Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleotide probes

Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleotide probes

Journal Pre-proof Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleo...

1MB Sizes 0 Downloads 6 Views

Journal Pre-proof Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleotide probes Jinqiang Hu, Yi Wang, Haijian Su, Huimin Ding, Xincheng Sun, Hui Gao, Yao Geng, Zhangcun Wang PII:

S0890-8508(19)30368-8

DOI:

https://doi.org/10.1016/j.mcp.2019.101501

Reference:

YMCPR 101501

To appear in:

Molecular and Cellular Probes

Received Date: 22 September 2019 Revised Date:

4 December 2019

Accepted Date: 26 December 2019

Please cite this article as: Hu J, Wang Y, Su H, Ding H, Sun X, Gao H, Geng Y, Wang Z, Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleotide probes, Molecular and Cellular Probes (2020), doi: https://doi.org/10.1016/ j.mcp.2019.101501. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.

1

Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase

2

polymerase amplification combined with triple-labeled nucleotide probes

3

Jinqiang Hua, b, c, d, †, *, Yi Wanga, †, Haijian Sue, Huimin Dinga, Xincheng Suna, b, c, Hui Gaoa, Yao

4

Genga, Zhangcun Wanga, b, *

5

(a School of Food and Bioengineering, Zhengzhou University of Light Industry, Zhengzhou 450000,

6

Henan Province, China; b Henan International Joint Laboratory of Food Safety, Zhengzhou 450000,

7

Henan Province, China; c Collaborative Innovation Center of Food Production and Safety, Zhengzhou

8

450000, Henan Province, China;

9

Control, Zhengzhou 450000, Henan Province, China; e Technology Center, China Tobacco Shandong

10

d

Henan Key Laboratory of Cold Chain Food Quality and Safety

Industrial Co., Ltd, Zhengzhou 266000, Shandong Province, China)

11 12

With 2 tables and 7 figures

13

Running title: Analysis of E. coli O157 using RPA with probe

14



15

*Corresponding authors:

16

Dr. Jinqiang Hu and Dr Zhangcun Wang

17

School of Food and Bioengineering

18

Zhengzhou University of Light Industry

19

Address: No. 136 Science Avenue, Hi-tech Development Zone, Zhengzhou, 450000, Henan Province,

20

P. R. China

21

Tel.: +86-371-86609631

22

Fax: +86-371-86609631

23

E-mail: [email protected]

These authors contributed equally to this work

1

1

ABSTRACT: Rapid analytical methods are urgently needed to evaluate Escherichia 2

coli (E. coli) O157:H7 in food. In this work, a novel recombinase polymerase 3

amplification (RPA)-based lateral flow dipstick (LFD) method was developed to detect 4

E. coli. Briefly, suitable primers and probes were designed and screened. Then, RPA 5

reaction parameters, including volume, time, and temperature, were optimized. The 6

specificity and sensitivity of RPA-LFD were analyzed, and a contaminated milk sample 7

was used to test the detection performance of the proposed method. The optimal RPA 8

reaction conditions included a minimum volume of 10 µL, incubation time of 10 min, 9

temperature range of 39–42 °C, the primer pair EOF4/EOR3, and the probe EOProb. 10

RPA-LFD was highly sensitive, it could detect as little as 1 fg of the genomic DNA of 11

E. coli O157:H7, and 19 nontarget DNA of foodborne bacteria did not yield 12

amplification products. Finally, the limit of detection of RPA-LFD for E. coli O157:H7 13

in artificially contaminated raw milk was 4.4 CFU/mL. In summary, the RPA-LFD 14

assay developed in this study is an effective tool for the rapid investigation of E. coli 15

O157:H7 contamination in raw milk samples. 16

Keywords: Escherichia coli, Recombinase polymerase amplification, Analysis

17

2

1

1. Introduction

2

Escherichia coli O157:H7 (E. coli O157:H7) is an important pathogen that can

3

contaminate food and water and, thus, threaten human health [1,2]. E. coli O157:H7

4

strains cause 100,000 infections yearly in the USA, and 6,109 confirmed cases of E.

5

coli O157:H7 infections were reported in Europe in 2014 [3,4]. Thus, E. coli O157:H7

6

presents an issue in food safety [5]. However, conventional detection methods to

7

identify E. coli O157:H7 mainly relied on culture-based assays, which take 5-7 days

8

including the process of pre-enrichment, selective culture, and biochemical and

9

serological identification [6]. These detection assays are time-consuming and laborious

10

[7]. Although more recent detection methods such as PCR and real-time PCR have been

11

developed, they often require long time and expensive / bulk instruments which limit

12

their application in point-of-care test (POCT) of E. coli O157:H7 especially in the

13

poor-resource environments. Thus, the development of novel detection technologies is

14

imperative to detect this foodborne pathogen in food.

15

In recent years, recombinase polymerase amplification (RPA), a novel isothermal

16

nucleic acid amplification technology, has been proven to be a useful method for

17

amplifying target DNA/RNA molecules [8,9]. RPA can open DNA strands and amplify

18

the DNA targets isothermally by combining the activities of recombinase and

19

polymerase. RPA amplicons can be obtained to achieve the detective level at a low

20

temperature range (37–42 °C) within less than 30 min through five consecutive steps

21

[10]. Some literatures reported that RPA can successfully identify foodborne poisoning

22

bacteria such as E. coli O157:H7, Salmonella enterica typhimurium, Staphylococcus

23

aureus by detecting the RPA amplicons using various end-point methods such as 3

1

enzyme-linked immunosorbent assays [11], fluorescence assays [12-14] and

2

colorimetry [15]. Nonetheless, these endpoint methods are either need expensive

3

instruments, low specificity or time-consuming or difficult to judge result with naked

4

eye and give rise to inapplicability of POCT at the grassroots level.

5

Until now, the lateral flow dipsticks (LFD) has attracted more and more attention

6

because chemical labeling enables end-point reading of amplification products with

7

naked eye on LFD by colored signals from gold nanoparticles (AuNP) [16] and so are a

8

convenient, visual, and user-frendly detection method for detecting various biological

9

agents and chemical contaminants, such as viruses, bacteria, toxins, veterinary drugs,

10

and pesticides, when integrated with other technologies [17-22]. LFD can detect

11

nucleic acids by recognizing the antigens integrated into nucleotide amplicons [23]. For

12

example, a lateral flow (LF) probe and the reverse primer of RPA were labeled with

13

FAM and biotin, respectively, to form antigen-harboring RPA products through the RPA

14

reaction. The resulting DNA amplicons, which consisted of two labeled antigens, could

15

migrate along an LFD strip by chromatography for approximately 5 min and be trapped

16

at the test line [24].

17

In the present study, we aims to combine the advantages of RPA with LFD to

18

develop an ultrasensitive, fast, convenient, and specific RPA-LFD assay for the

19

detection of E. coli O157:H7. Detection performance of RPA-LFD was also evaluated

20

in artificially contaminated raw milk samples. The RPA-LFD method developed here

21

could be an important tool to prevent and control foodborne diseases caused by E. coli

22

O157:H7.

23

2. Materials and methods 4

1

2.1. Bacterial resources and DNA preparation

2

Twenty-four bacterial strains were stored at −80 °C in our laboratory until use.

3

Five E. coli O157:H7 serotypes were considered the target bacteria, and the remaining

4

19 strains were used as specificity controls. The genomic DNA of these bacterial strains

5

and recombinant plasmid rpUCm-rfbE as the positive control were extracted in

6

accordance with the instructions of the Ezup Column Bacteria Genomic DNA

7

Purification Kit (Sangon Biotech, Shanghai, China) and SanPrep Column Plasmid

8

Mini-Preps Kit (Sangon Biotech, Shanghai, China), respectively, and quantified on a

9

Nanodrop 2000 (ThermoFisher Scientific, Waltham, USA) prior to storage at −20 °C

10

until use.

11

2.2. Design, screening, and labeling of primers and/or probes

12

To maximize the number of RPA primers obtained for RPA primer screening, the

13

conserved region of the rfbE gene (Genbank No. S83460) of an E. coli O157:H7

14

serotype was analyzed by applying the online BLASTn tool in NCBI. Subsequently,

15

potential RPA primers were carefully designed in accordance with the fundamental

16

principles for PCR and RPA using software Omiga v 2.0 (Oxford molecular Ltd.,

17

Oxford, UK). Each primer for RPA was 35 bp in length, and RPA products flanked by

18

forward and reverse primers should be between 116–350 bp when no overlaps between

19

primers and primer/probes are considered. Four forward primers, EOF1, EOF2, EOF3,

20

and EOF4, and four reverse primers, EOR1, EOR2, EOR3, and EOR4, were designed

21

(Table 1) and synthesized (Sangon Biotech, Shanghai, China).

22

To acquire the optimal RPA primer pairs, seven forward/reverse combinations,

23

namely, EOF1/EOR1, EOF2/EOR2, EOF3/EOR2, EOF4/EOR2, EOF3/EOR3, 5

1

EOF4/EOR3, and EOF4/EOR4, with predicted product sizes of 207, 110, 218, 327, 125,

2

233, and 142 bp, respectively, were dually examined through PCR-agarose

3

electrophoresis (AGE) and RPA-AGE. PCR amplification was conducted using 1 µL of

4

20 pg genomic DNA of E. coli O157:H7 as the template in a total volume of 25 µL

5

containing 12.5 µL of Taq PCR Master Mix (Sangon Biotech, Shanghai, China), 1 µL

6

of 10 pM forward/reverse primer, and 9.5 µL of ddH2O. PCR reactions were performed

7

in a gradient thermocycler (PTC-200, BioRad, CA, USA) under the following

8

conditions: predenaturation at 95 °C for 10 min; 30 cycles of 95 °C for 25 s, 60 °C for

9

30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 10 min. RPA

10

amplification was conducted in accordance with the specifications of the TwistAmp®

11

nfo Kit with a total volume of 10 µL. In brief, a mixture of 29.5 µL of rehydration

12

buffer with 12.2 µL of ddH2O was used to resuspend a lyophilized enzyme pellet in a

13

tube. The contents of the tube were then divided into five aliquots of equal volumes of

14

8.34 µL, placed in 0.2 mL tubes, and gently vortexed. Subsequently, each aliquot was

15

added with a premixture containing 0.42 µL of 10 µM forward/reverse primer and then

16

0.2 µL of 100 pg/µL of the genomic DNA of E. coli O157:H7 as a template. Finally, 0.5

17

µL of 280 mM magnesium acetate solution as an initiator was pipetted into the lid of

18

the reaction tubes prior to transient centrifugation to initiate the reactions

19

simultaneously. Reactions were performed at 40 °C for 20 min in a thermostatic water

20

bath (HH-6, Jieruier Electric Appliance, Jintan, China). The RPA products were

21

subsequently purified by using the SanPrep Column PCR Product Purification Kit

22

(Sangon Biotech, Shanghai, China), electrophoresed on 2% agarose gel (AGE) after 4S

23

Green Plus (Sangon Biotech, Shanghai, China) staining, and then detected under 6

1

ultraviolet light. The primer combination corresponding to the RPA band with the

2

largest quantity of the RPA product using BandScan 5.0 software (Glyko, Novato, CA,

3

USA) and without nonspecific RPA amplification was considered the optimal

4

combination.

5

To ensure that the RPA products were suitable for LFD detection, the 5′ end of the

6

reverse primer of the optimal primer combination screened as described above was

7

labeled with biotin, and the LF probe within the amplicon flanked by optimal primer

8

pair was incorporated with three labels, namely, a 5′-carboxyfluorescein group (FAM),

9

an internal abasic nucleotide analogue (THF), and a polymerase extension blocking

10

group (C3-Spacer). Integration of the FAM label into RPA products was accompanied

11

by the RPA reaction. LFD was conducted to verify the validity of the optimal primer

12

combinations and the corresponding probe before further experiments were conducted.

13

2.3. LFD analysis of RPA products

14

First, 2 µL of RPA product was transferred into a well of a microtiter plate

15

containing 98 µL of assay solution and mixed by using a micropipette. Subsequently,

16

the dipstick was vertically inserted into the solution and stood at room temperature for

17

approximately 5 min. In accordance with the specifications of Milenia HybriDetect 2T,

18

the RPA reaction was considered positive when the control (C) and test (T) lines were

19

visible and negative when only the C line was visible. The LFD was considered invalid

20

when no band appeared.

21

2.4. Optimization analysis of RPA reaction

22 23

To ascertain the effect of critical parameters, i.e., the temperature, volume, and time of the RPA reaction, on product quantity, six temperature gradients of 37, 38, 39, 40, 41, 7

1

and 42 °C; six volume gradients of 5, 10, 20, 30, 40, and 50 µL; and six time gradients

2

of 5, 10, 15, 20, 25, and 30 min were successively determined to identify the optimal

3

RPA reaction conditions. RPA products corresponding to different parameter

4

optimizations were evaluated through RPA-AGE and/or RPA-LFD assay as previously

5

described.

6

2.5. Sensitivity and specificity analyses of RPA-LFD

7

Exactly 1 × 10-1, 1 × 10-2, 1 × 10-3, 1 × 10-4, 1 × 10-5, 5 × 10-6, or 1 × 10-6 ng

8

genomic DNA was used as the template of the PCR and RPA reactions to test the

9

sensitivity of RPA-LFD toward the genomic DNA of E. coli O157:H7 obtained through

10

pure cell culture as described above. The PCR product was analyzed through 2% AGE,

11

and purified and unpurified RPA products were analyzed through 2% AGE and LFD,

12

respectively. PCR-AGE and RPA-AGE were used as controls for the RPA-LFD

13

sensitivity test.

14

To test the specificity of the RPA-LFD method toward E. coli O157:H7, 24

15

bacterial strains were employed as described in the Materials and Methods section. The

16

recombinant plasmid rpUCm-rfbE extracted from the E. coli Oneshot strain and the

17

genomic DNA of all of the bacterial strains were used as the templates for the PCR and

18

RPA reactions. The resultant PCR and RPA products were further analyzed through

19

AGE and LFD assays as previously described.

20

2.6. Analytical characteristics of RPA-LFD in artificially contaminated milk

21

To assess the application potential of RPA-LFD assay in raw milk, 9 mL of raw

22

milk that was tested negative for E. coli O157:H7 as examined through the PCR

23

method in accordance with an international standard (ISO 22174: 2005) was inoculated 8

1

with 1 mL of E. coli O157:H7 culture in mEC+n medium (tryptone 20 g/L, lactose 5

2

g/L, No. 3 bile salt 1.12 g/L, dipotassium hydrogen phosphate 4 g/L, potassium

3

dihydrogen phosphate 1.5 g/L, sodium chloride 5 g/L, and neonatal mycin 19.8 mg/L,

4

pH 7.0). The resultant mixture was diluted 107 fold. Subsequently, 100 µL of the

5

mixture corresponding to each dilution was immediately spread on a Cefixime Tellurite

6

Sorbitol MacConkey (CT-SMAC) (Haibo Biotech Corp, Shanghai, China) agar

7

(containing peptone 20 g/L, sorbitol 10 g/L, No. 3 bile salt 1.5 g/L, sodium chloride 5

8

g/L, neutral red 0.03 g/L, crystal violet 1.0 mg/L, agar 15 g/L, cefixime 0.05 mg/L, and

9

potassium tellurite 2.5 mg/L at pH 7.2) solid plate for bacterial counting. The genomic

10

DNA of E. coli O157:H7 originating from each dilution was also extracted as described

11

previously and used as the template for the RPA and PCR reactions. The resultant RPA

12

and PCR products were analysed by LFD and/or AGE described above.

13

3. Results

14

3.1. Confirmation of optimal primer combination and probe

15

As shown in Fig. 1A, the PCR and RPA methods could amplify the product size as

16

predicted using the seven primer combinations of EOF1/EOR1, EOF2/EOR2,

17

EOF3/EOR2, EOF4/EOR2, EOF3/EOR3, EOF4/EOR3, and EOF4/EOR4. Among

18

these combinations, EOF4/EOR3 was considered the optimal combination because the

19

largest amount of RPA product (233 bp in length) was obtained from this pair and no

20

nonspecific band was observed in the RPA reaction profile. After the optimal primer

21

combination, i.e., EOF4/EOR3, was obtained, the primer EOR3 was labeled with biotin,

22

and the LF probe designated as EOProb was designed and triple labeled as previously

23

described (Table 1 and Fig. 2). The RPA product obtained by using the labeled optimal 9

1

primer combination EOF4/EOR3 and the probe EOProb was then detected by LFD (Fig.

2

1B). The test line appeared on LFD when the positive control recombinant plasmid

3

rpUCm-rfbE and the genomic DNA of E. coli O157:H7 were used as templates for the

4

RPA reactions; no line appeared when the negative control (ddH2O) was used.

5

3.2. Establishment of optimal RPA reaction conditions

6

The effect of critical variables, including reaction volume, temperature, and time

7

on RPA reaction, was investigated. No obvious difference in RPA products was

8

observed from 39 °C to 42 °C by the AGE (Fig. 3A) and LFD (Fig. 3B) methods,

9

which indicates that 39–42 °C is the optimal temperature range of the RPA reaction.

10

The RPA product quantity remained unchanged from 10 µL to 50 µL regardless of

11

RPA-AGE (Fig. 4A) or RPA-LFD method (Fig. 4B). This finding indicates that 10 µL

12

is the minimum volume required by the RPA reaction. Finally, AGE (Fig. 5A) and LFD

13

(Fig. 5B) revealed that RPA product was constant from 10 min to 30 min. This result

14

suggests that 10 min is the shortest time required by the RPA reaction. Taken together,

15

the optimal parameters of RPA reaction are 39–42 °C, 10 µL, and 10 min.

16

3.3. Sensitivity and specificity analyses of RPA-LFD

17

Different amounts of E. coli O157:H7 genomic DNA, including 1 × 10-1, 1 × 10-2,

18

1 × 10-3, 1 × 10-4, 1 × 10-5, 5 × 10-6, and 1 × 10-6 ng, were used as templates for the RPA

19

and PCR reactions for limit of detection (LOD) confirmation of RPA-LFD. PCR-AGE

20

(Fig. 6A), RPA-AGE (Fig. 6B), and RPA-LFD (Fig. 6C) could detect 1 × 10-4, 5 × 10-6,

21

and 1 × 10-6 ng of genomic DNA, respectively. The RPA-LFD method was more

22

sensitive than the PCR-AGE or RPA-AGE method, thus indicating that the proposed

23

method is an ultrasensitive assay for E. coli O157:H7 detection. The specificity test 10

1

showed only one band of 233 bp during PCR-AGE and RPA-AGE, and only the T line

2

was observed on RPA-LFD when the positive control rpUCm-rfbE plasmid and five E.

3

coli O157:H7 serotypes were used as targets. However, neither the 233 bp product nor

4

the T line was observed when the 19 nontarget foodborne pathogenic bacteria were

5

assayed. This result demonstrates that the RPA-LFD assay using the combination of

6

EOF4/EOR3 and EOProb is not cross-reactive with control foodborne bacteria and, is

7

therefore, highly specific for the accurate detection of E. coli O157:H7 (Table 2).

8

3.4. Analytical performance of RPA-LFD assay in contaminated milk samples

9

E. coli O157:H7 with different concentrations of 4.4 × 107, 4.4 × 106, 4.4 × 105,

10

4.4 × 104, 4.4 × 103, 4.4 × 102, 4.4 × 101, and 4.4 × 100 CFU/mL in artificially

11

contaminated milk were examined through CT-SMAC plate counting and PCR-AGE

12

(Fig. 7A), RPA-AGE (Fig. 7B), and RPA-LFD (Fig. 7C). The LODs of RPA-LFD and

13

RPA-AGE were approximately 4.4 CFU/mL and 100 times lower than that of

14

PCR-AGE (4.4 × 102 CFU/mL), which illustrates that the RPA-LFD method is highly

15

sensitive for E. coli O157:H7 detection in artificially contaminated milk.

16

4. Discussion 17

As known, RPA system is much more complicated than PCR because primers

18

have an effect on RPA reaction [14]. In this study, primers were designed on the basis

19

of the principles recommended by the TwistAmpTM nfo Kit, i.e., long “tracks” of

20

guanines at the 5′ end (first 3–5 bp) are avoided, while cytosines are preferred.

21

Moreover, guanines and cytosines at the 3′ end of the primer (last 3 bp) tend to provide

22

a

23

https://www.twistdx.co.uk/en/support/manuals/twistamp-manuals).

stable

clamped

target

for

11

the

polymerase

(see

Intriguingly,

1

according to the principles described above the primer EOF3 is better than EOF4.

2

However, on the contrary, the quantity of the RPA product obtained using EOF3/EOR2

3

was lower than that obtained using EOF4/EOR2 (Fig. 1A, lanes 6, 8). This reveals that

4

the recommendations of the kit are only a reference but not absolutely correct. This

5

implicates that researchers should design and test primers carefully. Interestingly, the

6

results of the PCR method for primer screening were generally consistent with those of

7

the RPA method (Fig. 1A). Therefore, PCR should be conducted to test potential

8

primer combinations prior to RPA screening to save time and cost [20]. The potential

9

of the optimal primer combination EOF4/EOR3 screened through the PCR and RPA

10

methods for LFD detection was also confirmed (Fig. 1B) to guarantee that the primer

11

pair EOF4/EOR3 is effective and highly specific prior to its use in the development of

12

the RPA-LFD assay. However, the LF probe was designed after the potential optimal

13

primer pair (EOF4/EOR3) was screened, which have drawbacks, e.g., if the probe does

14

not work or shows a false positive results, the novel probe and even primers will be

15

redesigned and rescreened. Alternatively, the probe was designed firstly before the

16

primers surrounding the probe were designed and screened. This experimental scheme

17

allows us to design additional candidate primers aimed at the probe but limits the

18

reference to the principles of primer design because of the base composition restriction

19

of target gene sequence.

20

To specifically detect E. coli O157:H7, the highly conserved region of the rfbE

21

gene of E. coli O157:H7 was obtained by homology alignment in the Genbank database.

22

Besides, the 5 E. coli O157:H7 serotypes and 19 nontarget foodborne pathogenic

23

bacteria were used to test the specificity of RPA reaction. The time for RPA reaction 12

1

only took 10 min at the temperature range between 40 °C and 42 °C [25] in only 10 µL

2

reaction volume and this was rarely reported [13]. Moreover, LFD was used to directly

3

detect RPA product within 5 min without purification step, which can allow rapid and

4

convenient detection of genome DNA. Thus this can effectively promote the POCT

5

application of RPA-LFD in foodborne pathogens [17].

6

All in all, by carefully designing and screening the primers as well as optimizing

7

the reaction conditions of RPA, RPA-LFD was established. Detection performance

8

(sensitivity and specificity) and practical application in artificially milk of RPA-LFD

9

were detailedly analyzed. RPA-LFD developed in this study is rapid, simple,

10

convenient, specific, sensitively and independent of complex instruments and

11

equipments and can be suitable to rapid detection and close monitoring of E. coli

12

O157:H7 in poor-resource environments. However, multiple detection of foodborne

13

pathogenic microorganisms remains a huge challenge when LFD are used to detect two

14

or more DNA amplicons. Alternatively, RPA-LFD may also be combined with

15

bacterium-specific nucleic-labeled probes and microfluidics to realize high-throughput

16

parallel detection of foodborne targets [13,14,17,26].

17

5. Conclusion 18

Among seven RPA primer combinations that were tested, EOF4/EOR3 19

demonstrated the best effects via RPA primer screening. The RPA reaction can be 20

accomplished in a reaction volume of only 10 µL at 39–42 °C within 10 min. In 21

addition, the LODs of RPA-LFD for genomic DNA in raw milk artificially 22

contaminated with E. coli O157:H7 and E. coli bacteria were as little as 1 fg and 4.4 23

CFU/mL, respectively. The RPA-LFD assay did not show cross-reactivity with 19 13

1

nontarget foodborne pathogenic bacteria and is, thus, highly specific for E. coli 2

O157:H7 analysis. The assay developed in the present study is a promising analytical 3

method for the rapid, specific, sensitive, and intuitive detection of E. coli O157:H7 in 4

food samples with minimal laboratory equipment. 5

Conflicts of interest 6

The authors declare that they have no competing interests. 7

Acknowledgements 8

This work was supported by National Natural Science Foundation of China 9

(31201901, 31671782); Natural Science Foundation of Henan Province, China 10

(182300410096); Scientific and Technological Key Project of Henan Province, China 11

(182102310069); Scientific and Technological Key Project of Education Department of 12

Henan Province, China (14A180025); Program for Young Key Teacher of Zhengzhou 13

University of Light Industry, China (2013QNGG02). 14

References

15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

[1] M. Chandra, P. Cheng, G. Rondeau, S. Porwollik, M. McClelland, Int. J. Med. Microbiol. 303 (2013) 210-216. [2] C. L. Gyles, J. Anim. Sci. 85 (2007) 45-62. [3] M. Eppinger, T. A. Cebula, Gut Microbes 6 (2015) 194-201. [4] Control ECfDPa (2015) Annual Epidemiological Report 2016-Shigatoxin/verocytotoxin-producing Escherichia coli infection, Stockholm, ECDC. 2016. [5] Y. H. Li, L. Cao, C. Zhang, Q. M. Chen, F. X. Lu, X. M. Bie, Z. X. Lu, Int. Dairy J. 33 (2013) 27-33. [6] J. W. F. Law, N. S. Ab Mutalib, K. G. Chan, L. H. Lee, Front. Microbiol. 5 (2015) 770. [7] Y. Shao, S. Zhu, C. Jin, F. Chen, Int. J. Food Microbiol. 148 (2011) 75-79. [8] J. S. Chen, E. Ma, L. B. Harrington, M. Da Costa, X. Tian, J. M. Palefsky, J. A. Doudna, Science 360 (2018) 436-439. [9] J. S. Gootenberg, O. O. Abudayyeh, M. J. Kellner, J. Joung, J. J. Collins, F. Zhang, Science 360 (2018) 439-444. [10] S. Lutz, P. Weber, M. Focke, B. Faltin, J. Hoffmann, C. Müller, D. Mark, G. Roth, P. Munday, N. Armes, O. Piepenburg, R. Zengerle, F. von Stetten, Lab Chip 10 (2010) 887-893. 14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

[11] S. Santiago-Felipe, L. A. Tortajada-Genaro, R. Puchades, A. Maquieira, Anal. Chim. Acta 811 (2014) 81-87. [12] S. E. Murinda, A. M. Ibekwe, S. Zulkaffly, A. Cruz, S. Park, N. Razak, F. M. Paudzai, Ab Samad L, K. Baquir, K. Muthaiyah, B. Santiago, A. Rusli, S. Balkcom, Foodborne Pathog. Dis. 11 (2014) 529-536. [13] G. Choi, J. H. Jung, B. H, Park, S. J. Oh, J. H. Seo, J. S. Choi, D. H. Kim, T. S. Seo, Lab Chip 16 (2016) 2309-2316. [14] H. Ahn, B. S. Batule, Y. Seok, M. G. Kim, Anal. Chem. 90 (2018) 10211-10216. [15] E. J. Wee, T. H. Ngo, M. Trau, Sci. Rep. 5 (2015) 15028. [16] O. Piepenburg, C. H. Williams, D. L. Stemple, N. A. Armes, PLoS Biol. 4 (2006) e204. [17] M. L. Powell, F. R. Bowler, A. J. Martinez, C. J. Greenwood, N, Armes, O. Piepenburg, Anal. Biochem. 543 (2018) 108-115. [18] D. J. Chiao, J. J. Wey, R. H. Shyu, S. S. Tang, Hybridoma 27 (2008) 31-35. [19] S. Z. Hossain, R. E. Luckham, M. J. McFadden, J. D. Brennan, Anal. Chem. 81 (2009) 9055-9064. [20] J. Hu, R. Huang, Y. Sun, X. Wei, Y. Wang, C. Jiang, Y. Geng, X. Sun, J. Jing, H. Gao, Z. Wang, C. Dong, J. Microbiol. Methods 158 (2019) 25-32. [21] C. Song, Q. Liu, A. Zhi, J. Yang, Y. Zhi, Q. Li, X. Hu, R. Deng, J. Casas, L. Tang, G. Zhang, J. Agr. Food Chem. 59 (2011) 9319-9326. [22] T. Xiang, Z. Jiang, J. Zheng, C. Lo, H. Tsou, G. Ren, J. Zhang, A. Huang, G. Lai, Int. J. Mol. Med. 30 (2012) 1041-1047. [23] W. C. Ding, J. Chen, Y. H. Shi, X. J. Lu, M. Y. Li, Arch. Virol. 155 (2010) 385-389. [24] M. Magiati, A. Sevastou, D. P. Kalogianni, Microchim. Acta 185 (2018) 314. [25] Y. Zhao, F. Chen, Q. Li, L. Wang, C. Fan, Chem. Rev. 115 (2015) 12491-12545. [26] J. Hu, R. Huang, Y. Wang, X. Wei, Z. Wang, Y. Geng, J. Jing, H. Gao, X. Sun, C. Dong, C. Jiang, J. Microbiol. Methods 154 (2018) 127-133.

15

1

Figure captions

2

Fig. 1 Screening of primer combinations through PCR-AGE and RPA-AGE (A) and identification of

3

the potential optimal primer pair, EOF4/EOR3, by RPA-LFD (B). (A) M: DNA marker; lanes

4

1, 3, 5, 7, 9, 11, and 13 for PCR screening; lanes 2, 4, 6, 8, 10, 12, and 14 for RPA screening;

5

lanes 1, 2: EOF1/EOR1 (207 bp); lanes 3, 4: EOF2/EOR2 (110 bp); lanes 5 and 6:

6

EOF3/EOR2 (218 bp); lanes 7 and 8: EOF4/EOR2 (327 bp); lanes 9 and 10: EOF3/EOR3 (125

7

bp); lanes 11 and 12: EOF4/EOR3 (233 bp); and lanes 13 and 14: EOF4/EOR4 (142 bp). The

8

genomic DNA of E. coli O157:H7 was used as the template for PCR and RPA reactions. (B)

9

Lanes 1, 2, and 3: rpUCm-rfbE (positive control), genomic DNA of E. coli O157:H7, and

10

ddH2O used as the template, respectively; C: Control line and T: Test line; AGE: Agarose

11

electrophoresis; RPA: Recombinase polymerase amplification; LFD: Lateral flow dipsticks

12

Fig. 2 Combination and position of the optimal primer combination EOF4/EOR3 and probe EOProb.

13

The nonunderlined base “A” replaced with “THF” in the EOProb design would be present in

14

the target sequence of RPA product. THF: Tetrahydrofuran

15

Fig. 3 Optimization of RPA reaction temperature. (A) AGE and (B) LFD detection of RPA products.

16

M: DNA marker, 1: 37 °C, 2: 38 °C, 3: 39 °C, 4: 40 °C, 5: 41 °C, 6: 42 °C, C: Control line, T:

17

Test line.

18

Fig. 4 Optimization of the RPA reaction volume. (A) AGE and (B) LFD detection of RPA products. M:

19

DNA marker, 1: 5 µL, 2: 10 µL, 3: 20 µL, 4: 30 µL, 5: 40 µL, 6: 50 µL, C: Control line, T: Test

20

line.

21

Fig. 5 Optimization of RPA reaction time. (A) AGE and (B) LFD detection of RPA products. M: DNA

22

marker, 1: 5 min, 2: 10 min, 3: 15 min, 4: 20 min, 5: 25 min, 6: 30 min, C: Control line, T: Test

23

line. 16

1

Fig. 6 Sensitivity analysis of RPA-LFD. (A) AGE detection of the PCR product. (B) AGE and (C)

2

LFD detection of RPA products. M: DNA marker, 1: 0.1 ng, 2: 10 pg, 3: 1 pg, 4: 100 fg, 5: 10

3

fg, 6: 5 fg, 7:1 fg, 8: 100 ag, C: Control line, T: Test line. Tenfold serially diluted genomic

4

DNA of E. coli O157:H7 used as the template for PCR and RPA reactions.

5

Fig. 7 Evaluation of RPA-LFD for detecting raw milk artificially contaminated with E. coli O157:H7.

6

(A) AGE detection of the PCR product. (B) AGE and (C) LFD detection of RPA products. M:

7

DNA marker, 1: 4.4 × 107 CFU/mL, 2: 4.4 × 106 CFU/mL, 3: 4.4 × 105 CFU/mL, 4: 4.4 × 104

8

CFU/mL, 5: 4.4 × 103 CFU/mL, 6: 4.4 × 102 CFU/mL, 7:4.4 × 101 CFU/mL, 8: 4.4 × 100

9

CFU/mL, 9: Negative control, C: Control line, T: Test line. Tenfold serially diluted genomic

10

DNA extracted from E. coli O157:H7-contaminated raw milk used as the template for RPA

11

reactions.

17

1

Fig. 1

2

M 1

2

3

4

5

6

7

8

9 10 11 12 13 14

1

2

3

3 4 5 6 7

C

1500bp 1000bp 900bp 800bp 700bp 600bp 500bp 400bp 300bp 200bp 100bp

T

A

18

B

1

Fig. 2

2 3 4 5 6 7

19

1

Fig. 3

2 3 4 5 6

M

1

2

3

4

5

6

1

2

3

4

5

6

C

1500bp 1000bp 900bp 800bp 700bp 600bp 500bp 400bp 300bp 200bp

T

100bp

A 7

20

B

1

Fig. 4 M

2 3 4 5 6

1

2

3

4

5

1

6

2

3

4

5

6

1500bp 1000bp 900bp 800bp 700bp 600bp 500bp 400bp 300bp 200bp 100bp

C T

A

7

21

B

1

Fig. 5 M

2

5

1500bp 1000bp 900bp 800bp 700bp 600bp 500bp 400bp 300bp 200bp

6

100bp

3 4

1

2

3

4

5

6

1

2

3

4

5

6

C

T

A

7

22

B

1

Fig. 6 M

2 3 4 5 6

1

2

3

4

5

6

7

8

M

1

2

3

4

5

6

7

8

1

2

3

4

5

6

7

8

C

1500bp 1000bp 900bp 800bp 700bp 600bp 500bp 400bp 300bp 200bp 100bp

T

A

B

7

23

C

1

Fig. 7

2

M 1

2

3

4

5 6

7

8

9

M

1

2

3

4

5

6

7

8

9

1

2

3

4 5

6

7 8

9

C 3

1500bp 1000bp 900bp 4 800bp 700bp 600bp 500bp 5 400bp 300bp 200bp 6 100bp

T

A

B

7

24

C

1

Table 1 Primers and probes used in this study Name

2 3 4 5

Sequence (5′→3′)

Length (bp)

Sense

Application

EOF1

GCCCAGTTAGAACAAGCTGATGATTTTATATCACG

35

+

PCR/RPA

EOF2

CATCCATGTGATATGGAACAAATTGTAGAACTGGC

35

+

PCR/RPA

EOF3

CCCCATTTTCGTTGATTCAGATAATGAAACTTGGC

35

+

PCR/RPA

EOF4

TCTTCATTTAGCTTTGTTAGCGTTAGGTATATCGG

35

+

PCR/RPA

EOR1

CCTTGTTTCGATGAGTTTATCTGCAAGGTGATTCC

35



PCR/RPA

EOR2

CCCACATATTTACCTTTATATTTAGAACCAAAGGC

35



PCR/RPA

EOR3

CCATATCACATGGATGTCCGTATAAATGGACACAC

35



PCR/RPA

EOR4

CCAAGTTTCATTATCTGAATCAACGAAAATGGGGG

35



PCR/RPA

EOProb

FAM-TGTCTGTTAGTGACATAGAACAAAAAATCACT-TH F-ATAAAACTAAAGCTATT-C3-Spacer

49

+

RPA

Dig, digoxin; FAM, carboxyfluorescein group; C3-Spacer, polymerase extension blocking group; THF, internal a basic nucleotide analogue replacing a base (A) that would be present in the target sequence of RPA product; all primers used in both PCR and RPA reaction while the probe EOProb used for RPA reaction; +, forward direction; –, reverse direction.

25

1 2 3 4 5

Table 2 Specificity analysis of RPA-LFD for E. coli O157:H7 Strain name

Strain code

PCR-AGE

RPA-AGE

RPA-LFD

Bacillus cereus Campylobacter jejuni Clostridium perfringens Cronobacter sakazakii Escherichia coli Escherichia coli (Top10) Escherichia coli O157:H7

CMCC(B) 63303 CICC 22936 ATCC 13124 ATCC 29544 CICC 10032 No ATCC 25922 ATCC 35150 ATCC 43888 ATCC 43895 ATCC 700728 ATCC 19115 CMCC(B) 49027 ATCC 27853 CMCC 50041 ATCC 51741 ATCC 9150 BNCC 108207 ATCC12028 CMCC 51592 CMCC(B) 51572 CMCC 51105 BNCC 337755 ATCC 17802 CMCC(B) 52204

– – – – – + + + + + + – – – – – – – – – – – – – –

– – – – – + + + + + + – – – – – – – – – – – – – –

– – – – – + + + + + + – – – – – – – – – – – – – –

6 7 8 9 10 11 12 13 14

15 16 17

Listera monocytogenes Proteusbacillus vulgaris Pseudomonas aeruginosa Salmonella enteritidis Salmonella infantis Salmonella paratyphi Salmonella typhimurium Shigella boydii Shigella dysenteriae Shigella flexneri Shigella sonnei Staphylococcus aureus Vibrio parahaemolytieus Yersinia enterocolitica

CMCC, China Center for Medical Culture Collection; CICC, China Center of Industrial Culture Collection; ATCC, American Type Culture Collection; BNCC, BeNa Culture Collection; E. coli (TOP10), genetic engineered strain harboring recombinant plasmid rpUCm-rfbE as positive control; No, without strain code; +, positive; –, negative.

26

Highlights 1. Minimal volume, optimal temperature and shortest time of RPA reaction was 10 µL, 39-42 °C and 10 min, respectively; 2. Limit of detection of RPA combined with probe was 1 fg and 4.4 CFU / mL for genomic DNA of E. coli O157: H7 and for E. coli O157: H7 in artificially-contaminated food sample, respectively; 3. RPA was highly specific for E. coli O157: H7 using 19 non-target foodborne bacteria as controls; 4. Experimental results can be directly judged by naked eye with free equipment.

1