Progesterone attenuates demyelination and microglial reaction in the lysolecithin-injured spinal cord

Progesterone attenuates demyelination and microglial reaction in the lysolecithin-injured spinal cord

Neuroscience 192 (2011) 588 –597 PROGESTERONE ATTENUATES DEMYELINATION AND MICROGLIAL REACTION IN THE LYSOLECITHIN-INJURED SPINAL CORD L. GARAY,a,b V...

2MB Sizes 7 Downloads 30 Views

Neuroscience 192 (2011) 588 –597

PROGESTERONE ATTENUATES DEMYELINATION AND MICROGLIAL REACTION IN THE LYSOLECITHIN-INJURED SPINAL CORD L. GARAY,a,b V. TÜNGLER,a,c,d M. C. G. DENISELLE,a,b A. LIMA,a P. ROIGa AND A. F. DE NICOLAa,b*

Key words: demyelination, lysolecithin, microglial reaction, progesterone, remyelination.

a Laboratory of Neuroendocrine Biochemistry, Instituto de Biologia y Medicina Experimental-CONICET, Obligado 2490, 1428 Buenos Aires, Argentina

Multiple sclerosis (MS) is a major neurodegenerative disease that causes neurological disability in an estimated 2.5 million people worldwide. MS presents a gender preference, with a woman to man ratio of 2.6, although the incidence in women increases after menopause (Confavreux et al., 1998; Hughes, 2004). Interestingly, hormonal factors have been considered to play a pathogenic role in MS. Early studies report an association between lesion size of MS patients, low circulating progesterone levels and high estradiol levels during the sex cycle, suggesting a beneficial role of progesterone (Bansil et al., 1999; Pozzilli et al., 1999). The PRIMS (Pregnancy in Multiple Sclerosis) study concluded that relapses of MS are less frequent during the last trimester of pregnancy but reappear following delivery, supporting a protective role of sex steroids (El-Etr et al., 2005). This evidence led to the suggestion that progesterone-induced immunosuppression during human pregnancy may prevent relapses of MS (Confavreux et al., 1998; Hughes, 2004; Druckmann and Druckmann, 2005). Conclusive demonstrations regarding the neuroprotective and promyelinating role of progesterone in the central and peripheral nervous system (Melcangi et al., 2000; Azcoitia et al., 2003; Brinton et al., 2008; Schumacher et al., 2008; De Nicola et al., 2009), stimulated trials on its therapeutic value for MS and models of the disease such as experimental autoimmune encephalomyelitis (EAE) and cuprizone-induced demyelination. Earlier reports have shown variable effects of progesterone in EAE, ranging from inactivity, increased vulnerability of neurons to disease improvement if estradiol is combined with progesterone (Kim et al., 1999; Bebo et al., 2001; Hoffman et al., 2001). In particular, the synthetic progestin medroxyprogesterone acetate has shown a protective effect in EAE (Elliot et al., 1973). More recent evidence supports that progesterone provides beneficial effects to rodents with EAE. For example, progesterone treatment prior to EAE induction with myelin oligodendrocyte glycoprotein (MOG) attenuates the clinical scores of the disease, slightly delays disease onset and decreases demyelination foci, according to Luxol Fast Blue staining (LFB), myelin basic protein (MBP) and proteolipid protein (PLP) protein and mRNA expression. Key genes of motoneuron function and axonal parameters are also enhanced in EAE mice receiving progesterone (Garay et al., 2007, 2008, 2009). Another group has shown that progesterone given at the time of EAE induction reduces peak score and the cumulative disease index, decreases proinflammatory and increases antiflammatory chemokine secretion

b Department of Human Biochemistry, Faculty of Medicine, University of Buenos Aires, Paraguay 2155, 1425 Buenos Aires, Argentina c Institut für Pharmakologie und Toxikologie, Charité - Universitätsmedizin Berlin, Dorotheenstr. 94, 10117 Berlin, Germany d Klinik für Kinder- und Jugendmedizin, Technische Universität Dresden, Fetscherstr. 74, 01307, Dresden, Germany

Abstract—Progesterone treatment of mice with experimental autoimmune encephalomyelitis has shown beneficial effects in the spinal cord according to enhanced clinical, myelin and neuronal-related parameters. In the present work, we report progesterone effects in a model of primary demyelination induced by the intraspinal injection of lysophospatidylcholine (LPC). C57Bl6 adult male mice remained steroid-untreated or received a single 100 mg progesterone implant, which increased circulating steroid levels to those of mouse pregnancy. Seven days afterwards mice received a single injection of 1% LPC into the dorsal funiculus of the spinal cord. A week after, anesthetized mice were perfused and paraffin embedded sections of the spinal cord stained for total myelin using Luxol Fast Blue (LFB) histochemistry, for myelin basic protein (MBP) immunohistochemistry and for determination of OX-42ⴙ microglia/macrophages. Cryostat sections were also prepared and stained for oligodendrocyte precursors (NG2ⴙ cells) and mature oligodendrocytes (CC1ⴙ cells). A third batch of spinal cords was prepared for analysis of the microglial marker CD11b mRNA using qPCR. Results showed that progesterone pretreatment of LPCinjected mice decreased by 50% the area of demyelination, evaluated by either LFB staining or MBP immunostaining, increased the density of NG2ⴙ cells and of mature, CC1ⴙ oligodendrocytes and decreased the number of OX-42ⴙ cells, respect of steroid-untreated LPC mice. CD11b mRNA was hyperexpressed in LPC-treated mice, but significantly reduced in LPC-mice receiving progesterone. These results indicated that progesterone antagonized LPC injury, an effect involving (a) increased myelination; (b) stimulation of oligodendrocyte precursors and mature oligodendrocytes, and (c) attenuation of the microglial/macrophage response. Thus, use of a focal demyelination model suggests that progesterone exerts promyelinating and anti-inflammatory effects at the spinal cord level. © 2011 IBRO. Published by Elsevier Ltd. All rights reserved. *Correspondence to: A. F. De Nicola, Laboratory of Neuroendocrine Biochemistry, Instituto de Biologia y Medicina Experimental, Obligado 2490, 1428 Buenos Aires, Argentina. Tel: ⫹54-11-47832869; fax: ⫹54-11-47862564. E-mail address: [email protected] (A.F. De Nicola). Abbreviations: EAE, experimental autoimmune encephalomyelitis; LFB, Luxol Fast Blue; LPC, lysophospatidylcholine; MBP, myelin basic protein; MS, multiple sclerosis; OPC, oligodendrocyte precursor cells; PBS, phosphate-buffered saline; PFA, paraformaldehyde.

0306-4522/11 $ - see front matter © 2011 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2011.06.065

588

L. Garay et al. / Neuroscience 192 (2011) 588 –597

(Yates et al., 2010). A recent study employing steroid treatment at the time EAE symptoms started has shown a progesterone-induced nuclear sublocalization of the Olig1 transcription factor involved in remyelination in addition to providing clinical benefit (Yu et al., 2010). In cotherapy with estrogens, progesterone is also effective to counteract not only EAE-induced spinal cord demyelination but also cuprizone-induced demyelination of the corpus callosum (Acs et al., 2009; Garay et al., 2008). Thus, evidence gathered in rodents with demyelination caused by EAE induction and cuprizone treatment support a potential therapeutic value for steroids in experimental models of MS. Among the mechanisms involved, it is known that progesterone exerts immunomodulatory effects to control the onset or progression of MS and EAE. Thus, increased progesterone levels during pregnancy modulates the immune system, changing a Th1 pro-inflammatory response into a Th2 anti-inflammatory response (Confavreux et al., 1998; Hughes, 2004; Druckmann and Druckmann, 2005). Furthermore, progesterone activates lymphocytes to secrete the non-inflammatory cytokines IL3, IL4, IL10 and to reduce the inflammatory cytokines IFN-␥, TNF␣ and IL2 (Szekeres-Bartho and Wegmann, 1986; Blois et al., 2007). The immunomodulatory effects of progesterone applies not only to autoimmune diseases but has also been postulated to alleviate the effects of traumatic central nervous system (CNS) injury (Stein and Fulop, 1998). In the present work, we induced spinal cord demyelination employing lysolecithin (LPC), to further assess progesterone effects in a focal demyelination model caused by a gliotoxin. A seminal study of Hall (1972) has shown that intraspinal injection of LPC induces changes typical of wallerian degeneration with disruption of the myelin sheath. Later on, Jeffery and Blakemore (1995) demonstrate that LPC demyelination extends well beyond the lesion site, with rapidity of repair. Remyelination that follows loss of myelin requires the recruitment of oligodendrocyte precursor cells (NG2⫹ cells), that differentiate and mature into myelin-producing oligodendrocytes if properly stimulated (Bruce et al., 2010). However, in contrast to the existence of reports showing the effects of different steroids in the EAE model, only glucocorticoids have been tested in LPC-induced demyelination (Triarhou and Herndon, 1986; Pavelko et al., 1998). In the present work, mice received progesterone prior to induction of a focal demyelination by the intraspinal injection of LPC. Our data showed that progesterone-treated mice showed less spinal cord demyelination, increased the density of NG2⫹ cells and of mature oligodendrocytes and decreased the expression of a maker of reactive microglia/ macrophages, suggesting the possibility for direct steroid effects on the spinal cord.

EXPERIMENTAL PROCEDURES Experimental animals Male C57BL/6 mice (9 –11 weeks old) remained untreated or received s.c. a single 100 mg progesterone pellet (Sigma-Aldrich, St. Louis, MO, USA) under xylazine (6 mg/kg) and ketamine (75 mg/kg) anesthesia. A week afterwards, both groups of mice were anesthetized as before, secured on a flat surface and a dorsal

589

laminectomy was carried out in the upper thoracic region of the spinal cord closed to the midline. The dura mater was incised and the dorsal funiculus of the spinal cord exposed after opening the pia mater. One microlitre of a 1% solution of LPC (Sigma Aldrich, St. Louis, MO, USA) in sterile phosphate-buffered saline (PBS, pH 7.4) was slowly delivered with a Hamilton syringe into the dorsal funiculus. The injection site was macroscopically localized by the addition of Evan’s Blue dye to the LPC solution. The blue spot detected the injection site at T1-T3. The whole procedure was performed under a binocular dissecting microscope. The wound was closed in two layers and mice were left undisturbed for 1 week before killing for the different experiments. In this way, two groups of LPC-injected mice were prepared, that is, with or without progesterone pre-treatment. In addition, we prepared a third. group of steroid-untreated mice that received intraspinal injections of PBS only (control mice). Clinical signs in LPC-injected mice consisted of loss of tail tonicity, body shaking and unsteady gait. Clinical signs were absent from PBS-injected controls. Animal procedures followed the Guide for the Care and Use of Laboratory Animals (NIH Guide, Institute’s Assurance Certificate # A5072-01) and were approved by the Institute’s Animal Care and Use Committee.

LFB histochemistry and MBP immunostaining Anesthetized mice were perfused transcardially with a solution containing 4% paraformaldehyde (PFA) in 0.1 M sodium phosphate buffer pH 7.4. Thoracic spinal cords were removed, postfixed in the same fixative for 2.5 h and embedded in paraffin. All tissues were treated in an identical manner to evaluate toxininduced-demyelination. Each thoracic spinal cord was embedded in paraffin and subdivided into five blocks (A–E) 200 ␮m in thickness. From block A, 5 ␮m coronal slices were cut with a microtome starting on the top edge of the lesion site marked by Evan’s Blue staining. A total of eight slices were laid sequentially on a microscope slide, comprising a 40 ␮m section of the thoracic spinal cord. This procedure was repeated five times, in order to analyse the entire 200 ␮m section for demyelination. The next block B was discarded. For blocks C and E the procedure was identical to block A, whereas tissue contained in block D was discarded. The first slide from blocks A, C and E was deparaffinized and stained with LFB to mark the area of demyelination. LFB staining was carried out according to Kim et al. (2006). Sections were treated with 95% ethanol and left in LFB solution (0.1 mg% Luxol Fast Blue in 95% ethanol with 10% acetic acid) at 60 °C for 18 h. After several washes, sections were immersed in lithium carbonate, and then 70% ethanol, rinsed in distilled water, dried and mounted with Permount. The area of white matter demyelination, lacking LFB staining, was determined by computerized image analysis and expressed as described below. MBP immunocytochemistry (Labombarda et al., 2002) was performed in blocks A, C and E previously selected for LFB staining. Five-micrometre sections of paraffin-embedded spinal cords were deparaffinized and treated with 0.3% hydrogen peroxide in methanol for 30 min to block endogenous peroxidase. Immunocytochemistry was carried out using a 1:500 dilution of rabbit anti-MBP primary antibody (Code AO623, Dako Cytomation, Carpinteria, CA, USA) diluted in PBS containing 1% goat serum. After the overnight incubation at 4 °C and several washes with PBS, sections were incubated with a goat anti-rabbit IgG secondary antibody, diluted 1/200 (Vector laboratories, CA, USA) for 1 h at 22 °C, then with avidin-biotin-peroxidase (ABC) complex for 30 min (ABC kit Vector laboratories, CA, USA) and finally revealed with 0.5 mg/ml diaminobenzidine tetrachloride (Sigma Aldrich, St. Louis, MO, USA) in the presence of 0.01% H2O2 for 7 min in the dark. The sections were given a final rinse in PBS, dehydrated in graded ethanols and xylene, and mounted with Permount. For quantitative evaluation, areas showing negative LFB histochemical staining or MBP immunostaining were delimited at

590

L. Garay et al. / Neuroscience 192 (2011) 588 –597

several regions of the spinal cord (dorsal, lateral or ventral funiculus) by computerized image analysis using Optimas VI software (Ferrini et al., 1995; Labombarda et al., 2006). Surface areas of these regions were added up and demyelination for each spinal cord section was expressed as a percentage of the total surface area of white matter sampled (Mathisen et al., 2001; Papadopoulos et al., 2006). After examination of 24 representative sections of spinal cords per animal, the 12 most demyelinated sections were averaged to obtain an independent figure for each animal (n⫽6 – 8 animals per experimental group), as performed before using the EAE model (Garay et al., 2007).

systems, Foster City, CA, USA). Relative gene expression data were calculated using the 2⫺⌬⌬ct. method (Livak and Schmittgen, 2001), and it was determined as fold induction with respect to its respective control. For each amplification, 2 ng cDNA/␮l of reaction was used and PCR was performed in triplicate under optimized conditions: 95 °C at 10 min followed by 40 cycles at 95 °C for 0.15 s and 60 °C for 1 min. Primer concentration was 0.2 ␮M. We used five animals per control, LPC and LPC plus progesterone groups.

Immunostaining of NG2ⴙ oligodendrocyte precursors, CC1ⴙ mature oligodendrocytes and OX-42 microglia/macrophages

The content of serum progestins was determined using a CoatA-Count progesterone RIA Kit (Diagnostic Product Corporation, Los Angeles, USA) and results expressed as ng/ml serum. Intraand interassay coefficient of variation were 3.6 and 5.6%, respectively.

Mice were perfused with 4% PFA, the spinal cords extracted, post-fixed in this fixative for 2.5 h at 4 °C, cryoprotected by immersion in 20% sucrose overnight and kept frozen at ⫺80 °C until used. Thirty-micrometre cryostat transversal sections were permeabilized with 0.5% Triton X-100/3% normal goat serum in PBS for 10 min at 37 °C. For NG2 and CC1 immunocytochemistry, previously published methods were followed (Labombarda et al., 2002, 2006; Meyer et al., 2010). Sections were rinsed in PBS and incubated with specific antibodies prepared in 2% goat serum, 1% Triton X-100 in PBS overnight at 4 °C. For NG2 immunodetection, we used a 1/250 dilution of the rabbit NG2 polyclonal antibody (gift from Dr. Robert Stallcup, the Burnham Institute, La Jolla, CA, USA). Mature oligodendrocytes were stained with a 1/100 dilution of the mouse adenomatus polyposis coli (CC1) antibody (antiAPC AB-7, Cat. OP80, Calbiochem, USA). Microglial cells/macrophages were stained using a 1/200 dilution of the complement receptor 3 OX-42 mouse monoclonal antibody (Chemicon, Temecula, CA, USA). After several washes with PBS, sections were incubated with a 1/500 dilution of the anti-rabbit Alexa 488 (Invitrogen, Molecular Probes, Eugene, OR, USA) or anti-mouse Alexa 555 (Invitrogen, Molecular Probes, Eugene, OR, USA) for 60 min at room temperature. Sections were washed and mounted with Fluoromont-G (Southern Biotech, Birmingham, AL, USA). Photographs were taken under a Nikon Eclipse E 800 confocal laser microscope equipped with Nikon 11691 photographic equipment. Photographs were saved and further analyzed by a computerized image analysis system equipped with Optimas VI software. The number of NG2⫹, CC1⫹ and OX-42⫹ cells analyzed in a constant area was expressed per mm2 and the mean⫾SEM was statistically compared between the control, LPC and LPC⫹progesterone groups. Quantitative determination of CD11b mRNA by qPCR. For real time PCR, anesthetized mice were killed by decapitation and a 0.5 cm segment of the spinal cord from the site of LPC injection was removed and homogenized with a Polyitron homogenizer. Total RNA was then extracted using Trizol reagent (Life Technologies, Invitrogen, CA, USA). The concentration and purity of total RNA was determined by measuring the optical density at 260 and 280 nm. All samples were precipitated with ethanol and then dissolved in distilled water at a concentration of 1 ␮g/␮l. Total RNA was subjected to DNase 1 (Invitrogen) treatment (2 U for 10 min at room temperature) to remove residual contaminating genomic DNA. cDNA templates for PCR amplification were synthesized from 2 ␮g of total RNA using a SuperScript III RNase H reverse transcriptase kit (Invitrogen, CA, USA) for 60 min at 42 °C in the presence of random hexamer primers. Primers for qPCR were: forward 5=AAACCACAGTCCCGCAGAGA3= and reverse 5= CGTGTTCACCAGCTGGCTTA 3= (Reddy et al., 2009). Cyclofilin B was used as a housekeeping gene based on the similarity of mRNA expression across all samples templates. The relative gene expression for the mRNA of CD11b was determined using the ABI PRISM 7500 sequence Detection System (Applied Bio-

Progestin levels in serum

Statistical analysis Group differences for LFB staining, immunohistochemistry for MBP, CC1 and OX-42 and CD11b mRNA were determined by one-way ANOVA followed by Newman–Keuls post hoc test. Results were expressed as % demyelinated area/total white matter area (LFB), % area showing negative MBP staining/total MBP immunoreactive white matter area, or fold increase over the housekeeping gene signal in the case of CD11b mRNA. Densities of CC1⫹, NG2⫹ and OX-42⫹ cells were expressed as number of cells per mm2. A P⬍0.05 was considered significant.

RESULTS Serum progesterone levels Serum progesterone levels from heart blood collected at the time of killing revealed low values in control and LPCinjected male mice (2.87⫾0.55 and 4.77⫾1.81 ng/ml, respectively; P: NS). Instead, mice receiving progesterone pretreatment showed markedly increased serum progesterone levels (68.9⫾8.9 ng/ml, P⬍0.001 vs. control and LPC groups). These levels are in the range of serum progesterone reported for mouse pregnancy (Holinka et al., 1979). Effects of progesterone on LPC-induced demyelination determined by LFB histochemical staining and MBP immunostaining Light microscopy observations of control spinal cords showed uniform LFB staining of the ventral, lateral and dorsal funiculus of the white matter (Fig. 1A). In contrast focal areas of demyelination, devoided of LFB staining, were detected at several levels of the thoracic spinal cord of LPC-injected mice, as shown in the representative photomicrograph of Fig. 1B. Fig. 1C shows fewer LFB unstained areas in LPC-injected mice with prior progesterone treatment, suggesting a less severe demyelination. Quantitative analysis of LFB-free areas in spinal cord blocks A, C and E (Fig. 1D) showed that LPC caused a 21.6% demyelination of white matter tracks. Instead, demyelination was decreased to 12% in the same spinal cord sections from LPC-treated mice receiving progesterone pretreatment, respect of steroid-naive LPC-treated mice (Fig. 1D; P⬍0.05). Immunostaining for MBP, one of the major central myelin proteins, was also used to analyze the effects of

L. Garay et al. / Neuroscience 192 (2011) 588 –597

591

Fig. 1. (A–C) Representative photomicrographs of Luxol Fast Blue histochemical staining in control (A), LPC (B) and LPC⫹progesterone pretreated mice (C). Asterisks indicate areas of demyelination in (B, C). (D) Quantitative data for % demyelination respect of total white matter area according to the absence of histochemical reaction to LFB in LPC and LPC⫹progesterone groups. Statistical comparison showed that % demyelination was lower in LPC mice pretreated with progesterone (* P⬍0.05) (n⫽6 mice per group).

progesterone on LPC-induced demyelination. Control mice showed uniform MBP staining of white matter tracts (Fig. 2A). Focal loss of MBP staining was observed at the dorsal, ventral and lateral funiculus of mice with intraspinal

LPC injection (Fig. 2B) whereas an important restoration of MBP immunostaining occurred in LPC mice receiving progesterone pretreatment (Fig. 2C). In quantitative terms, LPC-treated mice showed a 23.4% reduction of MBP im-

Fig. 2. Representative photomicrographs of myelin basic protein immonohistochemistry in control (A), LPC (B) and LPC⫹progesterone pretreated mice (C). Asterisks indicate the absence of MBP immunoreaction in (B, C). (D) Quantitative data for % demyelination respect of total white matter area according to MBP immunoreaction in LPC and LPC⫹progesterone pretreated groups. Statistical comparison showed that % area with absent MBP immunoreactivity was lower in LPC mice pretreated with progesterone (* P⬍0.05) (n⫽6 mice per group).

592

L. Garay et al. / Neuroscience 192 (2011) 588 –597

munostaining of white matter tracks in blocks A, C and E (Fig. 2D), whereas MBP immunostaining amounted to only 12.7% of white matter in the same sections from progesterone-treated mice (Fig. 2D; P⬍0.05). Therefore, % demyelination after LPC and following progesterone pretreatment were remarkably similar using LFB histochemistry or MBP immunohistochemistry. Effects of progesterone on oligodendrocyte precursors and mature oligodendrocytes in the spinal cord of mice with LPC-induced demyelination Because progesterone and the gliotoxin showed opposite effects on spinal cord myelin, we next studied the effects of these factors on oligodendrocyte precursors (NG2⫹ cells) and mature oligodendrocytes, using cell markers and immunocytochemical techniques coupled to computerized image analysis. As expected, NG2⫹ cell density was low in control spinal cords (Fig. 3A), whereas they increased in number in response to LPC injection (Fig. 3B). Importantly, NG2⫹ cell count was further stimulated in progesteronepretreated LPC-injected mice (Fig. 3C). Compared with control spinal cords, density of NG2⫹ cells was 2.8-fold higher 7 days after LPC administration (P⬍0.001) and 3.6-fold higher in the LPC group pretreated with progesterone (P⬍0.001). The last group was also significantly higher than steroid-naive LPC-treated mice (P⬍0.05) (Fig. 3D). However, the NG2 antibody shows a relative cell specificity, because it stains not only oligodendrocyte precursor cells (OPC) but also pericytes forming the outer sheath of microvessels (Ozerdem et al., 2002). We as-

sumed that NG2⫹ elongated cells with long processes are pericytes, whereas cells with staining of soma and short ramified processes are OPC. Fig. 3A shows two cells with OPC morphology and an asterisk-marked cell with pericyte morphology. For counting purposes, only cells with OPC morphology were taken into account, as shown in the NG2⫹ cells of Fig. 3B from an LPC mouse and in Fig. 3C from an LPC⫹progesterone treated mouse. In contrast to the LPC-induced stimulation of NG2⫹ cell density, CC1⫹ mature oligodendrocytes were extremely labile to the gliotoxin (Fig. 4A, B). Thus, density of CC1⫹ cells decreased from near 800 cells/mm2 in controls (Fig. 4A) to about 300 cells/mm2 in LPC-injected mice (Fig. 4B, D, P⬍0.001 vs. controls). Progesterone pretreatment partially prevented the loss of CC1⫹ cells caused by LPC (Fig. 4C). In spite of the fact that CC1⫹ cell density remained below control levels, mature oligodendrocyte number was significantly enhanced in the progesterone pretreated group over the steroid-naive LPC group (Fig. 4D; P⬍0.01). Progesterone decreases the inflammatory response to LPC-induced demyelination It is known that LPC-induced demyelination is accompanied by a strong inflammatory reaction involving microglia activation (Ousman and David, 2000; Ghasemlou et al., 2007). To test for this event under our experimental conditions, the quantitative expression of the reactive microglial marker CD11b mRNA was analyzed by qPCR in the thoracic cord around the lesion. Fig. 5 shows the fold

Fig. 3. Effects of progesterone on NG2⫹ cells in controls (A), LPC-injected mice (B) and progesterone pretreated LPC-injected mice (C) in the lateral funiculus close to the demyelination area. Asterisk in (A) points to an NG2⫹ cell with elongated profile, probably a pericyte. Instead, NG2⫹ oligodendrocyte precursors show immunoreactivity of soma and short processes. (D) Quantitative analysis demonstrated increased number of NG2⫹ cells with the morphology of oligodendrocyte precursors in LPC-induced demyelination (*** P⬍0.001 vs. controls). Progesterone pre-treatment of LPC-injured mice significantly stimulated NG2⫹ cell number above levels of LPC mice without steroid treatment (** P⬍0.01) and control mice. Results represent the mean number of NG2⫹ cells per mm2 (⫾SEM) (n⫽6 mice per group). Inset bar: 50 ␮m.

L. Garay et al. / Neuroscience 192 (2011) 588 –597

593

Fig. 4. Changes in the number of CC1⫹ cells (mature oligodendrocytes) in control (A), LPC (B) and LPC⫹progesterone pretreated (C) groups in the lateral funiculus close to the demyelination area. (D) Quantitative analysis in LPC-injected mice showed a down regulation of CC1⫹ cell density respect of controls (*** P⬍0.001). Progesterone pretreatment increased the density of CC1 positive cells over the LCP-injected group (** P⬍0.01) although a difference with controls still persisted. Results represent the mean number of CC1⫹ cells per mm2 (⫾SEM) (n⫽5 mice per group). Inset bar: 50 ␮m.

increase of CD11b mRNA in the three groups. As expected, this marker was poorly expressed in control spinal cords, whereas an eight-fold increase was measured in LPC-treated mice (P⬍0.001). Although in LPC-treated mice with prior progesterone treatment a 4.9-fold increment of CD11b mRNA was still measured (P⬍0.01 vs. control), this marker was significantly down-regulated by progesterone pretreatment compared to the LPC only group (P⬍0.01). The number of OX-42⫹ cells was also determined as a measure of microglial cell/macrophage proliferation and

activation in response to toxic injury and progesterone protection. In the area of demyelination, however, the OX-42 antibody did no stain single cells but a diffuse, patchy staining was found in all LPC-injected groups, preventing an accurate determination. The number of OX-42 cells was then determined in the funiculus ventrolateralis below the area of demyelination. Results showed the presence of 104⫾9 cells/mm2 in the LPC group and 58⫾9 cells/mm2 in the LPC⫹progesterone group (n⫽5– 6 mice per group; P⬍0.01). Thus, progesterone decreased the microglial/macrophage response developing in the spinal cord of LPC-injected mice according to results of CD11b mRNA and OX-42 immunocytochemistry.

DISCUSSION

Fig. 5. Quantitative analysis of the reactive microglial marker CD11b mRNA in thoracic spinal cord obtained by qPCR of control mice, LPC-injured mice and LPC-injured mice receiving progesterone pretreatment. Statistical analysis by ANOVA and post hoc test demonstrated an eight-fold increase of the proinflammatory marker in LPCinjured mice respect of controls (*** P⬍0.001). Progesterone-pretreated mice responded less vigorously to the gliotoxin and its 4.9-fold increase was significantly lower in this group respect of LPC-injected steroid-naive mice (** P⬍0.01).

The present investigation shows that progesterone diminishes the gliotoxic and inflammatory effects of LPC in the spinal cord of male mice. Thus, progesterone decreased LPC focal demyelination at the injection site and at white matter locations caudal to this site. The progesterone protective effect on myelin was demonstrated using LFB histochemical staining for total myelin as well as by immunocytochemistry for MBP, a major central myelin protein. A marked increase in the number of NG2 oligodendrocyte precursors was found after LPC injection; yet, progesterone showed a moderate but significant increase of NG2 cells over those of LPC-treated mice. Preservation of myelin was also accompanied by increased density of mature CC1⫹ oligodendrocytes. The promyelinating drive of progesterone was accompanied by partial down-regulation of the microglial/macrophage reaction. The uncontrolled microglial reactivity may produce deleterious effects to my-

594

L. Garay et al. / Neuroscience 192 (2011) 588 –597

elin and myelin-producing cells (Ousman and David, 2000; Ghasemlou et al., 2007; Howell et al., 2010; Pang et al., 2010; Taylor et al., 2010); therefore, attenuation of CD11b expression by progesterone may be lead to myelin protection. The mechanism of action of LPC involves the activation of PLA2, the enzyme that hydrolyses the fatty acid esterified to the second carbon atom of phosphatidylcholine. The last is then converted into LPC, starting a chain reaction with myelin disruption and signs of wallerian degeneration along white matter tracks (Hall, 1972; Jeffery and Blakemore (1995) and with a dramatic reduction in MPB and PLP transcripts (Woodruff and Franklin, 1999). These mechanisms explain demyelination at the injection site and to the ventral and lateral funiculus at the vicinity of the lesion and along the spinal cord axis. Because glucocorticoids inhibit PLA2 (Gewert and Sundler, 1995), it might be argued that progesterone effects might be due to a glucocorticoid-like action. However, inhibition of PLA2 activity may not be the sole myelin-protecting effect of methylprednisolone following LPC, because glucocorticoids per se enhance remyelination (Pavelko et al., 1998), increase proteolipid protein and myelin-associated glycoprotein genes in glioma cells (Zhu et al., 1994) and enhance the rate of myelin formation in Schwann cells (Chan et al., 1998). To our knowledge, progesterone effects on PLA2 in the nervous system have not been reported, and inconsistent effects have been described for other tissues. For example, progesterone stimulates PLA2 during the acrosomal reaction of spermatozoa, inhibits it in lymphocytes during pregnancy but shows no effect in human endometrial stromal cells (Kurusu et al., 2007; Shi et al., 2005; Par et al., 2003; Periwal et al., 1996). Without discarding the participation of PLA2 in progesterone protection from PLC-induced demyelination, it should be recognized that progesterone exerts strong stimulatory effects upon the oligodendrocyte progenitors and mature oligodendrocytes and inhibitory effects upon inflammatory mediators. In this sense, progesterone is a recognized promyelinating factor for trauma, degeneration and inflammation of the peripheral (Koenig et al., 1995; Roglio et al., 2008; Leonelli et al., 2007) and central nervous system (Garay et al., 2008; Schumacher et al., 2008; De Nicola et al., 2009; Sayeed and Stein, 2009). Progesterone increases the expression of MBP and the mature oligodendrocyte marker cyclic nucleotide 3=-phosphodiesterase (CNPase) in cultures of mixed glial cells and organotypic slice cultures of cerebellum (Ghoumari et al., 2003), induces the myelin genes PMP22, PO and KROX-20 in Schwann cells (Guennoun et al., 2001; Schumacher et al., 2008), attenuates toxin-induced demyelination of the cerebellum of aging rats (Ibanez et al., 2004), increases myelination of cultured glioma cells (Zhu et al., 1994), and prevents or attenuates demyelination in the corpus callosum of cuprizone-treated mice (Acs et al., 2009), and in the spinal cord of EAE mice (Garay et al., 2007, 2008). In cultured oligodendrocytes, progesterone upregulates IGF-1 and stimulates progenitor cell migration (Chesik and De Keyser, 2010). In rats with spinal cord

injury, progesterone increases the expression of myelin proteins, enhances the density of oligodendrocyte precursors and induces their differentiation into mature oligodendrocytes by increasing the expression of myelin transcription factors Olig1 and Olig2 (Labombarda et al., 2006, 2009). These demonstrations support the possibility that increases of total myelin and MBP in LPC-induced demyelination may be due to a direct effect of progesterone on spinal cord glial cells. However, mature oligodendrocytes cannot engage in myelin repair after demyelination, because remyelination involves the recruitment of an endogenous population of OPC that express the NG2 surface marker (Nishiyama et al., 1999; Levine et al., 2001; Nielsen et al., 2006). Unfortunately, remyelination fails in diseases such as MS (Bruce et al., 2010). In this context, it was highly rewarding that oligodendrocyte density, according to CC1⫹ cell counting, and oligodendrocyte precursors, according to NG2⫹ cell counting, were both significantly increased in the spinal cords of progesterone pretreated, LPC-injected mice. There is strong evidence for progesterone stimulation of the proliferation, differentiation and maturation of OPC in vitro or in vivo, under a variety of different conditions (Gago et al., 2001; Ghoumari et al., 2005; Labombarda et al., 2006, 2009; Acs et al., 2009). However, in the absence of a proliferation marker such as BrdU or KI67, it is difficult to predict whether the increase of NG2 cells in LPC-injected mice were due to cell proliferation and/or to a block in their differentiation into mature oligodendrocytes. The latter possibility deserves consideration from the fact that the modest increase of NG2⫹ cell number after progesterone treatment may be due to their rapid proliferation and differentiation into NG2 negative oligodendrocytes. In contrast, a differentiation blockade could explain the buildup of NG2⫹ cells in the progesterone-naive LPC-injected mice. Our results also show that there was a concomitant increase of OPC and mature oligodendrocytes in LPCinjected mice receiving progesterone pre-treatment. In order to explain the mechanisms involved, we would like to hypothesized that (a) early exposure to progesterone sparks the rapid differentiation and maturation of precursors; (b) progesterone pretreatment protects mature oligodendrocytes from the effects of the gliotoxin, or (c) factors that impair remyelination and cause oligodendrocyte loss are repressed by progesterone. In support of the last possibility, our results showed that progesterone opposed the effect of LPC on the expression of CD11b mRNA and the number of OX-42⫹ cells. In addition to microglia, CD11b and OX-42 are also markers of monocytes and macrophages; thus the down-regulation of these molecules by progesterone cannot be exclusively ascribed to microglia, and further studies are needed to define the cell type(s) involved in the anti-inflammatory response to the steroid. Nevertheless, the exaggerated inflammatory response that follows gliotoxin injection is highly detrimental for myelin. Activated immune cells release proinflammatory cytokines, reactive oxygen species and toxic levels of nitric oxide, causing the necrotic or apoptotic death of oligodendrocytes in addition to axonal damage and demyelination

L. Garay et al. / Neuroscience 192 (2011) 588 –597

(Trivedi et al., 2006; Arevalo et al., 2010). Thus, overshadowing the immune response may prevent LPC damage to spinal cord oligodendrocytes. We have already mentioned in the introduction that progesterone shows potent immunomodulatory effects in MS, EAE, spinal cord and brain trauma by activating non-inflammatory cytokines and opposing inflammatory cytokines. Unopposed reactive CD11b⫹ cells contribute to the development of demyelinating diseases (Bowen and Olson, 2009; Basso et al., 2008), whereas anti-CD11b immunotherapy diminishes severity of EAE (Gordon et al., 1995). In our experimental model, the anti-inflammatory effects of progesterone on CD11b mRNA occurred at the spinal cord level, in consonance with effects on myelin-producing oligodendrocytes and their precursors. Therefore, the myelination drive might be linked in part to attenuation of microglial reactivity. Our data suggest that progesterone effects on the demyelinated spinal cord may take place at the tissue level. The present model adds to previous studies in EAE mice, supporting the usefulness of progesterone for the treatment of demyelinating diseases including MS. Acknowledgments—This work was supported by grants from the National Research Council of Argentina (PIP 00542), FONCYT (PICT, 2007 001044) and University of Buenos Aires (UBA M016).

REFERENCES Acs P, Kipp M, Norkute A, Johann S, Clarner T, Braun A, Berente Z, Komoly S, Beyer C (2009) 17beta-estradiol and progesterone prevent cuprizone provoked demyelination of corpus callosum in male mice. Glia 5:807– 814. Arevalo MA, Santos-Galindo M, Bellini MJ, Azcoitia I, Garcia-Segura LM (2010) Actions of estrogens on glial cells: implications for neuroprotection. Biochim Biophys Acta 1800:1106 –1112. Azcoitia I, Leonelli E, Magnaghi V, Veiga S, Garcia-Segura LM, Melcangi RC (2003) Progesterone and its derivatives dihydroprogesterone and tetrahydroprogesterone reduce myelin fiber morphological abnormalities and myelin fiber loss in the sciatic nerve of aged rats. Neurobiol Aging 24:853– 860. Bansil S, Lee HJ, Jindal S, Holtz CR, Cook SD (1999) Correlation between sex hormones and magnetic resonance imaging lesions in multiple sclerosis. Acta Neurol Scand 99:91–94. Basso AS, Frenkel D, Quintana FJ, Costa-Pinto FA, Petrovic-Stojkovic S, Puckett L, Monsonego A, Bar-Shir A, Engel Y, Gozin M, Weiner HL (2008) Reversal of axonal loss and disability in a mouse model of progressive multiple sclerosis. J Clin Invest 118:1532–1543. Bebo BF Jr, Fyfe-Johnson A, Adlard K, Beam AG, Vandenbark AA, Offner H (2001) Low-dose estrogen therapy ameliorates experimental autoimmune encephalomyelitis in two different inbred mouse strains. J Immunol 166:2080 –2089. Blois SM, Ilarregui JM, Tometten M, Garcia M, Orsal AS, Cordo-Russo R, Toscano MA, Bianco GA, Kobelt P, Handjiski B, Tirado I, Markert UR, Klapp BF, Poirier F, Szekeres-Bartho J, Rabinovich GA, Arck PC (2007) A pivotal role for galectin-1 in fetomaternal tolerance. Nat Med 13:1450 –1457. Bowen JL, Olson JK (2009) Innate immune CD11b⫹Gr-1⫹ cells, suppressor cells, affect the immune response during Theiler’s virusinduced demyelinating disease. J Immunol 183:6971– 6980. Brinton RD, Thompson RF, Foy MR, Baudry M, Wang J, Finch CE, Morgan TE, Pike CJ, Mack WJ, Stanczyk FZ, Nilsen J (2008) Progesterone receptors: form and function in brain. Front Neuroendocrinol 29:313–339.

595

Bruce CC, Zhao C, Franklin RJ (2010) Remyelination—an effective means of neuroprotection. Horm Behav 57:56 – 62. Chan JR, Phillips LJ 2nd, Glaser M (1998) Glucocorticoids and progestins signal the initiation and enhance the rate of myelin formation. Proc Natl Acad Sci U S A 95:10459 –10464. Chesik D, De Keyser J (2010) Progesterone and dexamethasone differentially regulate the IGF-system in glial cells. Neurosci Lett 468:178 –182. Confavreux C, Hutchinson M, Hours MM, Cortinovis-Tourniaire P, Moreau T (1998) Rate of pregnancy-related relapse in multiple sclerosis. N Engl J Med 339:285–291. De Nicola AF, Labombarda F, Gonzalez Deniselle MC, Gonzalez SL, Garay L, Meyer M, Gargiulo G, Guennoun R, Schumacher M (2009) Progesterone neuroprotection in traumatic CNS injury and motoneuron degeneration. Front Neuroendocrinol 30:173–187. Druckmann R, Druckmann MA (2005) Progesterone and the immunology of pregnancy. J Steroid Biochem Mol Biol 97:389 –396. El-Etr M, Vukusic S, Gignoux L, Durand-Dubief F, Achiti I, Baulieu EE, Confavreux C (2005) Steroid hormones in multiple sclerosis. J Neurol Sci 233:49 –54. Elliot GA, Gibbons AJ, Greig ME (1973) A comparison of the effects of melengestrol acetate with a combination of hydrocortisone acetate and medroxyprogesterone acetate and with other steroids in the treatment of experimental allergic encephalomyelitis in Wistar rats. Acta Neuropathol 23:95–104. Ferrini M, Lima A, De Nicola AF (1995) Estradiol abolishes autologous down regulation of glucocorticoid receptors in brain. Life Sci 57:2403–2412. Gago N, Akwa Y, Sananès N, Guennoun R, Baulieu EE, El-Etr M, Schumacher M (2001) Progesterone and the oligodendroglial lineage: stage-dependent biosynthesis and metabolism. Glia 36: 295–308. Garay L, Deniselle MCG, Lima A, Roig P, De Nicola AF (2007) Effects of progesterone in the spinal cord of a mouse model of multiple sclerosis. J Steroid Biochem Mol Biol 107:228 –237. Garay L, Deniselle MCG, Gierman L, Meyer M, Lima A, Roig P, De Nicola AF (2008) Steroid protection in the experimental autoimmune encephalomyelitis model of multiple sclerosis. Neuroimmunomodulation 15:76 – 83. Garay L, Deniselle MCG, Meyer M, Costa JJ, Lima A, Roig P, De Nicola AF (2009) Protective effects of progesterone administration on axonal pathology in mice with experimental autoimmune encephalomyelitis. Brain Res 1283:177–185. Gewert K, Sundler R (1995) Dexamethasone down-regulates the 85 kDa phospholipase A2 in mouse macrophages and suppresses its activation. Biochem J 307:499 –504. Ghasemlou N, Jeong SY, Lacroix S, David S (2007) T cells contribute to lysophosphatidylcholine-induced macrophage activation and demyelination in the CNS. Glia 55:294 –302. Ghoumari AM, Ibanez C, El-Etr M, Leclerc P, Eychenne B, O’Malley BW, Baulieu EE, Schumacher M (2003) Progesterone and its metabolites increase myelin basic protein expression in organotypic slice cultures of rat cerebellum. J Neurochem 86:848 – 859. Ghoumari AM, Baulieu EE, Schumacher M (2005) Progesterone increases oligodendroglial cell proliferation in rat cerebellar slice cultures. Neuroscience 135:47–58. Gordon EJ, Myers KJ, Dougherty JP, Rosen H, Ron Y (1995) Both anti-CD11a (LFA-1) and anti-CD11b (MAC-1) therapy delay the onset and diminish the severity of experimental autoimmune encephalomyelitis. J Neuroimmunol 62:153–160. Guennoun R, Benmessahel Y, Delespierre B, Gouézou M, Rajkowski KM, Baulieu EE, Schumacher M (2001) Progesterone stimulates Krox-20 gene expression in Schwann cells. Brain Res Mol Brain Res 90:75– 82. Hall SM (1972) The effect of injections of lysophosphatidyl choline into white matter of the adult mouse spinal cord. J Cell Sci 10:535–546.

596

L. Garay et al. / Neuroscience 192 (2011) 588 –597

Hoffman GE, Le WW, Murphy AZ, Koski CL (2001) Divergent effects of ovarian steroids on neuronal survival during experimental allergic encephalitis in Lewis rats. Exp Neurol 171:272–284. Holinka CF, Tseng YC, Finch CE (1979) Reproductive aging in C57BL/6J mice: plasma progesterone, viable embryos and resorption frequency throughout pregnancy. Biol Reprod 20:1201–1211. Howell OW, Rundle JL, Garg A, Komada M, Brophy PJ, Reynolds R (2010) Activated microglia mediate axoglial disruption that contributes to axonal injury in multiple sclerosis. J Neuropathol Exp Neurol 69:1017–1033. Hughes MD (2004) Multiple sclerosis and pregnancy. Neurol Clin 22:757–769. Ibanez C, Shields SA, Liere P, El-Etr M, Baulieu EE, Schumacher M, Franklin RJM (2004) Systemic progesterone administration results in a partial reversal of the age-associated decline in CNS remyelination following toxin-induced demyelination in male rats. Neuropathol Appl Neurobiol 30:80 – 89. Jeffery ND, Blakemore WF (1995) Remyelination of mouse spinal cord axons demyelinated by local injection of lysolecithin. J Neurocytol 24:775–781. Kim JH, Budde MD, Liang HF, Klein RS, Russell JH, Cross AH, Song SK (2006) Detecting axon damage in spinal cord from a mouse model of multiple sclerosis. Neurobiol Dis 21:626 – 632. Kim S, Liva SM, Dalal MA, Verity MA, Voskuhl RR (1999) Estriol ameliorates autoimmune demyelinating disease: implications for multiple sclerosis. Neurology 52:1230 –1238. Koenig HL, Schumacher M, Ferzaz B, Thi AN, Ressouches A, Guennoun R, Jung-Testas I, Robel P, Akwa Y, Baulieu EE (1995) Progesterone synthesis and myelin formation by Schwann cells. Science 268:1500 –1502. Kurusu S, Ishii S, Kawaminami M (2007) Changes in rat uterine and cervical phospholipase A2 activity following progesterone agonist or antagonist administration at term. J Reprod Dev 53:345–350. Labombarda F, Gonzalez SL, Deniselle MCG, Guennoun R, Schumacher M, De Nicola AF (2002) Cellular basis for progesterone neuroprotection in the injured spinal cord. J Neurotrauma 19: 343–355. Labombarda F, Gonzalez S, Gonzalez Deniselle MC, Garay L, Guennoun R, Schumacher M, De Nicola AF (2006) Progesterone increases the expression of myelin basic protein and the number of cells showing NG2 immunostaining in the lesioned spinal cord. J Neurotrauma 23:181–192. Labombarda F, Gonzalez S, Lima A, Roig P, Guennoun R, Schumacher M, De Nicola AF (2009) Effects of progesterone on oligodendrocyte progenitors, oligodendrocyte transcription factors, and myelin proteins following spinal cord injury. Glia 57:884 – 897. Leonelli E, Bianchi R, Cavaletti G, Caruso D, Crippa D, Garcia-Segura LM, Lauria G, Magnaghi V, Roglio I, Melcangi RC (2007) Progesterone and its derivatives are neuroprotective agents in experimental diabetic neuropathy: a multimodal analysis. Neuroscience 144:1293–1304. Levine JM, Reynolds R, Fawcett JW (2001) The oligodendrocyte precursor cell in health and disease. Trends Neurosci 24:39 – 47. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402– 408. Mathisen PM, Kawczak M, Yu M, Johnson JM, Tuohy VK (2001) Differential DM20 mRNA expression distinguishes two distinct patterns of spontaneous recovery from murine autoimmune encephalomyelitis. J Neurosci Res 64:542–551. Melcangi RC, Magnaghi V, Martini L (2000) Aging in peripheral nerves: regulation of myelin protein genes by steroid hormones. Prog Neurobiol 60:291–308. Meyer M, Gonzalez Deniselle MC, Garay LI, Monachelli GG, Lima A, Roig P, Guennoun R, Schumacher M, De Nicola AF (2010) Stage dependent effects of progesterone on motoneurons and glial cells of wobbler mouse spinal cord degeneration. Cell Mol Neurobiol 30:123–135.

Nielsen HH, Ladeby R, Drøjdahl N, Peterson AC, Finsen B (2006) Axonal degeneration stimulates the formation of NG2⫹ cells and oligodendrocytes in the mouse. Glia 54:105–115. Nishiyama A, Chang A, Trapp BD (1999) NG2⫹ glial cells: a novel glial cell population in the adult brain. J Neuropathol Exp Neurol 58:1113–1124. Ousman SS, David S (2000) Lysophosphatidylcholine induces rapid recruitment and activation of macrophages in the adult mouse spinal cord. Glia 30:92–104. Ozerdem U, Monosov E, Stallcup WB (2002) NG2 proteoglycan expression by pericytes in pathological microvasculature. Microvasc Res 63:129 –134. Pang Y, Campbell L, Zheng B, Fan L, Cai Z, Rhodes P (2010) Lipopolysaccharide-activated microglia induce death of oligodendrocyte progenitor cells and impede their development. Neuroscience 166:464 – 475. Papadopoulos D, Pham-Dinh D, Reynolds R (2006) Axon loss is responsible for chronic neurological deficit following inflammatory demyelination in the rat. Exp Neurol 197:373–385. Par G, Geli J, Kozma N, Varga P, Szekeres-Bartho J (2003) Progesterone regulates IL12 expression in pregnancy lymphocytes by inhibiting phospholipase A2. Am J Reprod Immunol 49:1–5. Pavelko KD, van Engelen BG, Rodriguez M (1998) Acceleration in the rate of CNS remyelination in lysolecithin-induced demyelination. J Neurosci 18:2498 –2505. Periwal SB, Farooq A, Bhargava VL, Bhatla N, Vij U, Murugesan K (1996) Effect of hormones and antihormones on phospholipase A2 activity in human endometrial stromal cells. Prostaglandins 51: 191–201. Pozzilli C, Falaschi P, Mainero C, Martocchia A, D’Urso R, Proietti A, Frontoni M, Bastianello S, Filippi M (1999) MRI in multiple sclerosis during the menstrual cycle: relationship with sex hormone patterns. Neurology 53:622– 624. Reddy PH, Manczak M, Zhao W, Nakamura K, Bebbington C, Yarranton G, Mao P (2009) Granulocyte-macrophage colony-stimulating factor antibody suppresses microglial activity: implications for antiinflammatory effects in Alzheimer’s disease and multiple sclerosis. J Neurochem 11:1514 –1528. Roglio I, Bianchi R, Gotti S, Scurati S, Giatti S, Pesaresi M, Caruso D, Panzica GC, Melcangi RC (2008) Neuroprotective effects of dihydroprogesterone and progesterone in an experimental model of nerve crush injury. Neuroscience 155:673– 685. Sayeed I, Stein DG (2009) Progesterone as a neuroprotective factor in traumatic and ischemic brain injury. Prog Brain Res 175:219 –237. Schumacher M, Sitruk-Ware R, De Nicola AF (2008) Progesterone and progestins: neuroprotection and myelin repair. Curr Opin Pharmacol 8:740 –746. Shi QX, Chen WY, Yuan YY, Mao LZ, Yu SQ, Chen AJ, Ni Y, Roldan ER (2005) Progesterone primes zona pellucida-induced activation of phospholipase A2 during acrosomal exocytosis in guinea pig spermatozoa. J Cell Physiol 205:344 –354. Stein DG, Fulop ZL (1998) Progesterone and recovery after traumatic brain injury: an overview. Neuroscientist 4:435– 442. Szekeres-Bartho J, Wegmann TG (1986) A progesterone-dependent immunomodulatory protein alters the Th1/Th2 balance. J Reprod Immunol 31:81–95. Taylor DL, Pirianov G, Holland S, McGinnity CJ, Norman AL, Reali C, Diemel LT, Gveric D, Yeung D, Mehmet H (2010) Attenuation of proliferation in oligodendrocyte precursor cells by activated microglia. J Neurosci Res 88:1632–1644. Triarhou LC, Herndon RM (1986) The effect of dexamethasone on L-alpha-lysophosphatidyl choline (lysolecithin)-induced demyelination of the rat spinal cord. Arch Neurol 43:121–125. Trivedi A, Olivas AD, Noble-Haeusslein LJ (2006) Inflammation and spinal cord injury: infiltrating leukocytes as determinants of injury and repair processes. Clin Neurosci Res 6:283–292.

L. Garay et al. / Neuroscience 192 (2011) 588 –597 Woodruff RH, Franklin RJ (1999) The expression of myelin protein mRNAs during remyelination of lysolecithin-induced demyelination. Neuropathol Appl Neurobiol 25:226 –235. Yates MA, Li Y, Chlebeck P, Proctor T, Vandenbark AA, Offner H (2010) Progesterone treatment reduces disease severity and increases IL-10 in experimental autoimmune encephalomyelitis. J Neuroimmunol 220:136 –139.

597

Yu HJ, Fei J, Chen XS, Cai QY, Liu HL, Liu GD, Yao ZX (2010) Progesterone attenuates neurological behavioral deficits of experimental autoimmune encephalomyelitis through remyelination with nucleus-sublocalized Olig1 protein. Neurosci Lett 476:42– 45. Zhu W, Wiggins RC, Konat GW (1994) Glucocorticoid-induced upregulation of proteolipid protein and myelin-associated glycoprotein genes in C6 cells. J Neurosci Res 37:208 –212.

(Accepted 23 June 2011) (Available online 28 June 2011)