Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

Gene, 173 (1996) 233-238 0 1996 Elsevier Science B.V. All rights reserved. 233 0378-1119/96/$15.00 GENE 098 10 Regulatory elements in the promoter...

806KB Sizes 0 Downloads 2 Views

Gene, 173 (1996) 233-238 0 1996 Elsevier Science B.V. All rights reserved.

233

0378-1119/96/$15.00

GENE 098 10

Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein (AP-1; AP-2; C/EBP;

HNF; NF-l/CTF;

peroxisome proliferators; peroxisome proliferator-activated

Karsten

Kristiansen”

Morten

Elholm”, Gurli Bjerking”, Jens Knudsenb,

aDepartment

of Molecular Biology; and blnstitute of Biochemistry, University of Odense, Odense, Denmark

Received by R. Padmanabhan:

28 July 1995; Revised/Accepted:

4 December/8

December

receptor; Spl)

and Susanne Mandrup”

1995; Received at publishers:

7 March

1996

SUMMARY

Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed lo-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP gene by electrophoretic mobility shift assay (EMSA) revealed specific binding of proteins from rat liver nuclear extracts to potential recognition sequences of NF-l/CTF, Spl, AP-1, C/EBP and HNF-3. In addition, specific binding to a DR-1 type element was observed. By using in vitro translated peroxisome proliferator activated receptors (PPAR) and a retinoid X receptor c1(RXRa), we demonstrated that this DR-1 element was capable of binding PPARa/RXRa, PPARG/RXRa and PPARy2/RXRa heterodimers. The PPARy2IRXRa heterodimer appeared to have the highest affinity for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed that deletion of the region containing the DR-1 element reduced transcriptional activity, and further indicated that three AP-2 sites and one NF-l/CTF site in the proximal promoter are of importance for basal promoter activity.

INTRODUCTION

Acyl-CoA-binding protein (ACBP) is a highly conserved IO-kDa protein which has been isolated from a number of different species ranging from human to yeast and plants (reviewed by Knudsen et al., 1993). We have demonstrated that ACBP can act as an intracellular acylCoA pool former (Mandrup et al., 1993) and transporter of acyl-CoA esters (Rasmussen et al., 1994). In addition, ACBP or peptides assumed to be derived by proteolytic Correspondence

to: Dr. S. Mandrup,

Department

of Molecular

Biology,

University of Odense, Campusvej 55, 5230 Odense M, Denmark. (+45-66) 15 86 96, ext. 2408; Fax (+45-65) 93 27 81;

Tel.

e-mail: [email protected]

processing of ACBP have been reported to: (1) displace diazepam from the benzodiazepine recognition site of the GABA, receptor; (2) displace benzodiazepines from the benzodiazepine recognition site in the outer mitochondrial membrane and increase the rate-limiting step in pregnenolone synthesis, i.e., cholesterol transport from the outer to the inner mitochondrial membrane; (3) suppress glucose stimulated release of insulin from isolated islets and perfused pancreas of the rat; (4) affect growth (reviewed by Knudsen et al., 1993); (5) exhibit antibacteassay; GABA, y-aminobutyric (Madison,

WI, USA); HNF-3,

aa, amino

ACBP, gene (DNA,

acid(s);

RNA) encoding

ACBP, ACBP,

acyl-CoA-binding ACO, acyl-CoA

protein; oxidase;

B-Gal (or B-gal), B-galactosidase; bp, base pair(s); CAT, chloramphenico1 acetyltransferase; cDNA, DNA complementary to RNA; DR, direct repeat(s); DTE, dithioerythritol; EMSA, electrophoretic mobility shift PII SO378-1119(96)00213-2

Genetics

hepatocyte

nuclear

Computer factor;

Group

HSE, high-

salt extract; kb, kilobase or 1000 bp; ID, identifier (sequence); NE, nuclear extract; nt, nucleotide(s); NF-1, nuclear factor 1; oligo, oligodeoxyribonucleotide;

Abbreviations:

acid; GCG.

PP, peroxisome

receptor(s); PPRE, PP responsive particle; RXR, retinoid X receptor; transcription

start point(s);

proliferator;

PPAR, PP activated

element; RNP, ribonucleoprotein TIU, trypsin inhibitor unit(s); tsp,

U B-gal, units B-galactosidase.

234 rial activity (Agerberth et al., 1993). These functions may be related to the acyl-CoA binding property of ACBP. Molecular cloning of the rat ACBP gene family, which comprises one expressed and 4 or 5 processed pseudogenes, demonstrated that the expressed ACBP gene belongs to the class of housekeeping genes (Mandrup et al., 1992; Kolmer et al., 1993). In keeping with this, in situ hybridization and immunohistochemical analyses have shown that the ACBP gene is ubiquitously expressed although the level of expression differs markedly among different tissues and cell types. In general, ACBP is highly expressed in secretory cells such as hepatocytes and steroid producing cells. Furthermore, we have shown that ACBP expression is induced during adipocyte differentiation (reviewed by Knudsen et al., 1993). In this report we present an analysis of the rat ACBP gene promoter delineating c&acting elements of importance for ACBP expression. EXPERIMENTAL

AND DISCUSSION

ing genes (Means and Farnham, 1990; Jolliff et al., 1991). The promoter region of the ACBP gene contains the hallmark of a typical housekeeping gene (Mandrup et al., 1992), and the possible importance of Spl is underscored by binding of Spl to non canonical Spl sites in the regions from nt -350 to -325 and from nt - 177 to - 147 of the ACBP promoter (Kolmer et al., 1993). We and others have previously shown that ACBP is present in high amounts in the liver (reviewed by Knudsen et al., 1993), and that the transcription from the ACBP gene is induced during adipocyte differentiation (Hansen et al., 1991). Transcription factors belonging to the C/EBP family are known to be involved in the regulation of hepatocyte (Li et al., 1990) as well as adipocyte specific gene transcription (Lin and Lane, 1992). Similarly, HNF-3 transcription factors are known to be involved in hepatocyte specific gene transcription (Pani et al., 1992), and proteins binding specifically to the HNF-3 consensus recognition sequence have also been identified in adipocytes (Enerbgck et al., 1992). Finally, AP-1 has been shown to be important for gene expression during adipose conversion (Distel et al., 1987).

(a) Identification of probable regulatory elements of the A CBP promoter by EMSA Computer-assisted analysis of the ACBP promoter

(b) Binding of PPAR to the promoter of the A CBP gene

region using the FINDTFD and FINDPATTERNS programs of the GCG Sequence Analysis Software Package revealed the presence of numerous consensus recognition sites for transacting factors (Fig. 1). The capability of a subset of these potential recognition sites to specifically bind proteins in rat liver nuclear extract (NE) was analyzed by EMSA which revealed specific binding to oligos encompassing the NF-l/CTF site at nt - 143, the Spl site at nt -484, the AP-1 site at nt - 747, the C/EBP site at nt -791, and the HNF-3 site at nt -824, respectively (Fig. 2). The NF-l/CTF (Jones et al., 1987) family and the Spl family (Kadonaga et al., 1986; Sogawa et al., 1993) of transcription factors have been shown to activate transcription of a variety of cellular and viral genes, and in particular the Spl family has been shown to be of crucial importance for basal transcription of housekeep-

At nt - 1525 and - 1257 the ACBP promoter harbors hexanucleotide direct repeats (DR) conforming to the consensus sequence reported for DR-1 type elements (Keller and Wahli, 1993). Such elements are known to bind several transcription factors belonging to the nuclear hormone receptor superfamily and to function as PPREs in the promoter region of several genes (reviewed by Keller and Wahli, 1993; Mangelsdorf and Evans, 1995). Heterodimers of individual members of the PPAR family and the RXR family are known to bind to the PPRE of the acyl-CoA oxidase (ACO) gene and to mediate the PP induced transcriptional activation of this gene (Gearing et al., 1993). Similarly, the liver enriched transcription factor HNF-4 is able to recognize DR-1 elements, and competitive binding of HNF-4 and PPAR/RXR to DR-1 elements modulating transcrip-

HNF3

-1600

DR-1

g

l:.ls_~~

m

AATCACCTAGTCAGCCTACCI-I-KTTAGTKTCCCG AATCACCTAGTCAGCCTACCTTTCTTAGTTCTCC~

100 bp

Fig. 1. Potential cis-regulatory elements in the promoter region the rat ACBP gene. Exon 1 is indicated by a box with the translated part filled in. A 38-bp direct repeat, the tsp (vertical arrows) and the potential transcription factor-recognition sites shown to bind proteins from rat liver nuclear extracts are indicated. Methods: Potential recognition sites for transcription factors were identified using the FINDTFD and the FINDPATTERNS programs of the GCG Sequence Analysis Software Package (Devereux et al., 1984), and selected sites were analyzed for their ability to bind proteins from rat liver nuclear

extracts

(see Figs. 2 and 3).

235

NE

-836 + -803 IO IO IO IO

~8

Fold excess

I

spanning

of proteins

the recognition

the ACBP promoter

- 729; Spl, -494 according [leupeptin incubated glycerol. assays

2

3

4

5

from rat liver nuclear sequences

lOO-fold excess of a heterologous regions,

CiEBPW-l IO Irn IM

of HNF-3

6

7 8

extracts

(lanes

l-5),

9

10

all indicated to -471;

to the procedure (1 Fg/ml),

probe relative

C/EBP

or [C(-32P]dGTP

by Gorski

(1 pg/ml),

20 min on ice in 25 p1 buffer Subsequently,

IO IO IO IO SPl HNF3 IO loo loo

(lanes 6-lo),

using the Klenow

(1 pg/ml)

containing

0.5 ng “P-labelled

and aprotinin

2.4 pg poly(dI-dC)i25

a 10 or lOO-fold excess of a homologous

or a heterologous

-836

competitor

purification

C/EBP,

Sprague

activation

of target

genes

has

been

reported

(Winrow et al., 1994; Hertz et al., 1995). Recently, the AC0 PPRE was reported to bind HNF-4 (Sladek, 1994). Using

EMSA

we detected

specific binding

of proteins

from rat liver NEs to an oligo containing the potential DR-1 element of the ACBP gene at nt - 1525 (Fig. 3A),

To

analyze

ACBP

expression

ments -7

covering

ACBP promoter effectively compete for binding of factors from rat liver NEs (Fig. 3A) indicating that this DR-1

USA).

pSV2-CAT.

element

taining

Given the abundance of HNF4 able that the retarded complex

is a functional

DR-1.

in liver NE it is conceivcontained HNF-4. Since

ACBP gene expression is induced by PPs (see below) and during adipocyte differentiation, we investigated whether PPAR/RXR heterodimers could bind to the ACBP DR-1 element in vitro. Fig. 3B demonstrates that in vitro translated rat RXRa, rat PPARa, mouse PPARG or mouse PPARy2 alone were unable to bind to the oligo encompassing the DR-1 element at nt - 1525 in the ACBP promoter, whereas binding was observed when in vitro translated RXRa was combined with either PPARa, PPARG or PPARy2. Since approximately equal amounts of the individual PPAR were used in the experiments, it appears that the PPARy2/RXR heterodimer has the highest affinity for the ACBP DR-1 element.

(v/v)

For competition

to the preincubation for 45 min) in

In

of importance

in hepatocytes,

was prepared

Galactosidase

elements

the ACBP

Chang

promoter

inhibitors

mM DTE/lO%

and added

to

300 g

to use. NEs were

gels (pre-electrophoresed

regulatory

constructs

of the ACBP

approx.

and protease

the

-753

(c) Analysis of the ACBP promoter by transient

These

DR-1 element

Dawley rats weighing

probe

covered

to - 774; AP-1;

transfection

human

the potential

-805

for 20 min at room temperature.

at nt - 1257 (results not shown). The PPRE of the AC0 promoter and the DR-1 element at nt - 1525 of the

but not to an oligo containing

oligos and filling in the

to all buffers just prior

was mixed with the labelled

in

probe, and a

The probes

pH 7.6!40 mM KCI/O.I mM EDTA/l

was incubated

Probes

and NF-1 (lanes 21-25)

of the nuclei was omitted

were added

mixture. Free DNA and DNA-protein complexes were resolved by electrophoresis in 4% polyacrylamide 50 mM TrisHCl pH 8.51380 mM glycine/2 mM EDTA at 12 V per cm for 1.5 h at 4’C.

tional

16-20),

of single-stranded

to -803;

from 3-month-old

mM Hepes

21 22 23 24 25

Spl (lanes

by annealing

(0.01 TIU/ml)]

DNA probe was added and the mixture

? 5 W-1 AC0 IO loo loo

of the E. co/i DNA polymerase.

HNF-3,

et al. (1986) except that the second

pepstatin

5

with a lo- and lOO-fold excess of the cognate

fragment

start codon:;

llL15),

5

sites in the rat ACBP promoter.

factor-binding

AP-I (lanes

was performed

Ni-I -156 + -126

16 17 18 19 20

transcription

- 156 to - 126. Rat liver NEs were prepared

described

antipain

IO IO IO IO AP-I AC0 10 loo loo

(NE) to potential

to the A in the translation

NF-l/CTF,

SP’ -494 -+ -411

Methods: DNA probes were prepared

as indicated.

ends with [a-3zP]dCTP

AP- I -757 -+ -729

I1 12 I? 14 I5

were used for EMSA. With each probe competition

single nt 3’-recessive following

-805 + -774 Ill IO IO IO

HNF3 Spl IO IM 100

Competitor

Fig. 2. Binding

CIEBP

HNF3

Probe

and

a nested

promoter

ligated

to a cat reporter

were transiently

control

vector the

transfected

(Promega,

cells

were

to -8

promoter

to

gene.

into

the

with the pSV-bMadison,

WI,

transfected

Fig. 4 shows that the reporter

the -2296

set of frag-

from nt -2296

liver cell line together

addition,

for

with

construct

region

con-

exhibited

an

activity almost as high as the strong SV40 enhancer/promoter in pSV2-CAT, whereas promoter activity was almost -2296 tains

halved upon deletion of the region between nt and - 1439. It is noteworthy that this region conthe DR-1

element.

Further

- 392 did not lead to further activity.

Deletion

- 182 resulted ity, and further

of the region

in a significant deletion

deletions

reduction

down

between

nt

-392

decrease in promoter

of the region

to nt

in transcriptional

between

and activ-

nt - 182

and - 124 led to an almost complete loss of promoter activity. The region from nt -392 to - 182 contains a sequence sequence

conforming

to

the

for the glucocorticoid

consensus receptor.

recognition However,

we

have shown that glucocorticoids do not stimulate expression of the ACBP gene in hepatocytes (unpublished

236 Probe NE

pg

-

AC0

PPRE

5

5

Competitor

ACBP

5

5

AC0

Fold excess

-

5

DR- 1 5

ACBP

10

loo

loo

3

4

5

5

5

ACBP

AC0

10

loo

loo

8

9

10

A

1

2

6

7

ACBP DR- 1

Probe Lysate

pl

PPARcl

pl

PPARG

pl

PPARy

pl

RXRcc

pl

-

2

1

1

1

1

1

1 1

1 1

1 1

1

1

1

results). Another prominent feature of the - 391 to - 182 region is the presence of a cluster of three potential AP-2 sites. Kolmer et al. (1993) demonstrated that an oligo spanning this region specifically bound proteins in nuclear extracts from different cell types. Thus, it is conceivable that AP-2 contribute considerably to basal transcriptional activity of the ACBP promoter. The severe reduction in transcriptional activity seen upon deletion of the - 182 to - 124 region coincide with the loss of the NF-l/CTF recognition sequence suggesting an important role for this element in ACBP transcription. Although EMSA clearly showed that the HNF-3, the C/EBP, and the AP-1 element each specifically bound proteins in NEs from rat liver, deletion of these sites did not reduce promoter activity in transient transfection experiments. This observation does not, however, imply that HNF-3, C/EBP and AP-1 are not involved in regulation of ACBP expression in hepatocytes, but is more likely to underscore the housekeeping promoter character of the ACBP gene. Several reports have demonstrated that housekeeping gene promoters contain a plethora of functional recognition sequences for various transcription factors and that high basal promoter activity can be observed even upon deletion of the majority of these sequences (Chung and Perry, 1993). (d) The functional significance of the DR-1 element of the A CBP promoter

To further investigate the functional significance of the DR-1 element of the ACBP gene we analyzed the effect of the peroxisome proliferator Wy 14,643 on the ACBP mRNA level in cultured rat liver H4IIEC3 cells. There was a significant induction of the ACBP mRNA comparable to the induction of the AC0 mRNA (Fig. 5). This is in accordance with a recent report showing that addition of PP to hepatocytes in vitro increases the level of ACBP (Vanden Heuvel et al., 1993) and that feeding rats 1 Fig. 3. Analysis EMSA. AC0

PPRE

element

of protein

(A) Competition PPRE

as probes.

3

of proteins (lanes

Lane

4

binding between

for binding

using the AC0

2

1-5)

6

5

7

to the ACBP the ACBP

DR-1

DR-1

8

9

element

element

by

and the

RXRa

combined

with lysates

programmed

PPARcl (lane 7), PPARG (lane 8), and PPARy

(lane 9). Methods: (A) See legend to Fig. 2. (B) EMSA was performed as described

1, free AC0

lOO-fold ACBP

encoding encoding

in rat NE. EMSA was performed PPRE;

DR-1

(lanes

lanes 2-5, AC0

6-10) PPRE

free ACBP DR-1; lanes 6610, ACBP DR-1 plus NE; lanes S-9, competilo- and

with plasmids

or the ACBP

plus NE; lanes 334, competition with lo- and lOO-fold excess AC0 with lOO-fold excess ACBP DR-1; lane 6, PPRE; lane 5, competition tion with

with a plasmid

DR-1;

lane

10, competition

with

lOO-fold excess of AC0 PPRE. (B) Binding of in vitro translated PPARa/RXRa, PPARG/RXRu and PPARyZ/RXR heterodimers to the ACBP DR-1 element. EMSA was performed using unprogrammed lysate and lysates programmed with plasmids encoding RXRc(, PPARa, PPARG, and PPARy as indicated. Lane 1, free ACBP DR-1 probe; lane

in the legend to Fig. 2. Linearized

plasmids

encoding

rat

PPARc( (Giittlicher et al., 1992) mouse PPARG (Amri et al., 1995) mouse PPARy2 (Tontonoz et al., 1994) or rat RXRc( (Gearing et al., 1993) were transcribed

in vitro using SP6 or T7 RNA polymerase

as

described by Milligan et al. (1987). In vitro translation was performed using a Promega nuclease-treated rabbit reticulocyte system as recommended

by the manufacturer

except that translation

was performed

in

the presence of 40 uM ZnCI,. EMSA was performed as described in the legend to Fig. 2 using 1 ul of the appropriate translation mixture

2, unprogrammed lysate; lanes 3-6, unprogrammed lysate plus lysates programmed with plasmids encoding PPARa (lane 3), PPARG (lane

as indicated. If necessary, the total amount of reticulocyte lysate was adjusted to 2 ul by the addition of unprogrammed lysate. The AC0 PPRE probe was a 2%bp oligo containing the core motif 5’-TGACCTTTGTCCT (Gearing et al., 1993). The ACBP DR-1 probe

4), PPARy

corresponded

(lane 5) and RXRu (lane 6); lanes 7-9, lysate programmed

to the region from nt - 1536 to - 1503 of the rat ACBP

gene (cf., Fig 1).

237 ACBP expression 4.5

1600

n

AC0 expression

4 8

3.5

‘S s % .r(

3

I! LZ

G

4 2

2.5

800

2 1.

600

1

4

0.5

0

300

WY 14,643(IN Fig. 5. Induction proliferator

ACBP promoter - cat constructs Fig. 4. Analysis

of the

Methods: The different of prACBP6 tional

promoter

SE 4.3 (Mandrup

exonuclease

Basic vector (Promega,

Madison,

micin and 2.5 pg amphotericin p-Galactosidase

regions were isolated

13) were grown

vector

and

as subfragments by unidirec-

into the pCAT-

in 85 mm plates

in

calf serum and 100 pg genta-

Cells were co-transfected 12-24 pg ACBP

atmo-

with 6 pg pSV-

promoter-cat

construct

according to the size of the plasmid. For comparison, cells were also transfected with 6 pg pSV-P-Galactosidase vector plus 12 pg pSV2-CAT.

The total amount

30 pg by the addition Transient

transfection

Czphosphate/HEPES mined

was

as described

(Stratagene,

performed

protocol

using a CAT ELISA

determined

of DNA for transfection

of pBluescript

mRNA

and protein

(Sterchele

(ATCC cat. no.

(Sigma, St Louis, MO, USA) containing

to

described

by Chomczynski

blotting.

The probes

fragment

of the rat ACBP

1991), the (Osumi

the cells were exposed to different

of Wy 14,643. Total RNA was isolated

1.3-kb

used for hybridization

PstI

cDNA

fragment

of the AC0

et al., 1984) and a DNA fragment

by random exposed

primer

extension

as described

EcoRI

(Hansen

cDNA

et al.,

clonepMJ102

from the conserved

region

Maden et al., 1987) all 32P-labelled

(Ausubel

to the filters and densitometric

were performed

+6 as

were the 458-bp

clone rlcACBP-E2b

of human 28 S rRNA (nt 3647-4438,

at day

( 1987) and analyzed by Northern

and Sacchi

previously

et al., 1991). X-ray films were scanning (Hansen

and normalization et al.. 1991).

to

the

standard

et al., 1991). CAT was deter-

kit (Boehringer),

induces

in DMEM

day -2 and + 6 relative to confluence concentrations

and p-gal activity

was

et al. (1991).

ACKNOWLEDGEMENTS

We thank

the hepatic

level of ACBP

et al., 1994).

Thus, members of the PPAR family are likely to be involved in the PP-activated transcriptional induction of ACBP in hepatocytes, possibly through interaction with the DR-element at nt - 152.5. Several results indicate that fatty acids or their derivatives may be the natural endogenous activators of the PPAR family (reviewed by Mangelsdorf and Evans, 1995), and thus, PPAR may activate the ACBP gene in response to an increase in the intracellular pool of fatty acids or acyl-CoAs suggesting a possible feed-back regulation of ACBP expression by ACBP itself.

(also for Addendum)

Connie

expert technical

with PPs significantly

by the peroxisome

La Jolla, CA, USA).

according

(Ausubel

by Ausubel

was adjusted

expression

10% fetal bovine calf serum and 100 pg gentamicin and 2.5 pg amphotericin B per ml. The medium was changed every second day. Between

transfection.

B per ml at 37°C in a humified

6.5% CO,.

and AC0

Wy 14,643. Methods: The cell line H4IIEC3

1600) was cultured

WI, USA) using the XbaI site. Chang

with 10% fetal bovine

sphere containing

by transient

or PCR, and ligated

cat. no. CCL

medium

promoter

et al., 1992) or generated

III digestion

liver cells (ATCC EMEM

ACBP

of ACBP

Gram

assistance,

and Margrette Dr. Martin

Kjeldsen

Giittlicher

for

for the

rat PPARa and rat RXRa clones, Dr. Paul A. Grimaldi for the mouse PPARG clone, Dr. Bruce M. Spiegelman for the mouse

PPARy2

clone and Dr. Rolf K. Berge for

the AC0 fragment. This work was part of a program within the Protein Engineering Research Centre under the Danish Biotechnology Research Program and Development Program, and was further supported by grants from the Danish Natural Science Research Council and the Albani Foundation.

REFERENCES Agerberth,

B., Boman,

A., Andersson,

M., Jiirnvall,

Boman, G.H.: Isolation of three antibacterial intestine: gastric inhibitory polypeptide (7-42),

H., Mutt,

V. and

peptides from pig diazepam-binding

238 inhibitor (32286) and a novel factor, peptide 276 (1993) 6233629. Amri, E.-Z., Bonino, P.A.: Cloning

F., Ailhaud,

of a protein

3910. Eur. J. Biochem.

G., Abumrad,

that mediates

N.A. and Grimaldi,

transcriptional

effects of

fatty acids in preadipocytes. Homology to peroxisome proliferatoractivated receptors. J. Biol. Chem. 270 (1995) 236772371. Ausubel,

F.M., Brent, R., Kingston,

R.E., Moore,

Smith, J.A. and Struhl, K.: Current Protocols John Wiley and Sons, New York, 1992. Chomczynski,

P. and Sacchi, N.: Single-step

D.D., Seidman, in Molecular

method

Chung,

S. and Perry,

R.P.: The importance

binding elements for the activity Acids Res. 21 (1993) 3301I3308. den Dunnen,

J.T. and Schoenmakers,

the Rattus

J.G.G.:

extraction. S-factor

promoter.

Consensus

noruegicus Bl- and B2 repeats.

J.G.,

Biology.

of downstream

of the rpL32

Li, X., Huang,

of RNA isolation

by acid guanidinium thiocyanate-phenol-chloroform Anal. Biochem. 162 (1987) 156-159.

Nucleic

sequences

Nucleic

of

Acids Res. 15

(1987) 2772. Devereux,

J., Haeberli,

sequence

analysis

P. and Smithies, programs

0.:

A comprehensive

for the VAX. Nucleic

(1984) 3877395. Distel, R.J., Ro, H.-S., Rosen, B.S., Groves, Nucleoprotein

complexes

that regulate

differentiation:

direct participation

D.L. and Spiegelman,

of two &-regulatory

regions,

tance for the differentiation-linked adipogenesis. Gearing,

K.L., Giittlicher,

and retinoid

X receptor.

a chimera

glucocorticoid

Knudsen, in 3T3-Li entiation. Hertz,

Proc.

Natl.

M. and Schibler,

from the mouse albumin

4653-4657. Hansen, H.O.,

E. and Gustafsson,

Proc.

Andreasen,

P.H.,

Biochem.

promoter.

Acad.

Mandrup,

during

J.-A.: Fatty acids

acid-activated

Natl.

in vitro tran-

Cell 47 (1986) 767-776. receptor

Sci. USA

S., Kristiansen,

of acyl-CoA-binding

cells by insulin

receptor

Sci. USA 90 (1993)

E., Li, Q. and Gustafsson,

receptor.

J.: Induction

Acad.

U.: Tissue-specific

of the clofibric

protein

and the 89 (1992) K. and

and its mRNA

preadipocyte-to-adipocyte

differ-

J. 227 (1991) 341-344.

R., Bishara-Shieban,

peroxisome

of impor-

of the LPL gene during

M., Teboul, M., Widmark,

M., Widmark,

activate

LP-a and LP-b,

induction

of the peroxisome-proliferator-activated

1440-1444. Gorski, K., Carneiro, scription

L. and Bjursell, G.: lipase (LPL) promoter:

Mol. Cell. Biol. (1992) 4622-4633.

J.-A.: Interaction

Giittlicher,

B.M.:

in adipocyte

of c-fos. Cell (1987) 8355844.

Enerblck, S., Ohlsson, B.G., Samuelsson, Characterization of the human lipoprotein evidence

set of

Acids Res. 12

gene expression

proliferators

J. and Bar-Tana,

J.: Mode

as hypolipidemic

drugs.

of action

Suppression

of of

apolipoprotein C-III. J. Biol. Chem. 270 (1995) 13470-13475. Jolliff, K., Li, Y. and Johnson, L.F.: Multiple protein-DNA interactions in the TATAA-les 53 mouse thymidylate Acids Res. 11 (1991) 226772274. Jones, K.A., Kadonaga, J.T., Rosenfeld, A cellular DNA-binding

protein

synthase

promoter.

Nucleic

P.J., Kelly, T.J. and Tjian, R.:

that activates

eukaryotic

transcrip-

tion and DNA replication. Cell 48 (1987) 79989. Kadonaga, J.T., Jones, K.A. and Tjian, R.: Promoter-specific activation of RNA polymerase II transcription by Spl. Trends Biochem. Sci.

1I (1986) 20-23. Keller, H. and Wahli, W.: Peroxisome proliferator-activated A link between endocrinology and nutrition. Trends

receptors. Endocrin.

Metabol. 4 (1993) 291-296. Knudsen, J., Mandrup, S., Rasmussen, J.T., Andreasen, P.H., Paulsen, F. and Kristiansen, K.: The function of acyl-CoA-binding protein (ACBP)/Diazepam binding inhibitor (DBI). Mol. Cell. Biochem. 123 (1993) 1299138. Kolmer, M., Alho, H., Costa, E. and Pani, L.: Cloning and tissue-specific functional characterization of the promoter of the rat diazepam binding inhibitor, a peptide with multiple biological actions. Proc. Natl. Acad. Sci. USA 90 (1993) 843998443.

Lee, W., Haslinger, A., Karin, M. and Tjian, R.: Activation of transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40. Nature 325 (1987) 3688372. J.H., Rienhoff Jr., H.Y. and Liao, W.S.-L.: Two adjacent

C/EBP-binding sequences that participate in the cell-specific expression of the mouse serum amyloid A3 gene. Mol. Cell. Biol. 10 (1990) 6624-663 I. Lin, F-T. and Lane, M.D.: Antisense CCAAT/enhancer-binding protein RNA suppresses coordinate gene expression mulation during differentiation of 3T3-Ll Dev. 6 (1992) 533-544.

and triglyceride accupreadipocytes. Genes

Maden, B.E.H., Dent, C.L., Farrell, T.E., Garde, J., McCallum, F.S. and Wakeman, J.A.: Clones of human ribosomal DNA containing the complete 18 S-rRNA and 28 S-rRNA genes. Biochem. J. 246 (1987) 519-527. Mandrup, S., Hummel, R., Ravn, S., Jensen, G., Andreasen, P.H., Gregersen, N., Knudsen, J. and Kristiansen K.: Acyl-CoA-binding protein/diazepam-binding inhibitor gene and pseudogenes J. Mol. Biol. 228 (1992) 101 l-1022. Mandrup, S., Jepsen, R., Sk&t, H., Rosendal, J., Hojrup, P., Kristiansen, K. and Knudsen, J.: Effect of heterologous expression of acyl-CoAbinding protein on acyl-CoA level and composition in yeast. Biochem. J. 290 (1993) 3699374. Mangelsdorf, D.J. and Evans, R.M.: The RXR heterodimers and orphan receptors. Cell 83 (1995) 841-850. Means, A.L. and Farnham, P.J.: Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site. Mol. Cell. Biol. 10 (1990) 653-661. Milligan, J.F., Groebe, D.R., Witherell, G.W. and Uhlenbeck, O.C.: Oligonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res. 15 (1987) 878338798. Osumi, T., Ozasa, H. and Hashimoto, T.: Molecular cloning of cDNA for rat acyl-CoA oxidase. J. Biol. Chem. 259 (1984) 2031-2034. Pani, L., Qian, X., Clevidence, D. and Costa, R.H.: The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3b involves a cell-specific factor and positive autoactivation. Mol. Cell. Biol. 12 (1992) 552-562. Rasmussen, J.T., Fzrgeman, N.J., Kristiansen, K. and Knudsen, J.: Acyl-CoA-binding protein (ACBP) can mediate intermembrane acyl-CoA transport and donate acyl-CoA for B-oxidation and glycerolipid synthesis. Biochem. J. 299 (1994) 1655170. Ryden, T.A. and Beemon, K.: Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein. Mol. Cell. Biol. 9 (1989) 115551164. Sladek, F.M.: Hepatocyte and M. Yaniv (Eds.),

nuclear factor 4 (HNF-4). In: F. Tronche Liver Gene Expression. R.G. Landes Co.,

Austin, TX, 1994, pp. 2077230. Sogawa, K., Kikuchi, Y., Imataka, H. and Fujii-Kuriyama, Y.: Comparison of DNA-binding properties between BTEB and Spl. J. Biochem. 114 (1993) 605-609. Sterchele, P.F., Vanden Heuvel, J.P., Nesbit, D.J., Davis II, J.W., Shrago, E. and Peterson, R.E.: Induction of hepatic acyl-CoA-binding protein and fatty acid-binding protein by perfluorodecanoic acid: examination of a possible correlation to hepatic long-chain acylcoenzyme A levels. Biochem. Pharmacol. 48 (1994) 9555966. Tontonoz, P., Hu, E., Graves, R.A., Buddavari, A.I. and Spiegelman, B.M.: mPPARy2: tissue-specific regulator of an adipocyte enhancer. Genes Dev. 8 (1994) 122441234. Vanden Heuvel. J.P., Sterchele, P.F., Nesbit, D.J. and Peterson, R.E.: Coordinate induction of acyl-CoA binding protein, fatty acid binding protein and peroxisomal B-oxidation by peroxisome prohferators. Biochim. Biophys. Acta 1177 (1993) 1833190. Winrow, C.J., Marcus, S.L., Miyata, KS., Zhang, B., Capone, J.P. and Rachubinski, A.: Transactivation of the Peroxisome Prohferatoractivated receptor is differentially modulated by hepatocyte nuclear factor-4. Gene Exp. 4 (1994) 53-62.