Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3 Tunisian strain

Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3 Tunisian strain

Accepted Manuscript Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3...

3MB Sizes 0 Downloads 16 Views

Accepted Manuscript Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3 Tunisian strain

Ahlem Eddehech, Zarai Zied, Fatma Aloui, Nabil Smichi, Alexandre Noiriel, Abdelkarim Abousalham, Youssef Gargouri PII: DOI: Reference:

S0141-8130(18)34745-7 https://doi.org/10.1016/j.ijbiomac.2018.11.050 BIOMAC 10927

To appear in:

International Journal of Biological Macromolecules

Received date: Revised date: Accepted date:

7 September 2018 9 November 2018 9 November 2018

Please cite this article as: Ahlem Eddehech, Zarai Zied, Fatma Aloui, Nabil Smichi, Alexandre Noiriel, Abdelkarim Abousalham, Youssef Gargouri , Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3 Tunisian strain. Biomac (2018), https://doi.org/10.1016/ j.ijbiomac.2018.11.050

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Production, purification and biochemical characterization of a thermoactive, alkaline lipase from a newly isolated Serratia sp. W3 Tunisian strain

Ahlem Eddehech1, Zarai Zied1*, Fatma Aloui1, Nabil Smichi1, Alexandre Noiriel2, Abdelkarim

Laboratory of Biochemistry and Enzymatic Engineering of Lipases, National School of

SC

1

RI

PT

Abousalham2, Youssef Gargouri1.

Engineers of Sfax, University of Sfax, PB 1173, Km 4 Road Soukra, Sfax, Tunisia. Université Lyon 1, Institut de Chimie et de Biochimie Moléculaires et Supramoléculaires

NU

2

AC

CE

PT E

D

F-69622 Villeurbanne cedex, France.

MA

(ICBMS), UMR 5246 CNRS, Métabolisme, Enzymes et Mécanismes Moléculaires (MEM2),

(*) To whom correspondence should be addressed. Dr. Zied Zarai: Laboratory of Biochemistry and Enzymatic Engineering of Lipases, National School of Engineers of Sfax, University of Sfax, PB 1173, Km 4 Soukra Road, Sfax, Tunisia. Phone/Fax: 216 74 675 055 E-mail: [email protected]

1

ACCEPTED MANUSCRIPT Abstract: A newly isolated Serratia sp. W3 strain was shown to secrete a non-induced lipase in the culture medium. Lipolytic activity was optimized using the response surface methodology (RSM) and the extracellular lipase from Serratia sp. W3 (SmL) was purified to homogeneity with a total yield of 10% and its molecular mass was estimated of about 67 kDa by SDS-PAGE. The amino

PT

acid sequence of the first 7 N-terminal residues of SmL revealed a high degree of homology

RI

with other Serratia lipase sequences. The purified SmL can be considered as thermoactive

SC

lipase, its maximal specific activity measured at pH 9 and 55°C was shown to be 625 U/mg and 300 U/mg using tributyrin and olive oil emulsion as substrate, respectively. In contrast to other

NU

described Serratia lipases, SmL was found to be stable at a large scale of pH between pH 5 and pH 12. SmL was also able to hydrolyze its substrate in presence of various oxidizing agents as

MA

well as in presence of surfactants and some commercial detergents. Then, considering the overall biochemical properties of SmL, it can be considered as a potential candidate for

D

industrial and biotechnological applications, such as synthesis of biodiesel and in the detergent

CE

PT E

industry.

Keywords: Serratia; lipase; optimization, response surface methodology, purification;

AC

characterization; thermo-alkaline.

2

ACCEPTED MANUSCRIPT Introduction Lipases (EC 3.1.1.3) represent an important variety of biotechnologically valuable enzymes [1, 2]. They are widely distributed in nature and numerous purified varieties are already wellcharacterized [3-4-5]. In fact, the enzymes extracted from microorganisms are the most interesting because of their potential applications in various industries such as food, dairy,

PT

pharmaceuticals, detergents, textile, biodiesel, cosmetics, synthesis of fine chemicals,

RI

agrochemicals, and new polymeric materials [6, 7].

SC

Bacterial lipases are classified into eight different families based on amino acid sequence and biochemical properties [8]. Family I.3 is represented by lipases from Serratia marcescens and

NU

Pseudomonas fluorescens, segregated from other lipases not only by their amino acid sequences but also by their secretion models and biological properties [9]. Serratia species are gram-

MA

negative bacilli belonging to the family of Enterobacteriaceae, which are opportunistic to human, plant and insect. These species are widespread in various biotopes from soil, water,

PT E

D

plants and air.

The lipase A from Serratia genus containing = 613–614 amino-acid residues and a molecular

CE

mass of about 65 kDa was described [10, 11]. This enzyme was used to produce a large scale of the racemic 3-(4-methoxyphenyl) glycidic acid methyl ester, which is a chiral precursor for

AC

diltiazem synthesis, a calcium-channel blocker and coronary vasodilator [12]. Enzyme production by microorganisms is affected by culture medium composition and growth conditions. Response surface methodology (RSM) has been strictly adopted to optimize microbial enzyme production [13, 14]. This experimental design method presents a useful model for studying the effect of several parameters influencing the responses by varying them simultaneously and at a minimum number of experimental tests [15].

3

ACCEPTED MANUSCRIPT The lack of industrial scale-up of lipases previously described from Serratia genus may be due to their relatively low stability and catalytic activity inadequate to the industrial process conditions (high temperatures, extreme pH values or non-aqueous solvents); hence the importance of looking for Serratia lipases with properties suitable for practical applications.

PT

Thermostable lipases are more appropriate to industrial processes because the reactions might be performed at elevated temperatures and therefore the structure of enzyme is maintained in

RI

extreme conditions. Further advantages include increased solubility of lipid substrates in water,

SC

faster reaction and reduced possible risk of contamination [16, 17].Therefore, the overall purpose of this work is to identify a new strain Serratia sp. W3 isolated from palm leaf and

NU

optimize the culture conditions for a maximum production of a thermo-active, alkaline and

MA

detergent-stable lipase. Further, the obtained lipase purification and biochemical

AC

CE

PT E

D

characterization was sought to respond to biotechnological application requirements.

4

ACCEPTED MANUSCRIPT Materials and methods 1-Bacterial strains, plasmids, and media Tributyrin (99%, puriss.) and benzamidine were obtained from Fluka (Buchs, Switzerland). Sodium deoxycholic acid (NaDC), sodium taurodeoxycholic acid (NaTDC), casein peptone, yeast extract and ethylene diamine tetraacetic acid (EDTA) were purchased from Sigma

PT

Chemical (St. Louis, USA); Arabic gum was from Mayaud Baker LTD (Dagenham, United

RI

Kingdom); protein molecular mass marker and supports of chromatography used for lipase

SC

purification: Sephacryl S-100, monoQ-Sepharose and DEAE-cellulose gels were from Amersham; acrylamide and electrophoresis grade were from BDH (Poole, United Kingdom);

NU

pH-stat was from Metrohm (Switzerland).

MA

2-Source of strains

In order to study some of their enzymatic potentials, a set of bacterial strains, isolated from

D

several different Tunisian biotopes of which we quote date palm leaf, located in the Nefta oasis

PT E

north of “Chott Djerid”, and industrial effluents from the Sfax region were the subject of a qualitative test followed by a quantitative one in order to screen their lipolytic activities for potentiality to degrade olive oil.

CE

3-Isolation and screening of lipolytic bacterium

AC

Initial screening of lipolytic microorganisms from various Tunisian biotopes was carried out using a plate assay in a medium containing triacylglycerol and the fluorescent dye Rhodamine B [18]. The solid medium contains 1‰ olive oil, 1% nutrient broth, 1% NaCl, 1.5 g agar and 1‰ Rhodamine B. The culture plates were incubated at 37°C, and colonies giving orange fluorescence halos around them, upon UV irradiation, were regarded as putative lipase producers [18]. Among the variable isolates, W3 showed the maximum zone formation of 10 mm on tributyrin medium at 37°C of incubation after 24 h. Qualitatively screened lipolytic bacteria W3 were subjected to quantitative screening by assaying their enzyme activity under 5

ACCEPTED MANUSCRIPT submerged fermentation with medium A containing: 17 g/L peptone, 5 g/L yeast extract, 2.5g/L K2HPO4, 5 g/L NaCl, pH 7, and finally selected for further studies. 4-Identification of the isolated strain The bacteria were identified by morphological and physiological characterizations, including

PT

Gram reaction, motility, cell morphology growth under anaerobic conditions, catalase and oxidase production, as well as other tests included in the species description. The biochemical

RI

tests were conducted using the API 20NE system. The identification was further improved via

bacterial

colonies

by

a

set

buffer

SC

the 16S rRNA gene sequencing method. Briefly, genomic DNA of W3 was extracted from method

and

amplified 3’)

CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC

universal

3’)

and

(5’

reverse

(5’

primers.

PCR

MA

NU

CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG

using

amplification was programmed to carry out an initial denaturation step at 94°C for 3 min, 30 cycles of denaturation at 94°C for 1 min, annealing at 53°C for 1 min and elongation at 72°C

PT E

D

for 2 min, followed by a final amplification step at 72°C for 3 min. The 16S rRNA gene sequence was compared with sequences available in the nucleotide database using the BLAST

CE

nucleotide algorithm at the NCBI. 5-Lipase activity measurement

AC

Lipase activity was measured titrimetrically at pH 9 and 55°C with a pH-stat, under standard conditions described previously [19], using tributyrin or olive oil emulsions as substrates in the presence of 3 mM CaCl2 and 1 mM NaDC. One unit of lipase activity corresponds to 1 µmol of fatty acid liberated per minute under standard conditions. Protein concentration was determined as described by Bradford [20] using bovine serum albumin (BSA) as the reference protein.

6

ACCEPTED MANUSCRIPT 6-Optimization of enzyme production Preliminary Studies Preliminary studies have been carried out in order to select the best nitrogen and carbon sources based on the classical method ‘one variable at a time’. Different conditions were tested with several sources of carbon (casein, glucose, maltose, esters (Tween 80 and Tween 20),

PT

triglycerides (olive oil and soya oil)) and different organic and inorganic nitrogen sources (urea,

RI

yeast extract, soy flour, NH4Cl).

SC

One factor approach experiment was adopted to study the effect of incubation temperature, incubation time and agitation speed on enzyme production (Fig.S1). Obtained results revealed

NU

that the lipolytic activity reached its maximum at 30°C and 200 rpm. The follow-up of lipolytic

MA

activity’s kinetics showed that the beginning of the growth phase was at 32 h. The production of the lipase was triggered from the beginning of the growth phase and reached its maximum

D

activity at the end of the exponential phase corresponding to 32 h of culture.

PT E

The experiments were made in 250 mL Erlenmeyer flasks with a useful volume of 50 mL on a nutrient broth (medium A) from a 16-h old pre-culture (Optical Density (OD) at 600 nm = 0.08),

CE

the pH was set at 7. The culture was incubated aerobically during 32 h on a rotary shaker set at 200 rpm and at a temperature of 30°C.

AC

We adopted a planning experimental methodology to enhance the production of SmL by Serratia sp.W3. These include a first screening by Plackett-Burman design and an optimization by a Box Benkhen Design. Plackett - Burman designs According to the preliminary study, it was assumed that the extracellular lipase production depended on seven parameters (yeast extract, peptone, tryptone, NaCl, K2HPO4, glucose and pH). In order to determine which of these potential parameters had a statistically significant 7

ACCEPTED MANUSCRIPT effect on the enzyme synthesis, a Plackett-Burman (PB) design with 15 experiments was carried out. The variables were analyzed at three levels of their values: high (+1), baseline (0) and low (-1). The baseline level (0) corresponded to central values of the screening design. The levels attributed to each variable were determined based on results of preliminary study (data not

PT

shown). Box Benkhen

RI

The factors selected based on the screening design as having a significant effect on lipolytic

SC

activity were subjected to further optimization with RSM using a Box–Benkhen experimental design. The variables were prescribed into three levels, coded -1, 0 and 1. Consequently, all the

NU

involved factors’ level combinations were constructed.

MA

7-Production and purification of Serratia sp. W3 lipase The culture medium from Serratia sp. W3 was prepared under optimal conditions for 32 h of

D

incubation at 30°C and 200 rpm. Cells were discarded by centrifugation (25 min, 8470 g) and

(65% saturation) at 4°C.

PT E

the resulting crude enzyme solution (500 mL) was precipitated with solid ammonium sulfate

CE

The precipitate obtained after centrifugation was then resuspended in 25 mM sodium acetate, pH 5.4 containing 25 mM NaCl and 2 mM benzamidine (buffer A) and insoluble material was

AC

removed by centrifugation at 8470 g during 5 min. The obtained sample (10 mL) was loaded on a Sephacryl S-100 column (2.5 cm × 150 cm) pre-equilibrated with buffer A. It was then eluted with the same buffer at a flow rate of 30 mL/min. The lipase activity was checked as previously described and the elution profile of proteins was monitored at 280 nm. The active fractions were applied to the second step of purification on Mono Q Sepharose anion exchanger (2 cm × 20 cm) column pre-equilibrated with buffer A. Adsorbed material was then eluted with a linear NaCl gradient (200 mL of 150–500 mM in buffer A) at a flow rate of 60

8

ACCEPTED MANUSCRIPT mL/h. The active fractions were eluted between 250 and 400 mM NaCl, collected and concentrated with ultrafiltration disk membranes with a cut-off of 50 KDa. The samples were washed three times with 3× 50 mL of buffer B (25 mM Tris–HCl, pH 8) to remove NaCl. The enzyme solution was finally applied to a DEAE-Cellulose anion exchanger pre-equilibrated in buffer B using Amersham Biosciences AKTA FPLC System. The column (1.5 x 5 cm) was

PT

washed with 50 mL of the same buffer. No lipase activity was detected in the washing flow.

RI

Adsorbed material was eluted with a linear NaCl gradient (100 mL of 20–500 mM in buffer B)

SC

at a rate of 60 mL/h. The lipase activity was eluted between 200 and 300 mM NaCl. Active and pure fractions were stored at 20°C until used for biochemical characterization.

NU

8-Gel electrophoresis and N-terminal sequence analysis

MA

The purified lipase was analyzed electrophoretically by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) on 15% gel according to the Laemmli method [21]. The N-

D

terminal amino-acid sequence was determined by automated Edman’s degradation using an

PT E

Applied Biosystems protein sequencer [22]. 9-Biochemical characterization

Effect of pH and temperature on SmL activity and stability

CE

-

AC

Investigation for the optimum pH of purified lipase activity was carried out in various buffers at different pH (5-10.5) at 50°C. The pH stability of the SmL was determined by incubating the lipase in buffer solutions with different pH values (3-12) at 100 mM for 2 h at 4°C. The residual lipase activity was determined, after centrifugation, under standard assay conditions. The optimal temperature for the purified lipase was determined by performing the enzymatic assay on pH stat at a heat range from 30 to65°C) at pH 9. Thermal lipase stability was determined by incubating the enzyme solution at different temperatures (30–60°C) and pH 5.4 for 60 min. The residual lipase activity was determined, after centrifugation, under standard 9

ACCEPTED MANUSCRIPT assay method, the non-heated lipase, which was left at room temperature, was considered as the control (100% of enzymatic activity). -

Effect of metal ions on the SmL activity

Divalent metal cations play an important role in the structure and function of proteins. Various

PT

metal ion (Mg2+, Fe2+, Cu2+, Ca2+) requirement in SmL activity was tested at pH 9 and 55°C

in the presence of increasing metal ion concentrations. Effect of detergent on SmL activity and stability

SC

-

RI

with pH-stat. Experiments were performed as described above using tributyrin as the substrate

NU

In order to investigate the effect of bile salts on SmL activity, the hydrolysis rate of the tributyrin by the SmL was measured at 55°C and pH 9 in the presence of 3 mM CaCl2 and with increasing

MA

NaDC concentration.

D

The effect of surfactant agents (10%, v/v for 1h at 40°C) on Sml stability was also checked.

-

PT E

Residual SmL activity was measured at pH 9 and 55°C. Stability of SmL in organic solvents

CE

The SmL stability in organic solvents was determined by mixing purified lipase with increasing concentrations (10%, 50%) of different solvents (dimethylsulfoxide, methanol, ethanol,

AC

isopropanol and acetone) for 24 h of incubation. The mixture was incubated after vortex at room temperature with shaking. Samples were withdrawn periodically to determine the residual activity under standard conditions using tributyrin as substrate.

Results and discussion 10

ACCEPTED MANUSCRIPT 1-Lipase production According to the screening of isolates on Rhodamine B agar plate, two lipase-producing bacteria were obtained. Only one, namely W3, showed a lipolytic activity of 6 U/mL on tributyrin and 4 U/mL on an olive oil emulsion via a quantitative enzymatic test using the pH

PT

stat technique. Various preliminary tests were carried out with a view to choosing the best components of the

RI

medium (carbon source, phosphorus nitrates, etc). In light of results, peptone and yeast extracts

SC

were found the most suitable for a better lipase production by W3. In fact, they are sources of amino acids and bacteria growth factors; and also contain cofactors and vitamins essential for

NU

the development of bacteria and the production of metabolites.

MA

2-Identification of the strain

The 1000 nucleotides amplified by PCR were sequenced and the results exhibited a 99%

D

identity with different species belonging to Serratia genus. Eventually, the sequence was

PT E

submitted in the genomic database as a new Serratia sp. W3 Tunisian cultivar under the following accession number MH762127.

CE

3-Optimization of enzyme production

AC

Bacterial ability to produce lipases is highly dependent on the strain and bacterial medium composition influencing the enzyme synthesis and its activity. In this study, we aimed to select the most influential factors using the PB approach among a large number of variables. Reducing the number of parameters to be taken into account in modeling makes it possible to minimize the coefficients to be identified in the models and consequently the experiments to be carried out for this operation. According to this assumption, six medium components (yeast extract, peptone, tryptone, NaCl, K2HPO4, glucose) and one operational parameter (pH) were

11

ACCEPTED MANUSCRIPT tested using a 15-run matrix. These parameters were studied at three levels of value (Table 1). The PB results indicated a variation of lipase activity in the range from 0 to 6 U /mL in fifteen trials. This wide range proved the importance of this step in selecting the most involved factors and fixing the level of less influential ones.

PT

The lipolytic activity data were statistically analyzed within a PB design using the Design Expert software to estimate t-value represented by the Pareto-chart diagram, the sum of squares

RI

and percentage of contribution of each factor in the response (data not shown). The factor

SC

contribution rates and the Pareto chart data which present, in rod form and in ascending order,

are peptone, yeast extract, tryptone and pH.

NU

the t-Value of the effects of different parameters studied showed that the most influential factors

MA

In fact, wheat peptone, yeast extract and tryptone concentration had a positive effect on lipase production, while the pH exhibited a negative one. When the sign of the effect of the tested

D

variable is positive, the response is greater at a high level of the parameter, and vice versa.

PT E

Thus, on a set of 7 parameters estimated as potentially influential, 4 factors had a significant involvement in the observed responses and the statistically insignificant variables, i.e. glucose,

CE

K2HPO4 and NaCl, were discarded in the successive optimization stage.

AC

-Lipolytic activity optimization using response surface methodology (RSM) Peptone, yeast extract, tryptone and pH, the most influential factors in lipolytic activity, were optimized using a Box Behnken design (Table S1). For a plan with 4 factors, 27 experiments were necessary. In order to reduce this number, the pH was discarded and the three other factors were chosen as critical variables affecting lipase production. For each experiment, the remaining factors were maintained at KH2PO4 0 % (negative effect -0.5 and low contribution percentage 1.11), glucose 0.5 %, NaCl 0.5 % and pH 7.

12

ACCEPTED MANUSCRIPT The mathematical model in terms of coded factors is expressed as follows: R1 =+12.00 +2.63 * A+0.44 * B+2.06 * C-0.50 * A * B+1.75 * A * C-1.63 * B * C-2.56 * A^2-3.44 * B^2-5.19 * C^2 Where R1 is the estimated lipolytic activity and A, B and C the coded values for peptone, yeast

PT

extract and tryptone, respectively. Statistical significance of model equations was evaluated by ANOVA based on Fisher's test.

RI

The analysis of the variance shows that the sum of the squared deviations (SS) evaluated with

SC

14 degrees of freedom (dof) is divided into two sums of squares. The first, estimated at 9 dof, is due to regression (to factors) which encompasses the effects of factors and interactions

NU

between them. The second, estimated with 5 ddl, is attributed to the residual variation.

MA

The ANOVA of the regression model (table 2) demonstrates that the model is highly significant. This is evident from the calculated F-value (Fmodel =10.46) and probability value

D

(p = 0.0094).

PT E

The individual effect of peptone (p = 0.0067), and tryptone (p=0.0174) and the interaction effect of peptone versus peptone (0.0319), tryptone versus tryptone (p=0.0019), yeast extract versus

CE

yeast extract (0.0108) and peptone versus tryptone (0.0902) were found to be the most significant factors influencing lipolytic activity. These results were confirmed by the Student’s

AC

t-test (α = 0.05).

The fit of the model was also expressed by the correlation coefficient R2 found to be 0.95, indicating that 95% of the variability in the response (lipolytic activity) could be explained by the model which proves a high significance of the adjustment. The closer the values of R2 to 1, the better the model would explain the variability between the experimental and the model predicted values. Adjusted R2 (0.86) confirms the good agreement between the experimental and the predicted results.

13

ACCEPTED MANUSCRIPT -Graphical interpretation of the mathematic model The fitted model was used to draw curves that reflect the independent effect of peptone, yeast extract and tryptone concentration in culture medium on lipolytic activity. The surface curves (Fig. 1) show that a high lipolytic activity can be reached when using high concentrations of

PT

both peptone and tryptone. - Optimum point

RI

The response optimizer in Design Expert software was used to find the optimum value of the

SC

variables for maximum lipolytic activity by Serratia sp W3. The optimum value of the variables in actual unit was predicted as 14.9 g/L casein peptone, 3.7 g/L tryptone, 2.2 g/L yeast extract,

NU

3 g/L NaCl, 5 g/L glucose, the pH being set at 7 and the temperature at 30°C with the predicted

MA

maximum lipolytic activity of 12.93 U/mL. The organism produced 13 U/mL, thus confirming the validity. The lipase production yield (13U/mL) was absolutely more important than the one

D

obtained during the preliminary study (5 U/mL). Thus, lipase activity was multiplied by a factor

PT E

of 2.6-fold. The expected result (13 U/mL) was very close to the experimental result (12.93 U/mL). By optimizing the medium composition and the culture conditions, not only the

CE

production of lipase was enhanced but also the cost of enzyme production was reduced. 4-Purification of SmL

AC

The SmL was purified as described in the “Materials and Methods” section. The extracellular lipase was purified to homogeneity from the culture medium of Serratia sp. W3. The enzyme was precipitated with 65% saturation of ammonium sulfate used as a starting material for further purification. The precipitate was solubilized in minimum buffer A and loaded to Sephacryl S100 gel filtration column. Protein elution was performed with the same buffer. Fractions containing SmL activity (Fig. 2A) were pooled and loaded on Mono-Q Sepharose column. The peak of lipase activity emerged at 300 mM NaCl (Fig. 2B). Fractions containing lipase activity

14

ACCEPTED MANUSCRIPT were finally gathered and applied to a DEAE cellulose column equilibrated with buffer B. The elution profile of the SmL obtained after this step is shown in Fig. 2C. Pure SmL was eluted between 250 and 350 mM NaCl. SDS-PAGE analysis showed that the pure enzyme exhibited one band corresponding to a molecular mass of about 67 kDa (Fig. 3). Many lipases from Serratia had a molecular mass of

PT

62-67 kDa with pI 4.5-5.8 [23, 24]. The purification flow sheet is shown in Table 3. The

RI

specific activity of the pure enzyme reached 625 U/mg and 300 U/mg using TC4 and olive oil

SC

as substrate, respectively, in the presence of 3 mM CaCl2, 1 mM NaDC at pH 9 and 55°C. These data indicate that the enzyme has a preference for short-chain triacylglycerol substrates. No

NU

phospholipase activity was detected when using egg PC as the substrate in the same

MA

experimental conditions.

The lipase activity of this protein was further confirmed by zymogram assay under native conditions (data not shown). Only one band of the enzyme showing triacylglycerol hydrolysis

PT E

D

was revealed and that fits well with the molecular mass of purified lipase. 5- N-terminal sequence analysis of SmL.

CE

The SmL NH2-terminal sequencing allowed the identification of 7 residues, I-F-S-Y-K-D-L. This N-terminal sequence exhibited a high degree of homology with lipases of the same

AC

previously characterized genus (Table 4) [23, 24] and with that of a thermostable lipase from P. fluorescens SIK W1 [25]. 6- Biochemical characterization 6.1. Effects of pH on SmL activity and stability The pH stability of the SmL was determined by pre-incubating the enzyme over a wide pH range of 3–12 for 1 h at room temperature and as shown in Fig. 4A, the SmL was highly stable over a broad pH range and maintained 100% of its maximal activity between pH 5.0 and 7.0 15

ACCEPTED MANUSCRIPT and 60 % at pH 12. Our results differ from those reported in the literature for related lipases. For instance, Zaki and Saeed (2012) [26] showed that maximum stability of lipase from one strain of Serratia marcescens was at pH 8; but under pH 5, the lipase lost about 50% of its activity. Abdon (2003) [27] reported lipase stability of psychrophilic Serratia marcescens between 8-9 while maximum stability of lipase from S. grimisii was reported to be between of

PT

7-9 [28].

RI

Moreover, the pH activity profile of the purified lipase is shown in Fig. 4B. The results showed

SC

that the purified enzyme displayed activity over a broad range of pH (7–11), with an optimum at pH 9 and at pH 10.5 the enzyme keeps more than 60% of its maximum activity. Under the

NU

same experimental conditions, Matsumae and Shibatani (1994) [23] reported that the lipase

MA

activity of Serratia marcescens Sr41 8000 is maximal at pH 8; while at pH 9, the enzyme retains less than 40% of its activity is totally cancelled at pH 10, while Gao et al. (2004) [29] and Bachkatova and Severina (1980) [30] showed that optimum pH for lipase activity was 6.5 and

PT E

D

6.3, respectively from two other Serratia genus strains. 6.2. Effect of temperature on SmL activity and stability.

CE

The effect of temperature on SmL stability was determined by measuring the residual SmL activity after incubation of the pure enzyme at various temperatures (Fig. 4 C). The thermal

AC

stability profile of the purified enzyme showed that the lipase was inactivated at high temperatures (above 55°C). The enzyme retained more than 50% or 30% of its initial activity after 30 min of incubation at 50°C and 60°C, respectively. These results are in accordance with earlier works [27] that found that lipase activity from S. marcescens is not as thermostable as other bacterial lipases. However, according to previous studies, calcium ions could enhance the thermo-stability of the family I.3 lipase [12]. This was confirmed with our extracellular lipase (this study). In fact, the

16

ACCEPTED MANUSCRIPT effect of Ca2+ supplementation at a final concentration of 3 mM was clearly noticed almost in the whole range of temperatures compared to that without the addition of the ions. The SmL is able to retain more than 70% of its initial activity in the presence of calcium ions even at 60°C. Hence, calcium ions apparently play a key role in maintaining the three-dimensional conformation of SmL at extreme temperatures.

PT

The effect of temperatures in SmL activity was also studied by assaying the enzyme activity at

RI

different temperatures (Fig 4 D). Results showed that the lipase was active at temperatures

SC

ranging from 30°C to 60°C and activity increased significantly with temperature to reach its maximum value at 55°C. This high activity at 55°C may be explained by the presence of

NU

calcium ions in the assay medium which could stabilize the conformation of the enzyme.

MA

These results show that SmL is a thermo-active enzyme, unlike all the Serratia lipases previously described by Bachkatova and Severina (1980) [30], which showed that the highest lipase activity was from S. marcescens strain 345 at 45°C. In addition, Abdon (2003) [27]

PT E

D

reported an optimal temperature of lipase activity of one S. marcescens strain at 37°C, and Immanuel et al. (2008) [31] revealed an optimal temperature of lipase activity of S. rubidaea between 25 and 35°C. In fact, extremozymes can be used in industrial reactions that are not

CE

feasible at ambient temperature. High temperature is preferable in many chemical reactions to

AC

guarantee higher solubility of substrates, better mixing, faster reaction rate, lower viscosity, and decreased risk of microbial contamination [32]. 6.3. Effect of metal ions on SmL activity Different ions (Ca2+, Cu2+, Mg2+ and Fe2+) were studied for their influence on the purified Serratia sp. W3 lipase activity. As shown in Fig. 4 E, calcium ions play the role of a cofactor for the SmL. The presence of this ion in the assay medium was shown to be the most effective in increasing lipase activity to reach a maximum of 625 U/mg using tributyrin as substrate at 55°C and at pH 9. Indeed, previous studies have reported that the lipases from Serratia genus 17

ACCEPTED MANUSCRIPT are defined as calcium-stimulated and are already known to contain a Ca2+ binding site near the active site that affects the stability and activity of the lipases. Furthermore, the addition of Ca2+ drastically enhances the lipase activities. [33, 34]. Magnesium ion is also demonstrated to be a for SmL catalysis which reaches a maximum level

PT

of hydrolysis (480 U/mg) in the presence of 3 mM of Mg2+ in the assay medium. However, Cu2+ and Fe2+ seem to be SmL activity inhibitors. In fact, in absence of these metal ions and in

RI

presence of 10 mM EDTA, our enzyme shows its maximum specific activity of the order of

SC

300 U/mg. This activity decreases by increasing the concentration of Cu2+ and Fe2+. Our data are in accordance with the results published by Zaki and Saeed (2012) [26] which exhibited that

NU

Zn2+ and Cu2+ ions depressed the Serratia marcescens N3 lipase activity while Mg2+ and Ca2+ were found to stimulate it. The same results were found by Pogori et al. (2008) [35] with an

MA

extracellular lipase from Rhizopus chinensis while Yu et al. (2007) [36] proved that Ba2+ and

6.4. Effect of detergents on SmL activity and stability.

PT E

.

D

Mn2+ are the two main stimulators of Yarrowia lipolytica lipase.

Aware of the importance of surfactants to the preparation of emulsions for lipase assays and

CE

their characterization, we studied the effect of a commercial detergent (NaDC) on the SmL activity. As shown in Fig. 4 F, the presence of bile salts seems to enhance the SmL activity up

AC

to a limit concentration of 1 mM, which reaches an optimum of 625U/mg. Comparable results were obtained with some bacterial lipases as Staphylococcus simulans [37], Staphylocococcus aureus [38] and fungal lipases as Fusarium solani [39]. This detergent has no inhibitory effect on the SmL activity even at a large concentration of bile salts (7 mM) unlike what has been described for the lipase of R. oryzae lipase activity [40]. Besides, the stability of the enzyme in the presence of some surfactants was studied. As shown in figure 5, SmL was highly stable towards some known surfactants after 1 h incubation at 18

ACCEPTED MANUSCRIPT 40°C and retained its full activity in the presence of 20 mM Triton TX-100, Tween 80, NaDC and NaTDC; while in the presence of SDS, the purified enzyme was noted to be less stable and lost about 75% of its initial activity. This is in contrast with bibliographical results where Serratia marcescens ECU1010 lipase was stable in the presence of different surfactant agents such as Pg400de, Pg250de and Tween-80, and Triton X series, such as Triton X-45 and Triton

PT

X-100, inhibited the activity seriously [41].

RI

6.5. Effect of organic solvents on SmL stability

SC

The organic solvent tolerance of any of the lipases from Serratia species has not been widely

NU

reported so far. In this report, the stability of the purified SmL with respect to certain solvents generally miscible with water was tested and results were expressed in terms of residual activity

MA

compared to an untreated control. It is well known that microbial lipases are rarely stable in hydrophobic organic solvents. However, Serratia Sp. W3 lipase has shown extremely high

D

stability (Table 5), at a concentration of 10% of water-miscible organic solvents. The lipase did

PT E

not show a drastic decrease in residual activity after 24 h incubation, with better stability in the presence of DMSO, an organic solvent widely used to dissolve proteins to some extent. These

CE

data were in agreement with Zhao et al. (2008) [41] who proved in a previous study that the DMSO at 10% concentration activated a lipase from Serratia marcescens ECU1010. Besides,

AC

SmL was shown quite stable, remaining active after 24 h of preincubation in the presence of neat hydrophilic solvents such as acetone and isopropanol, respectively with 83 and 77.0% of initial activity.

Interestingly, the purified lipase retained activity even after preincubation at a concentration of 50% of water-miscible organic solvents although the activity level did not exceed 30% of the initial activity for all the solvents tested. This stability of Serratia sp. W3 lipase against organic solvents elects it as a potential candidate for application in the synthesis of esters.

19

ACCEPTED MANUSCRIPT Conclusions In this study, Plackett– Burman and Box–Behnken designs were employed to optimize the culture conditions for the production of a novel lipase by a newly isolated Serratia sp. W3 Tunisian cultivar from palm leaves. Lipase was purified to homogeneity at 157-fold of purity and showed a specific activity of 625 U/mg and 300 U/mg on tributyrin and olive oil emulsion,

PT

respectively. When fully characterised, the SmL displayed high stability in a variety of

RI

industrially relevant organic solvents and in the presence of surfactants. Furthermore, SmL

SC

displayed interesting biochemical criteria such as the high stability in a wide pH range and activity at high temperature and at alkaline conditions, suggesting that this enzyme may be a

NU

suitable candidate for bio-transformations in the food and pharmaceutical industries.

MA

Additionally, the novelty of Serratia sp. W3 strain, and the lipase explored here with its unique stability characteristics, makes this enzyme a potential catalyst for other biotechnological

D

applications such as synthesis of biodiesel, biodegradable biopolymers for application in the

Acknowledgments

PT E

detergent industry.

This study was supported by “Ministry of Higher Education Scientific research Tunisia”

CE

through a grant to “Laboratory of Biochemistry and Enzymatic engineering of Lipases - ENIS”.

AC

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES [1] R.Verger, “Interfacial activation” of lipases: Facts and artifacts, Trends in Biotechnology. 15 (1997) 32-38.

20

ACCEPTED MANUSCRIPT [2] R.D. Schmid, R.VergerLipases: Interfacial enzymes with attractive applications. Angewandte Chemie International Edition. 37 (1998) 1609-1633. [3] H. Horchani, N. Ben Salem, Z. Zarai, A. Sayari, Y. Gargouri, M. Chaabouni, Enzymatic synthesis of eugenol benzoate by immobilized Staphylococcus aureus lipase: optimization

PT

using response surface methodology and determination of antioxidant activity, Bioresource Technology. 101 (2010) 2809– 2817.

RI

[4] H. Horchani, I. Aissa, S. Ouertani, Z. Zarai, A. Sayari, Staphylococcal lipases:

SC

Biotechnological applications, Journal of Molecular Catalysis B: Enzymatic. 76 (2012) 125-

NU

132.

[5] Z. Zarai, M. BouAli, A. Fendri, H. Louati, H. Mejdoub, Y. Gargouri, Purification and

MA

biochemical properties of Hexaplex trunculus digestive lipase, Process Biochemistry. 47 (12) (2012) 2434-2439

PT E

D

[6] R.K. Saxena, P.K. Ghosh, R. Gupta, W.S. Davidson, S. Bradoo, R. Gulati, Microbial lipases: potential biocatalyst for the future industry, Current Science. 77 (1999) 101–115.

(2002) 390-397.

CE

[7] K.E. Jaeger, T. Eggert, Lipases for Biotechnology, Current Opinion in Biotechnology. 13

AC

[8] J. Arpigny, K. Jaeger, Bacterial lipolytic enzymes: classification and properties, Biochemical Journal. 343 (1999) 177–183. [9] K. Amada, M. Haruki, T. Imanaka, M. Morikawa, S. Kanaya, Overproduction in Escherichia coli, purification and characterization of a family I.3 lipase from Pseudomonas sp. MIS38. Biochimica et Biophysica Acta. 1478 (2000) 201–210.

21

ACCEPTED MANUSCRIPT [10] Z. D. Long, J.H. Xua, L. L. Zhao, J. Pan , S. Yang, L. Hua. Overexpression of Serratia marcescens lipase in Escherichia coli for efficient bioresolution of racemic ketoprofen, Journal of Molecular Catalysis B: Enzymatic. 47 (2007) 105–110. [11] M. Mohammadi, Z. Sepehrizadeh, A. Ebrahim-Habibi, A.R. Shahverdi, M.A.Faramarzi,

PT

N. Setayesh, Bacterial expression and characterization of an activerecombinant lipase A from Serratia marcescens with truncated C-terminalregion, Journal of Molecular Catalysis B:

RI

Enzymatic. 120 (2015) 84–92.

SC

[12] R. Meier, T. Drepper, V. Svensson, K.-E. Jaeger, U. Baumann, A calcium-gatedlid and a

NU

large _-roll sandwich are revealed by the crystal structure of extracellular lipase from Serratia marcescens, Journal of Biological Chemistry. 282 (2007) 31477–31483.

MA

[13] A. Shyamala Devi, K. Chitra Devi, R. Rajendiran , Optimization of Lipase Production Using Bacillus subtilis by Response Surface Methodology. International Journal of Biological,

D

Biomolecular, Agricultural, Food and Biotechnological Engineering. (2012) Vol:6, N:9.

PT E

[14] C . Luciane Maria , P. Andreiza Lazzarotto , B. Silvia, L . Raquel Aparecida, D.M. Marieli, R. Christian Oliveira , B.Telma Elita , V.C , Surface response methodology for the

CE

optimization of lipase production under submerged fermentation by filamentous fungi.

AC

Brazilian Journal of Microbiology. 47 (2016) 461-467.

[15] R. Kaushik , R. G. Marwah , P. Gupta , S. Saran , L. Saso , V. S. Parmar , R. K. Saxena , Optimization of Lipase Production from Aspergillus terreus by Response Surface Methodology and Its Potential for Synthesis of Partial Glycerides Under Solvent Free Conditions. Indian J Microbiol . 50(4) (2010) 456–462.

22

ACCEPTED MANUSCRIPT [16]

Y.R. Abdel-Fattah, Optimization of thermostable lipase production from athermophilic

Geobacillus sp: using Box-Behnken experimental design, Biotechnology Letters. 24 (2002) 1217–1222. [17] P. Rathi, V. Goswami, V. Sahai, R. Gupta, Statistical medium optimization andproduction

PT

of a hyperthermostable lipase from Burkholderia cepacia in abioreactor, Journal of Applied Microbiology. 93 (2002) 930–936.

SC

Environmental Microbiology. 53(1) (1987) 211-3.

RI

[18] G, Kouker K.E. Jaeger, Specific and sensitive plate assay for bacterial lipases, Applied and

NU

[19] D.A. Six, E.A. Dennis, The expanding superfamily of phospholipase A2 enzymes: classification and characterization, Biochimica et Biophysica Acta. 1488 (5) (2000) 1-19.

MA

[20] M.M. Bradford, Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding, Analytical Biochemistry. 72 (1976)

PT E

D

248-254.

[21] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of

CE

bacteriophage T4, Nature. 227 (1970) 680–5. [22] R.M. Hewick, M.W. Hunkapiller, L.E. Hood,W.J. Dreyer, Journal of Biological

AC

Chemistry. 256 (1981) 7990–7997. [23] H. Matsumae, T. Shibatani, Purification and Characterization of the Lipase from Serratia marcescens Sr41 8000 Responsible for Asymmetric Hydrolysis of 3-Phenylglycidic Acid Esters , journal of fermentation and bioengineering. 77 (2) (1994) 152-158. [24] R. Meier, T. Dripper , V. Svensson , Karl-Erich Jaeger, and Ulrich Baumann . A Calciumgated Lid and a Large _-Roll Sandwich Are Revealed by the Crystal Structure of Extracellular Lipase from Serratia marcescens, Journal of Biological Chemistry. 282 (2007) 31477-31483. 23

ACCEPTED MANUSCRIPT [25] G.H. Chung, Y.P. Lee, G.H. Jeohn, O.J. Yoo, and J.S. Rhee, Cloning and nucleotide sequence of thermostable lipase gene from Pseudomonas fluorescens SIK W1, Agricultural and biological chemistry. 55 (1991) 2359-2365. [26] N.H. zaki, S.E. Saeed, Production, purification and characterization of extra cellular lipase from Serratia marcescens and its potential activity for hydrolysis of edible oils, Journal of Al

PT

Nahrain University. 15 (2012) 94-102.

lipase,

Journal

of

Dairy

Science.

86

(2003)

127



132.

SC

marcescens

RI

[27] A.M. Abdon, Purification and partial characterization of Psychrotrophic Serratia

[28] A.M. Abdou, Studies on some Gram -negative Proteolytic and lipolytic microorganisms

NU

in milk and milk products. Ph.D Thesis., Zagazig Univ. (Benha branch), kaliobyia, Egypt,

[29]

MA

(1997).

L. Gao, J. Xu, Z.Z. Lin, Optimization of Serratia marcescens lipase Production for

D

enantioseletive hydrolysis of 3-Phenylglycidic acid ester. J. of Industrial Microbiology and

[30]

PT E

Biotechnology. 31 (11) (2004) 525–530.

N. A. Bachkatova, L. O. Severina, Isolation and charaterization of intracellular lipase

CE

from Serratia marcescens. 345. Prik. Biokhim Mikobiol. 16 (3) (1980) 315 – 26.

AC

[31] G. Immanuel, A. Jwbadhas, A. palaresam, Investigation of lipase production by milk isolate, Serratia rubidaea, Food Technology and Biotechnology. 46 (1) (2008) 60 -65. [32] S. Mechri, M. Kriaa, M. Ben Elhoul Berrouina, M. Omrane Benmrad, N. Zaraî Jaouadi, H. Rekik, K. Bouacem, A. Bouanane-Darenfed, A. Chebbi, S. Sayadi, M. Chamkha, S. Bejar, B. Jaouadi, Optimized production and characterization of a detergent-stable protease from Lysinibacillus fusiformis C250R, International Journal of Biological Macromolecules. 101 (2017) 383-397.

24

ACCEPTED MANUSCRIPT [33] H. Akatsuka, E. Kawai, K. Omori, S. Komatsubara, T. Shibatani, T. Tosa, The lipA gene of Serratia marcescens which encodes an extracellular lipase having no N-terminal signal peptide, Journal of Bacteriology. 176 (1994) 1949–1956. [34] K. Amada, M. Haruki, T. Imanaka, M. Morikawa, S. Kanaya, Overproduction

PT

inEscherichia coli, purification and characterization of a family I: 3 lipase fromPseudomonas sp. MIS38, Biochimica et Biophysica Acta (BBA). 1478 (2000) 201–210.

RI

[35] M. Yu, Q. Shaowei, T. Tan, Purification and characterization of the extracellular lipase

SC

Lip 2 from Yarrowia lipolytica. J. Bacteriol. 138 (2007) 663–670.

[36] N. Pogori, A. cheikyoussef, D. Wang, Production and biochemical characterization of an

NU

extra cellular lipase from Rhizopus chinensis CCTCC M201021. Biotechnology. 7 (2008) 710

MA

– 717.

[37] A. Sayari, N. Agrebi, S. Jaoua, Y. Gargouri, Biochemical and molecular characterization

H. Horchani, H. Mosbah, N. Ben Salem, Y. Gargouri, A. Sayari. Biochemical and

PT E

[38]

D

of Staphylococcus simulans lipase, Biochimie. 83 (2001) 863–871.

molecular characterization of a thermoactive, alkaline and detergent-stable lipase from a newly

(2009) 237–245.

CE

isolated Staphylococcus aureus strain, Journal of Molecular Catalysis B: Enzymatic. 56

AC

[39] R. Jallouli, F. Khrouf , A. Fendri , T. Mechichi , Y. Gargouri , S. Bezzine . Purification and Biochemical Characterization of a Novel Alkaline (Phospho)lipase from a Newly Isolated Fusarium solani Strain, Applied Biochemistry and Biotechnology.168 (2012), 2330–2343. [40] A . Ben Salah, A. Sayari, R.Verger, Y. Gargouri ,Kinetic studies of Rhizopus oryzae lipase using monomolecular film technique, Biochimie. 83(6) (2001) 463-469.

25

ACCEPTED MANUSCRIPT [41] Z. Li-Li , X. Jian-He, Z. Jian, P. Jiang, W. Zhi-Long, Biochemical properties and potential applications of an organic solvent tolerant lipase isolated from Serratia marcescens ECU1010.

AC

CE

PT E

D

MA

NU

SC

RI

PT

Process Biochemistry. 43 (2008) 626–633.

26

ACCEPTED MANUSCRIPT Figure captions Fig. 1 Response surface plot of SmL production showing the mutual interaction between (A) yeast extract (X1) and peptone (X2) concentrations at constant value of tryptone (0.25 %), (B) tryptone (X3) and yeast extract (X1) concentrations with peptone fixed at 1 %, (C) tryptone

PT

(X3) and peptone (X2) concentrations at constant yeast extract value (0.25 %). Fig. 2 Purification of SmL. (A) Chromatography profile of SmL from on Sephacryl S-100 gel

RI

filtration column. Protein elution was performed with buffer A at a flow rate of 30 mL/min as

SC

described in Material and Methods. Fractions containing SmL activity were pooled and loaded

NU

on Mono-Q Sepharose column (B). The peak of lipase activity emerged at 300 mM NaCl. The pooled active and dialyzed SmL fractions from the Mono-Q Sepharose column were applied to

MA

a DEAE cellulose column (5 x 1.5 cm) (C). Non-fixed proteins were washed out with the same buffer in the absence of NaCl. The elution of the adsorbed proteins was performed with a linear

D

gradient of NaCl (0–500 mM). The flow rate was 60 ml/h and the fraction size was 1 ml.

PT E

Fig. 3 SDS-PAGE analysis of purified SmL in a 12 % polyacrylamide gel . Lane 1, molecular mass markers, lanes 2 and 3 : DEAE-Cellulose purified lipase fractions.

CE

Fig. 4 pH effect on the SmL activity (A) and stability (B): The enzyme activity was determined by measuring the activity at various pH and after incubation the pure SmL for 1 h in different

AC

buffer solutions at various pH ranging from 3 to 12. The activity of the enzyme at pH 5.4 was taken as 100%. (C) Temperature effect on enzyme activity and stability (D): SmL activity was tested at various temperatures and after 30 min of incubation in the presence and absence of CaCl2 at different temperatures. The activity of the non-heated enzyme was taken as 100%. In all experiments, lipase activity was measured under standard conditions using TC4 as substrate. (E) Effect of the concentration of metal ions on SmL activity. Lipase activity was measured at increasing concentrations of metal ions using tributyrin as substrate in the presence of 1 mM NaDC. The star indicates the enzymatic activity measured in the absence of any metal ions 27

ACCEPTED MANUSCRIPT traces and in the presence of 10 mM EDTA. (F) Effect of increasing concentration of bile salts (NaDC) on lipase activity in presence of 3 mM CaCl2 using the tributyrin as substrate as substrate. Each point represents the mean of three independent experiments. Fig. 5. Lpase stability of SmL in presence of surfactants. SmL preparation was incubated in presence of surfactants (20 mM), commercial detergents (1%, w/v) and oxidizing agents (10%, v/v) for 1 h at 40

AC

CE

PT E

D

MA

NU

SC

RI

PT

◦C. Residual SmL activity was determined at pH 9 and 55 ◦C. All experiments were done in triplicate.

28

ACCEPTED MANUSCRIPT Table 1. The various media components included in PB experiments and their corresponding higher (+1), medium (0), and lower (-1) concentration levels. Level

Variables

0

+1

Yeast extract

0

0.25

0.5

Peptone

0

1

2

Tryptone

0

0.25

NaCl

0

0.25

0.5

K2HPO4

0

0.25

0.5

Glucose

0

0.5

1

pH

7

NU

SC

RI

PT

-1

8

AC

CE

PT E

D

MA

7.5

0.5

29

ACCEPTED MANUSCRIPT Table 2. ANOVA analysis for Sml from Serratia sp. W3 activity in Box Benkhen design experiments Sum of Squares df Mean Square F Value Prob > F

Model

262.30

9

29.14

10.46

0.0094

A-Peptone

55.13

1

55.13

19.78

0.0067

B-Yeast extract

1.53

1

1.53

0.55

0.4919

C-Tryptone

34.03

1

34.03

12.21

0.0174

AB

1.00

1

1.00

0.36

0.5753

AC

12.25

1

12.25

BC

10.56

1

10.56

A^2

24.25

1

24.25

B^2

43.63

1

C^2

99.36

Residual

13.94

Lack of Fit

13.94

Pure Error

0.00

Total

276.23

RI SC

0.0902 0.1091

8.70

0.0319

43.63

15.65

0.0108

1

99.36

35.65

0.0019

5

2.79

3

4.65

2

0.00

NU

3.79

MA D

4.39

14

AC

CE

PT E

Significant

PT

Source

30

ACCEPTED MANUSCRIPT Table 3. Flowsheet of the purification procedure of SmL. See Materials and Methods for details. One unit (U) corresponds to micromole of fatty acid released per minute using tributyrin as substrate under the experimental conditions used. Activity measurements are described in Materials and Methods.

Total protein (mg)

Total activity (U)

Specific activity (U/mg)

Culture supernatant

1280

5100

3.98

100

1

(NH4)2SO4 (70 %)

273

1700

6.2

33

1.55

6

1200

198

23.52

50

Mono-Q Sepharose column

1.75

720

410

13.72

103

DEAE Cellulose column

0.72

450

625

10

157

Purification (fold)

PT

RI SC

Yield (%)

AC

CE

PT E

D

MA

Sephacryl S-100 column

NU

Purification step

31

ACCEPTED MANUSCRIPT Table 4 : N-terminal sequence comparison of SmL (present study) with SM6, ES-2 and ECU 1010 lipases. SmL SM6 ECU 1010 ES-2

--MGIFSYKDLDEKASKALFSDALAI SHMGIFSYKDLDENASKALFSDALAI --MGIFSYKDLDENASKALFSDALAI --MGIFSYKDLDENASKALFSDALAI

Present study [26] [24] [24]

a

AC

CE

PT E

D

MA

NU

SC

RI

PT

Amino acid sequences for comparison were obtained using the program BLAST-P (NCBI, NIH, USA) database. b SmL residue not identical with the sequences of other Serratia lipases is indicated in red letter.

32

ACCEPTED MANUSCRIPT Table 5: Stability of Serratia Sp. W3 lipase in the presence of various organic solvents. The enzyme was incubated 24h under shaking condition at 25 ◦C in the presence of one solvent (10%, v/v) and (10%, v/v), and then the residual activity was determined at pH 9 and 55 ◦C using tributyrin as substrate. The control was measured after incubation of the esterase in absence of organic solvent.

Residual activity (%)

(10%, v/v)

(50%, v/v)

97

Ethanol

87

Acetone

77

Isopropanol

83

RI

DMSO

SC

90

17 23 18 13 26

AC

CE

PT E

D

MA

Methanol

PT

Residual activity (%)

NU

Organic solvents

33

Figure 1

Figure 2