ´nya et al.

strains were investigated from our strain collection to select one, which was sensitive enough to the compounds of the FK506 family, for the development of the method. After studying the antifungal activity of FK506 the A. niger IDR 721 strain was selected, the growth of which was inhibited by 20 ng/ml FK506 or FK520. An FK506–FK520 resistant mutant signed IDR 722 was prepared from the selected A. niger IDR 721 strain by mutagenic treatments. The sensitive strain did not grow on a medium, which contained more than 20 ng/ml FK506 or FK520, while its resistant mutant grew on the medium, which contained FK506 or FK520 up to 25 000 ng/ml concentration. There was not any difference among the effects of other type antifungal compounds on the growth of the two strains, which is important for the selectivity of the assay. According to these investigations the A. niger IDR 721 strain and its FK506–FK520 resistant mutant signed IDR 722 were applied as test organisms in the screening program. After investigation of the fermentation broth of more than 25 000 isolated actinomycete strains, the strain no. 25 672 originated from a Mexican soil sample was selected, the fermentation broths of which were positive in the microbiological and chemical test assays. The active compound was isolated from the fermentation broths of the selected strain and according to the spectroscopic investigations the isolated compound was FK520. The strain produced 1–5 mg/l FK520 under shaken flask circumstances using FKA fermentation medium at 28 1C for 4 days.

After the isolation the first strain with FK520 producing ability, we developed a polymerase chain reaction (PCR) based screening method, by which the presence of the genes involved in the biosynthesis of FK506 or FK520 could be detected independently of the appearance of the immunosupp ressant compounds in the fermentation broth. The isolated FK520 producer strain no. 25 672 was used as positive control during the development of the PCR method. Oligonucleotide primers were designed on the basis of the DNA sequences of the biosynthetic genes of FK506 and FK520, available in the literature. After investigation of several primer pairs the primers designed for the 31-O-demethylFK520 methyltransferase (fkbm) gene (50 CGAGGCGCAGTTCCTTTACC-30 and 50 -TCCGCGATGACGTCGGAGAG-30 ) proved to be the most advantageous. A DNA fragment of 464 bp size (including the primers) was amplified from the DNA of the strains, which carried the 31-O-demethyl-FK520 methyltransferase (fkbm) gene of the FK506 or FK520 biosynthesis cluster (Fig. 2). The screening program supplemented with the PCR based method was continued and two other strains (no. 25 794 and 26 557) isolated also from Mexican soil sample were selected, the fermentation broths of which contained FK520 type immunosuppressant compound according to the test methods. The 464 bp long fragment of the 31-Odemethyl-FK520 methyltransferase gene could be also amplified from the DNA of these strains. After isolation of the active compound from the cultures of the strains, it proved to be also FK520 according to the spectroscopic examinations.

Table 1. Comparison of taxonomic characteristics of strains no. 25 672, 25 794 and 26 557 with Streptomyces tubercidicus ISP 5261

Spore chain morphology Aerial mass color Reverse side color Soluble pigment pH-indicator character of endo- and exopigment Formation of melanoid pigments Utilization of L-Arabinose D-Xylose L-Rhamnose D-Glucose D-Fructose Sucrose D-Raffinose D-Mannitol myo-Inositol +: Positive; : negative; +/: doubtful.

Strains no. 25 672, 25 794, 26 557

S. tubercidicus ISP 5261

Spiral Light gray Grayish brown or violet Yellow to violet +   +/  + + + + + +

Spiral Light gray Grayish brown to dark brown Yellow to violet-pink +     + + + + + +

ARTICLE IN PRESS Production of FK520 by Streptomyces tubercidicus

Taxonomical investigation of the isolated FK520 producer strains Description of strains no. 25 672, 25 794 and 26 557 The strains no. 25 672, 25 794 and 26 557 formed branched substrate mycelia and aerial hyphae, which bear spirals. The mature spore chains consisted of 3–10 or more spores. The color of the aerial mass was (d, 3 fe) in the Gray color-series and on glycerol–asparagine agar (ISP med. 5) in some places its color was (4 ig+5 dc) in the Red color-series. The reverse side of the colony was grayish brown to grayish violet. The reverse mycelium pigment had pH indicator character, changing to yellowish shade of original color with

629 addition of 0.05 N NaOH and to grayish shade of original color with addition of 0.05 N HCl. Color in media: melanoid pigments were not formed in tryptone–yeast broth (ISP med. 1), peptone–yeast–iron agar (ISP med. 6) and tyrosine agar (ISP med. 7). In yeast extract–malt extract agar, oatmeal agar and glycerol–asparagine agar reddish brown, yellowish gray or yellow exopigment were found. These pigments were pH-sensitive showing similar changes as it was described for the endopigment of the substrate mycelium. Carbon source utilization: D-glucose, myo-inositol, D-mannitol, D-fructose, sucrose and raffinose were utilized for growth. No growth or only trace of growth was observed with L-arabinose and L-rhamnose, the utilization of D-xylose was doubtful. We searched

Table 2. Comparison of cultural-morphological and some physiological characters of strains no. 25 672, 25 794, 26 557 and Streptomyces tubercidicus no. 585 (Nakamura, 1961) Strain no.

25 672

25 794

26 557

585

Glucose–asparagine agar

G AM R SP

Sparse Thin, grayish Purplish None

Sparse Thin, grayish Purplish None

Sparse Thin, grayish Purplish None

Moderate Thin, white Purplish None

Glucose–asparagine–yeast agar

G

Good

Good

Good

Moderate

AM R SP

Thin Grayish brown Purplish brown

Thin, brownish Grayish brown Purplish brown

Thin Grayish brown Purplish brown

Thin, grayish Dark brown Buff yellow

G AM

Good Light gray

Good Light gray

Good Mouse gray

R SP

Grayish brown None

Grayish brown Sligh purplish

Good Light brownish gray Grayish brown Sligh purplish

G AM

Good Brownish gray

Good Thin, brownish

R SP

Purplish gray None

Reddish brown Sligh

Moderate Thin, brownish gray Grayish brown None

Good Cottony, mouse gray Old rose Pink

Starch agar

G AM R SP

Moderate Thin, white Buff yellow None

Moderate Thin, white Reddish gray None

Moderate Powdery, white Buff yellow None

Good Thin, white Light buff None or sligh

Tyrosine agar

G AM R SP

Moderate None Yellowish None

Moderate None Yellowish None

Moderate None Yellowish None

Poor None None None

Moderately strong Moderate Spiral

Moderately strong Poor Spiral

Moderately strong Negative Spiral

Moderately strong

Synthetic agar (sucrose)

Synthetic agar (glycerol)

Diastatic activity Tyrosinase activity Sporophores on Bennett agar

Abbreviations: G: growth; AM: aerial mass color; R: reverse side color; SP: soluble pigment.

Old rose Purplish

Negative Spiral

ARTICLE IN PRESS 630

A. Ko ´nya et al.

the taxonomic data of known Streptomyces species in the International Streptomyces Project (ISP) descriptions by Shirling and Gottlieb’s reports (Shirling and Gottlieb, 1968a, b, 1969, 1972) and we used different diagnostic keys too (Nonomura, 1974; Szabo ´ et al., 1975). The results of comparative studies showed that our strains could be identified as S. tubercidicus (Nakamura, 1961). The comparison of our strains and S. tubercidicus ISP 5261, the taxonomic characteristics of which were originated from ISP descriptions (Shirling and Gottlieb, 1969), is shown in Table 1. Additional taxonomical investigations were accomplished with our S. tubercidicus strains and the results were compared with data of the original description of S. tubercidicus (Nakamura, 1961) (Table 2). It seems from the data that our strains possessed the most differentiated characters of S. tubercidicus no. 585 (color of aerial mycelium, soluble pigment, etc.). Direct comparison was also carried out between Mexican isolates and type strain of S. tubercidicus (DSMZ 42761). On the basis of their micro- and macromorphological characters and carbohydrate utilization patterns our strains are typical members of S. tubercidicus. In addition to ISP characters the utilization of nitrogen sources were also examined (Table 3) and it seems that relatively limited differences were revealed between our strains and authentic strain of S. tubercidicus.

Table 3.

The occurrence of S. tubercidicus was relative high – approximately 8% – in Streptomyces population isolated from Mexican soil sample. The recognition of strains of this species was facilitated by their pigmentation, so it can be said that the S. tubercidicus species is typical member of the actinomycete population isolated from this sample. The part of the 31-O-demethyl-FK520 methyltransferase gene, amplified from the isolated S. tubercidicus strains were sequenced (Genbank DQ387857) and compared to that of the FK520 producer S. hygroscopicus var. ascomyceticus (Genbank AF235504) to the 31-O-demethyl-FK506 methyltransferase gene of the FK506 producer Streptomyces sp. (Genbank U65940) and to the methyltransferase gene of the rapamycin producer S. hygroscopicus (Genbank X86780) obtaining 88%, 83% and 77% identity, respectively. The comparison of the DNA sequences without the primers used in the PCR amplification (424 bp) is shown in Fig. 3. Although further sequencing is necessary to determine the exact similarity between the biosynthetic gene clusters of our isolated strain and the described FK520 producer strains, the obtained results show relative high difference between the same genes of the FK520 biosynthetic gene cluster of the two species. The detailed comparison of the known FK520 producer S. hygroscopicus strain and the newly isolated S. tubercidicus strain will

Nitrogen sources utilization of Mexican isolates and Streptomyces tubercidicus DSMZ 42 761 Strain no.

DL-Alanine DL-a-Amino-n-Butyric L-Arginine L-Asparagine L-Cysteine L-Glutamine Glycine L-Histidine L-Hydroxyproline L-Leucine L-Methionine L-Ornithine L-Phenylalanine Sarcosine L-Serine L-Threonine L-Valine KNO3 (NH4)SO4

acid

25 672

25 794

26 557

DSMZ 42 761

++ +++ ++ +++ + ++ +++ +++ +/ ++ + ++ ++ +/ ++ ++ ++ ++ +/

++  ++ +++ + ++ +++ +++ +/ ++ + ++ ++ +/ ++ +/ ++ ++ +

++ + ++ +++ + +++ +++ +++ + ++ + ++ ++ + ++ + ++ ++ +

++  +++ ++ ++ +++ ++ +++ ++ +++ ++ ++ +++ +/ + +/ ++ ++ +

Abbreviations: +,++,+++ : positive,: negative, +/ : doubtful.

ARTICLE IN PRESS Production of FK520 by Streptomyces tubercidicus

631

1 10 20 30 40 50 60 GGGAGATCTTCACCGACCGCTGCTACCTGCGCCATGGCATCGAGCTGCGTGCGGGGGGCG GGGAGATCTTCACCCAGCGCTGCTACCTGCGCCACGGTGTCGACCTGCGCCCGGGGGACG GGGAGATCTTCACGGACCGCTGCTATCTGCGCCACGGCGTCGAACTGCGCCCGGGGGACG AGGAGATCTTCGCCGAGCGGTGCTACTTGCGGCGCGGCCTTGAGCTGCGAGCGGGTGACG 70 80 90 100 110 120 TGGTGTTCGACATCGGCGCGAACATCGGCATGTTCACGCTTTTCGCTCATCTGGAGTGTT TGGTGTTCGACGTCGGCGCGAACATCGGCATGTTCACGCTTTTCGCGCATCTGGAGTGTC TGGTGTTCGACGTCGGCGCCAACATCGGCATGTTCATGCTCTTCGCCCATCTCGAACATC TGGTCTTCGACGTCGGCGCGAACATCGGCATGTTCTCGCTCTTCGCCCACCTGGAGTGCC 130 140 150 160 170 180 CGGGTGTGACCGTGCACGCCTTCGAGCCTGCGCCGGTGCCGTTCGCGGCGCTGCGAGCGA CTGGTGTGACCGTGCACGCCTTCGAGCCCGCGCCCGTGCCGTTCGCGGCGCTGCGGGCGA CCGGTGTGACCGTGCACGCCTTCGAACCCGCGCCTGTGCCGTTCGCCGCACTGCGGGCGA CCGATGTCACGGTGCACGCCTTCGAGCCGGCGCCGGTGCCGTACGCCGCGCTCAGGGCCA 190 200 210 220 230 240 ACGTCATGCGGCACGGCATTCCGGGCTGTGCGGAGCAGTGCGCGGTCTCCGACATGGCGG ACGTGACGCGGCACGGCATCCCGGGCCAGGCGGACCAGTGCGCGGTCTCCGACAGCTCCG ACGCGGTACGGCACCGCGTCGCCGGCCGGGTGGACCAGTGCGCCGTTTCCGACGAGGCCG ATGCCGAGCGGTACGCCATCGCGGGCCGGTTCGAGCAGTGCGCGGTCTCGGACGTGGCCG 250 260 270 280 290 300 GCGTCCAGAAGATGACCTTCTACCTTGACGCCACACTGATGTCCGGCTTCCACGCGGATG GCACCCGGAAGATGACCTTCTATCCCGACGCCACGCTGATGTCCGGTTTCCACGCGGATG GCGTACGCAGGATGACGTTCTACCCCGACGCCACGCTGATGTCCGGTTTCCACCCGGACG GCCGCGGCAAGATGACGTTCTACACGGATACCACGATGATGTCGGGCTTCCACCCGGATC 310 320 330 340 350 360 CCGCCGCCCGGACGGAGCTGTTGCGCACACTCGGCCTCAACGGCGGTTATACCGCTGAGG CCGCGGCCCGGACGGAGCTGTTGCGCACGCTCGGCCTCAACGGCGGCTACACCGCCGAGG CCGCCGCCCGCAAGGAGCTGCTGCGCACCCTCGGCCTCAACGGCGGCTACACCGCTGAGG CGGCGACCCGCGCGGAGCTGCTGCGCAGGCTCGCCATCAACGGCGGGTACAGTGCCGAGG 370 380 390 400 410 420 ACGTCGACACCATGCTCGCGCAACTGCCCGACGTCAGCGAGGAGATCGAAACCCCTGTGG ACGTCGACCTCATGCTCGCGCAACTGCCCGACCAGAGCGAGGAGATCGAGACTCCTGTGG ACGTCGACATGATGCTCGCCCAACTGCCCGACACGGGAGAGGAGATCGAAACCTCGGTCG CCGCCGACCGGATGCTGGCCGAGCTGCCGGACACCAGCCAGGTGATCGAGACGTCCGTCG

TCCG TCCG TCCG TACG

Figure 3. Comparison of the 424 bp sequence of the 31-O-demethyl-FK520 methyltransferase gene, amplified from the isolated S. tubercidicus strain to that of the FK520 producer S. hygroscopicus var. ascomyceticus, to the 31-O-demethylFK506 methyltransferase gene of the FK506 producer Streptomyces sp. and to the methyltransferase gene of the rapamycin producer S. hygroscopicus. The bases, which differ from the appropriate bases in the sequence amplified from the S. tubercidicus strains, are highlighted with bold style and gray background. First line: S. tubercidicus; second line: S. hygroscopicus var. ascomyceticus; third line: FK506 producer Streptomyces sp.; fourth line: rapamycin producer S. hygroscopicus.

provide useful information about the evolutionary change of the FK520 biosynthetic gene cluster.

References Borel, J.F., Feurer, C., Gubler, H.U., Stahelin, H., 1976. Biological effects of cyclosporin A: a new antilymphocyte agent. Agents Actions 6, 468–475.

Byrne, K.M., Shafiee, A., Nielsen, J.B., Arison, B.H., Monaghan, R.L., Kaplan, L., 1993. The biosynthesis and enzymology of an immunosuppressant, immunomycin, produced by Streptomyces hygroscopicus var ascomyceticus. In: Nash, C., Hunter-Cevera, J., Cooper, R., Eveleih, D.E., Hamill, R. (Eds.), Developments in Industrial Microbiology Series, vol. 32. Wm. C. Brown Publisher, Dubuque, IA, pp. 29–47. Garrity, G.M., Heimbuch, B.K., Motamedi, H., Shafiee, A., 1993. Genetic relationships among actinomycetes that produce the immunosuppressant macrolides

ARTICLE IN PRESS 632 FK506, FK520/FK523 and rapamycin. J. Ind. Microbiol. 12, 42–47. + J., Boros, S., Jekkel, A., Barta, I., Ko ´nya, A., Su ¨to, Horva ´th, Gy., Ambrus, G., 2001. Microbiological transformation of mycophenolic acid. J. Mol. Catal. B: Enzymatic 11, 423–426. Kahn, J.N., Byrne, K.M., Kaplan, L., Monaghan, R.J., 1992. Aspergillus niger mutants. US patent application no. 5,318,895. Kino, T., Hatanaka, H., Miyata, S., Inamura, N., Nishiyama, N., Yajima, T., Goto, T., Okuhara, M., Kohsaka, M., Aoki, H., Ochiai, T., 1987. FK506, a novel immunosuppressant isolated from a Streptomyces. J. Antibiot. 40, 1256–1265. Motamedi, H., Shafiee, A., 1998. The biosynthetic gene cluster for the macrolactone ring of the immunosuppressant FK506. Eur. J. Biochem. 256, 528–534. Motamedi, H., Shafiee, A., Cai, S., Streicher, S., Arison, B.H., Miller, R.R., 1996. Characterization of methyltransferase and hydroxylase genes involved in the biosynthesis of the immunosuppressants FK506 and FK520. J. Bacteriol. 178, 5243–5248. Nakamura, G., 1961. Studies on antibiotic actinomycetes. II. On Streptomyces producing a new antibiotic tubercidin. J. Antibiot. (Tokyo) Ser. A 14, 90–93. Nonomura, H., 1974. Key for classification of 458 species of the streptomycetes included in ISP. J. Ferment. Technol. 52, 78–92. Regentin, R., Cadapan, L., Ou, S., Zavala, S., Licari, P., 2002. Production of a novel FK520 analog in Streptomyces hygroscopicus: improving titer while minimizing impurities. J. Ind. Microbiol. Biotechnol. 28, 12–16.

A. Ko ´nya et al. Shirling, E.B., Gottlieb, D., 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 16, 313–340. Shirling, E.B., Gottlieb, D., 1968a. Cooperative description of type cultures of Streptomyces. II. Species desciptions from first study. Int. J. Syst. Bacteriol. 18, 69–189. Shirling, E.B., Gottlieb, D., 1968b. Cooperative description of the type cultures of Streptomyces. III. Additional species descriptions from first and second studies. Int. J. Syst. Bacteriol. 18, 279–392. Shirling, E.B., Gottlieb, D., 1969. Cooperative description of type cultures of Streptomyces. IV. Species descriptions from second, third and fourth studies. Int. J. Syst. Bacteriol. 19, 391–512. Shirling, E.B., Gottlieb, D., 1972. Cooperative description of type cultures of Streptomyces. V. Additional descriptions. Int. J. Syst. Bacteriol. 22, 265–394. Szabo ´, I.M., Marton, M., Buti, I., Fernandez, C., 1975. A diagnostic key for the identification of ‘‘species’’ of Streptomyces and Streptoverticillium included in the International Streptomyces Project. Acta Bot. Acad. Sci. Hung. 21, 387–418. Takafumi, U., Fumihiro, F., Naoki, N., 2002. Identification of genes coding enzymes for ascomycin tetra-hydropyranose ring formation. Int. J. Mol. Med. 9, 141–145. Williams, S.T., Goodfellow, M., Alderson, G., Wellington, E.M.H., Sneath, P.H.A., Sackin, M.J., 1983. Numerical classification of Streptomyces and related genera. J. Gen. Microbiol. 129, 1743–1813. Wu, K., Chung, L., Revill, W.P., Katz, L., Reeves, C.D., 2000. The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251, 81–90.