Screening and identification of five peptides from pinto bean with inhibitory activities against α-amylase using phage display technique

Screening and identification of five peptides from pinto bean with inhibitory activities against α-amylase using phage display technique

Accepted Manuscript Title: Screening and Identification of Five Peptides from Pinto Bean with Inhibitory Activities against ␣-Amylase using Phage Disp...

742KB Sizes 0 Downloads 0 Views

Accepted Manuscript Title: Screening and Identification of Five Peptides from Pinto Bean with Inhibitory Activities against ␣-Amylase using Phage Display Technique Author: Ying-Yuan Ngoh Theam Soon Lim Chee-Yuen Gan PII: DOI: Reference:

S0141-0229(16)30054-0 http://dx.doi.org/doi:10.1016/j.enzmictec.2016.04.001 EMT 8892

To appear in:

Enzyme and Microbial Technology

Received date: Revised date: Accepted date:

2-12-2015 24-3-2016 2-4-2016

Please cite this article as: Ngoh Ying-Yuan, Lim Theam Soon, Gan CheeYuen.Screening and Identification of Five Peptides from Pinto Bean with Inhibitory Activities against rmalpha-Amylase using Phage Display Technique.Enzyme and Microbial Technology http://dx.doi.org/10.1016/j.enzmictec.2016.04.001 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Screening and Identification of Five Peptides from Pinto Bean with Inhibitory Activities against α-Amylase using Phage Display Technique

Ying-Yuan Ngoha, Theam Soon Limb, Chee-Yuen Gana*

a

Analytical Biochemistry Research Centre, Universiti Sains Malaysia, 11800 Penang,

Malaysia b

Institute for Research in Molecular Medicine, Universiti Sains Malaysia, 11800 Penang,

Malaysia *Corresponding author: Address: Analytical Biochemistry Research Centre, Universiti Sains Malaysia, 11800 USM, Penang, Malaysia Tel: +604 653 4260; Fax: +604 653 4688. Email: [email protected]

Highlights 

5 novel anti α-amylase peptides were screened from Pinto bean



SyP9 exhibited the highest α-amylase inhibition activity with IC50 of 1.97 mg ml-1



His, Pro and Met residues in PBBP were proposed to be critical for the binding



Binding sites of amylase were predicted to be Tyr54, Leu194, Met195, Asp229, Ala230, His233, Asp326



The phage display technique had enhanced the bioactive peptide discovery process

1

Abstract The objective of this study was to screen and identify α-amylase inhibitor peptides from Pinto bean. Five Pinto bean bioactive peptides were successfully identified: PPHMLP (P1), PLPWGAGF (P3), PPHMGGP (P6), PLPLHMLP (P7) and LSSLEMGSLGALFVCM (P9). Based on ELISA results, their promising optical density values were 1.27; 3.71, 1.67, 3.20 and 1.03, respectively, which indicated the binding interaction between the peptide and α-amylase occurred. The highest inhibitory activity (66.72%) of the chemically synthesized peptide was shown in SyP9 followed by SyP1 (48.86%), SyP3 (31.17%), SyP7 (27.88%) and SyP6 (23.96%). The IC50 values were 1.97, 8.96, 14.63, 18.45 and 20.56 mg ml-1, respectively. Structure activity relationship study revealed that α-amylase was inhibited due to its residues of Ala230, Asp229, Asp326, Tyr54, Met195, Leu194 and His233 were bound.

On the other hand, the

residues of PBBP (i.e. histidine, proline and methionine) were found to have the highest potency in the binding interaction.

Keywords: α-amylase inhibitor; bioactive peptides; phage display; Pinto bean

1.

Introduction Hyperglycaemia, is a term whereby blood sugar levels are elevated due to

insufficient production of insulin from the pancreas or unresponsive cells towards insulin [1]. An absolute deficiency in insulin secretion (type I diabetes) or insulin action (type II diabetes) or both leads to hyperglycaemia in diabetic patients. In recent years, the number of diabetes cases has increased tremendously with an estimated 30 million cases in 1985, 2

150 million cases in 2000, 246 million cases in 2007 and is expected to hit 380 million cases by 2025 [2]. Therefore, it is timely for the introduction of alternative therapeutic approaches to combat the alarming rate of diabetes. One such alternative treatment is through the inhibition of carbohydrate hydrolysing enzymes, such as α-amylase. α-Amylase was named by Kuhn in 1925. The word α-amylase was derived from the alpha configuration of the amylase hydrolysis product. It is an enzyme, which breaks down starch to simple sugars, such as maltose. To be more precise, α-amylase catalyses the hydrolysis of internal alpha-1,4-glucan links in polysaccharides containing 3 or more alpha-1,4-linked D-glucose units, yielding a mixture of maltose and glucose. After the starchy food consumption, α-amylase will immediately convert starch to simple sugars in our bodies. This is disadvantageous especially for diabetic patients, who have low insulin levels and the glucose content could not be cleared in their blood. Hence, the use of αamylase inhibitor is a potential therapy for diabetic patients to maintain a low level of glucose. Early detection of this disease is so crucial for early intervention and prevention. The detection systems are based on the visualization of exogenous probes such as antibodies and peptides that target unique protein expression patterns. Peptides are considered to be more advantageous as detection probes due to their high clonal diversity, rapid binding kinetics and low immunogenicity [3]. Apart from that, peptides (1-2 kDa) are considerably smaller in size compared to antibody fragments and do not bind to the reticuloendothelial system, thus they will not elicit an immune response upon repeated administration [4]. This is an important feature for efficient uptake of peptides as by the body with lower risk of immunogenicity. Therefore, exploring novel peptides that could 3

bind to α-amylase with high specificity and sensitivity is extremely important for the early detection and treatment of diabetic patients. Phage display is a selection technique whereby a library of peptides or proteins are expressed as a fusion with the coat proteins of a filamentous bacteriophage that exhibited on the surface of virion [5]. The main characteristic of phage display systems is the physical linkage of a polypeptide phenotypic nature corresponding to the genotype information as demonstrated by George Smith in 1985 [6]. Phage display has been acknowledged as an alternative and established method for the identification of novel peptides that exhibits selectivity to various target biomolecules (e.g. enzymes, cellsurface receptors and biomaterials) [7]. Phages can be produced rapidly and economically in large quantities and are very stable and resistant to degradation by organic solvents, proteases and heat [5]. Based on these advantages, we hypothesized that the peptide ligands displayed on the phage surface might provide attractive alternatives for the detection of interaction between α-amylase and phage bearing Pinto bean bioactive peptides (PBBP), thus contributing in the inhibition of α-amylase activity. Pinto bean (Phaseolus vulgaris cv. Pinto) is categorized as common bean, which was originated from Peru. It is an underutilised legume, which has been used as a staple food source in several countries (e.g. the United States and northwestern Mexico) due to its high protein content as well as its nutritional values. The top five producers of Pinto bean are the United States, China, Brazil, India and Indonesia. Our previous work proved that bioactive peptides derived from Pinto bean have the potential in inhibiting α-amylase activity [8]. In that study, eleven PBBP containing 6 to 16 amino acids were successfully identified. However, the capability of each PBBP in the α-amylase inhibitory activity was 4

remained unknown. To our knowledge, interactions between PBBP and α-amylase have also not been reported. Therefore, we explored the α-amylase inhibitory activities of the selected PBBP as well as their structure-activity relationship (SAR) in the current study in order to investigate the inhibition mechanism. In this study, we proposed to use phage display technology, which involved the cloning of predicted peptide sequences into a phagemid for the generation of peptide presenting phage particles. These phage particles were then used to determine the binding capabilities of each peptide with α-amylase before conducting the confirmatory testing using pure peptides. The identification of these peptides would provide an alternative avenue for α-amylase inhibition in the management of diabetes. 2.

Materials and methods

2.1

Bacterial strains, plasmids, enzymes, chemicals, and culture media In this study, Escherichia coli DH10β and XL1Blue that was used as the host

organism were purchased from Invitrogen (Carlsbad, California). E. coli was cultured in 2YT medium (Novagen, Merck KgaA, Darmstat, Germany) with the addition of 2% (w/v) glucose and 100 µg/ml ampicillin unless stated otherwise. Helper phage (M13KO7) and restriction enzymes (Nco1 and Not1) were purchased from New England Biolabs Inc. (Ipswich, MA, USA). Tween 20, 2-(N-morpholino)ethanesulfonic acid (MES), as well as Na2HPO4, KH2PO4, KCI and NaCI, which were used to prepare phosphate buffered saline (PBS), were purchased from Merck Millipore (Merck KgaA, Darmstat, Germany). Polyethylene glycol (PEG), glycine and α-amylase (Bacillus sp.) were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). 2,2’-azino-bis-ethylbenziazoline-6sulfonic acid (ABTS) and kanamycin were obtained from Amresco (Ohio, USA). Skim 5

milk was purchased from Nacalai Tesque (Kyoto, Japan). Ampicillin and Dream Taq DNA polymerase were obtained from Thermo Fisher Scientific (USA)

2.2

Molecular cloning and DNA sequencing of PBBPs In our previous published work [8], a total of 11 peptide sequences was identified,

as shown in Table 1 with their corresponding DNA sequences. Synthetic oligonucleotides representing the DNA sequences and a reverse primer (3’-TTTTCCTTTTCG-5’) were designed and ordered from Integrated DNA Technologies, USA. Molecular cloning technique was carried out as described previously in the work of Sambrook [9] with slight modifications. The oligonucleotides and primer were dissolved in Milli-Q water to a final concentration of 100 µm. A 50 µl reaction mixture of annealed duplex containing oligonucleotides (5 µg), primer (4 µg) and TE+NaCl was put into the thermal cycler which was undergoing polymerase chain reaction (PCR). The cycling condition for amplification was as follows: (1) 95 °C for 2 mins, (2) 90 °C for 0.10 s, (3) 80 °C for 1 min, (4) 70 °C for 1 min, (5) 60 °C for 1 min, (6) 50 °C for 1 min, (7) 40 °C for 1 min, (8) 30 °C for 1 min, and (9) 20 °C for 1 min. Subsequently, digestion was carried out overnight at 37 °C using restriction enzymes Not1 and Nco1. The product was then ligated into a digested pPEP vector at 4 °C overnight. Electroporationusing of electrocompetent DH10β cells was then performed using a micropulser. The suspension was pooled on the ampicillin agar plate and incubated overnight at 37 °C. Colony PCR was carried out using LMB3 forward primer (5’-CAG GAA ACA GCT ATG AC-3’) and PIII reverse primer (5’-GTT AGC GTA ACG ATC TAA-3’). The programme used was: (1) 95 °C for 90 s, (2) 20 cycles of 95 °C for 30 s; 55 °C for 30 s; 6

and 72 °C for 45 s, (3) 72 °C for 5 mins, and (4) 20 °C for ∞. The PCR product was then analysed using agarose gel electrophoresis. Clones exhibiting single bands were cultured overnight at 37 °C with constant shaking of 200 rpm. To purify the clones (DNA), miniprep was subsequently carried out using QIAprep Spin Miniprep Kit (Qiagen, USA) and then they were sent for sequence confirmation (Centre for Chemical Biology, Universiti Sains Malaysia, Malaysia).

2.3

Phage packaging Phage packaging was carried out as described by Loh et al. with slight

modifications [10]. Clones of PBBP sequences in XL1Blue cells were cultured until the OD600 value achieved 0.5 and then co-infected with M13KO7 helper phage at 37 °C for 30 mins. Amplification was carried out overnight at 30 °C with a constant shaking (180 rpm) and the addition of kanamycin (60 ug/ml). Supernatants containing phage-cloned peptides (PhP) were then purified through precipitation using PEG/NaCl for 1 h at 4 °C. After incubation, the phage-cloned peptides were pelleted by centrifugation and they were dissolved in phosphate buffered saline (PBS) buffer at pH 7.4.

2.4

Phage ELISA The binding interaction of the phage-cloned peptides with α-amylase (Bacillus sp.)

was examined using the phage ELISA. The protocol was performed according to Loh et al. with slight modifications [10]. A total of 10 µg of α-amylase in 100 µl of PBS (pH 7.4) was coated on the surface of each well of microtiter plate (Corning, USA) by incubation overnight at 4 °C followed by washing and blocking using 0.1% (v/v) PBST and 2% 7

(w/v) skim milk, respectively. Subsequently, a total of 109 cfu phage particles were incubated on the α-amylase coated ELISA plates followed by 100 µl of horseradish peroxidase (HRP)-conjugated M13 antibody for 1 h of incubation. Then, 100 µl of 2,2’azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) developing solution was added to each well and incubated for 30 mins in the dark at room temperature. Absorbance reading at 405 nm was measured using a microplate reader (Thermo Scientific Multiskan Spectrum, Finland).

2.5

Peptide synthesis Five phage-cloned peptides were selected (i.e. PhP1, PhP3, PhP6, PhP7 and PhP9)

from the result of phage ELISA analysis in order to be chemically synthesized. These peptides were obtained from 1st BASE, Malaysia. The chemically synthesized peptide (SyP) were then named as SyP1, SyP3, SyP6, SyP7 and SyP9, respectively.

2.6

Pull-down assay A total of 200 µl (10 mg) of SiMAG-Amine beads (Chemicell, Germany) were

washed 4 times with 1 ml of phosphate buffer saline (PBS, pH 7.4) using a magnetic separator followed by 3 times of washing with 1 ml of 2-(N-morpholino)ethanesulfonic acid (MES buffer, pH 6.0). After washing, 250 µl (10 mg) of 1-Ethyl-3-(3 dimethylaminopropyl)carbodiimide (EDC) was added to activate the amino groups of the beads. Immediately, 500 µl of α-amylase (10 mg/ml) was added to the beads and incubated overnight at 4 °C. The α-amylase-coupled beads were then added with blocking buffer (i.e. 2% (w/v) skim milk in 0.1% (v/v) PBST) and incubated for 1 h at 8

4 °C. Subsequently, the beads were washed 3 times with 1 ml of (PBS, pH 7.4). A total of 50 µl of the beads was then incubated with 100 µl of chemically synthesized peptide (SyP) (1 mg/ml) for 1 h at 4 °C. Once the incubation ended, the beads were washed again for 3 times with 1 ml of PBS (pH 7.4). The presence of the SyP and α-amylase were analysed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and 18% resolving gel was used in the experiment.

2.7

Reverse pull-down assay The assay was conducted as stated in Section 2.6 with modifications. Briefly,

after the SiMAG-Amine beads were washed and activated, they were coupled with chemically synthesized peptide (SyP) (100 µl, 1 mg/ml) overnight at 4 °C. The SyPcoupled beads were then added with blocking buffer (i.e. 2% (w/v) skim milk in 0.1% (v/v) PBST) and incubated for 1 h at 4 °C. Subsequently, the binding interaction took place when 500 µl of α-amylase (10 mg/ml) was added to the beads and incubated for 1 h at 4 °C. Once the incubation ended, the beads were washed again for 3 times with 1 ml of PBS (pH 7.4) and the presence of bound α-amylase was analysed using SDS-PAGE. Since the presence of SyP could not be detected using SDS-PAGE, tandem mass spectrometry analysis was conducted. Following the reverse pull down assay, 50 µl of the P1 beads were centrifuged gently to remove the supernatant. A 200 µl of 0.2 M glycineHCl (pH 2.0) was added to the SyP1 beads and incubated at 4 °C for 10 mins with a constant shaking of 300 rpm. The mixture was then centrifuged at 5000 rpm for 1 min at 4 °C and the supernatant was collected. These steps were repeated twice. The collected supernatant was filtered using ultra-centrifugal unit with MWCO of 30 kDa (Microcon, 9

Millipore, Ireland) to remove α-amylase. The filtrate was concentrated using a vacuum concentrator and then filtered using 0.2 µm syringe filter (Titan, SunSri, India) prior to tandem mass spectrometry analysis. The chromatographic separation and the MS conditions were described previously in details by Siow and Gan [11]. Subsequently, data analysis was performed using PEAKS studio version 6.0 to examine the existence of the SyP1. These procedures were repeated for SyP3, SyP6 and SyP7.

2.8

α-Amylase inhibition assay The α-amylase inhibition assay was performed according to the method of

Worthington [12]. A 100 µl of peptide solution (1 mg/ml) and 500 µl of 0.02 M sodium phosphate buffer (pH 6.9, in 6 mM NaCl) containing α-amylase (0.5 mg/ml) were incubated at 25 °C for 10 mins. Subsequently, 500 µl of 1% starch solution in 0.02 M sodium phosphate buffer (pH 6.9, containing 6 mM NaCl) was added into each tube. The reaction mixture was then incubated at 25 °C for 10 mins and the reaction was stopped by the addition of 1.0 ml of dinitrosalicylic acid reagent. Immediately, the mixture was heated in a boiling water bath for 5 mins and then cooled to room temperature. The reaction mixture was then diluted by adding 10 ml of distilled water and the absorbance at 540 nm was measured using a UV-Vis spectrophotometer (Spectramax M5, Molecular Devices, USA). The α-amylase inhibitory activity was expressed as percent inhibition as calculated using the following equation: % inhibition =

AControl −( ASample −ASample blank ) AControl

× 100%

(1)

10

where ASample blank was the absorbance of a mixture of starch solution and sample without the addition of enzyme, whereas AControl was the absorbance of a mixture of starch solution and enzyme without the addition of sample. Subsequently, IC50 was determined using the same protocol with different amounts of peptide as samples. The IC50 value was defined as the concentration of inhibitor required to inhibit 50% of the α-amylase activity.

2.9

Structure-activity relationship (SAR) study Current work utilized CABS Dock server in the SAR study. The three-

dimensional structure of Bacillus sp. α-amylase was imported from the Protein Data Bank (1BLI). Peptide sequences were keyed in as inputs along with a protein receptor in PDB format. Contact maps, which were generated as outputs, were then analysed accordingly.

2.10

Statistical analysis Statistical analysis was performed using SPSS for Windows, Version 12.0 (SPSS

Institute, Inc., Cary, NC). The results were compared using one-way analysis of variance (ANOVA) and the significance level was of p<0.05. All the measurements were performed in at least three replicates.

3.

Results and discussion

3.1

Molecular cloning and DNA sequencing A total of 11 Pinto bean bioactive peptides (PBBP) from Pinto bean hydrolysates

was identified in our previous work to show potential α-amylase inhibition and 11

antioxidant properties [8]. These sequences were cloned into a phagemid vector to allow the presentation of these peptides on the surface of phage particles. Sequence analysis will show the successful insertion of the peptides if there is no frame shift in the phagemid vector. Interestingly, only 9 of the 11 peptide sequences were successfully cloned, except for P5 and P10. The sequencing results showed incomplete and incorrect position of the His tag as a result of a frame shift during the cloning of P5. As for P10, sequencing results showed a substitution of the first amino acid in the sequence resulting in a change in the amino acid sequence. This phenomenon is common as substitutions and frame shifts could occur during the cloning process. Even with a substitution, the clone P10 has a well defined sequence being in frame with the sequencing result. Thus, all the clones with proper insertion of the peptide sequences was used for phage packaging and phage ELISA, except for P5.

3.2

Validation of phage clones by ELISA The interaction or binding efficiency of phage clones bearing PBBP to α-amylase

was validated using phage ELISA. The basis of cloning the peptides for presentation on phage was to improve the solubility and the yield of the peptides. Bacterial expression of peptides is difficult to yield a sufficient amount of peptide for analysis. The advantage of mounting the peptides on phage particles is also depending on the ability to generate higher readouts. All phage-cloned peptides (PhP) exhibited positive values of optical density at 405 nm (OD405nm) indicating an interaction between the PBBP and α-amylase (Fig. 1). This was further supported by the low OD405nm value for M13KO7 (OD405nm = 0.10), a negative control to ensure the absence of non-specific binding interaction 12

between the helper phage and α-amylase. The OD405nm value obtained by M13KO7 was reliable as it was found to be similar to the work of Chin et al. [13] and low background readings observed could be served as an indication of a clear enrichment of binders with low levels of non-specific binding. PhP3 (OD405nm = 3.71) showed the highest binding interaction with α-amylase followed by PhP7 (OD405nm = 3.20), PhP6 (OD405nm = 1.67), P1 (OD405nm = 1.27), PhP9 (OD405nm = 1.03), PhP8 (OD405nm = 0.64) and PhP2 (OD405nm = 0.62). The result suggested that there were interactions between these peptides and α-amylase. Meanwhile, phage clones of PhP4 (OD405nm = 0.11), PhP10 (OD405nm = 0.13) and PhP11 (OD405nm = 0.10) had low OD405nm values which close to that of the negative control (M13KO7). It is likely that these peptides (i.e. PhP4, PhP10 and PhP11) have a poor interaction with αamylase. In terms of OD values, there was no significant difference (p>0.05) observed between PhP4, PhP10, PhP11 and M13KO7 whereas the remaining phage clones (i.e. PhP1, PhP2, PhP3, PhP6, PhP7, PhP8 and PhP9) had significantly (p<0.05) higher values.

3.3

Pull-down assay Pull-down assay was carried out to confirm the binding interaction between the

chemically synthesized peptide (SyP) and α-amylase. Lane 2, 5 and 6 in Fig. 2(a) were representing the standard references for SyP9, skim milk and α-amylase, respectively. It could be observed that SyP9 (~1.6 kDa) could be detected in the SDS-PAGE gel (lane 2) whereas skim milk protein bands could be observed in lane 5 with molecular masses ranging from ~15 to ~25 kDa. α-Amylase (lane 6), on the other hand, could be observed in the region where the molecular masses were higher (~50–75 kDa). It should be noted 13

that skim milk was used as blocking agent in order to cover the remaining surface area of the beads after the bead-amylase coupling process. Therefore, these bands could be seen in the sample or negative control, as shown in lane 3 and 4, respectively. Lane 4 in Fig. 2(a) was used as negative control where peptide was proven that it did not bind with the bead after blocking with skim milk during the process. Therefore, the result in lane 3 confirmed that there was a binding interaction of SyP9 solely with α-amylase because both α-amylase and SyP9 bands could be observed. A residue of skim milk protein could also be seen in this lane due to the surface of the beads were not completely bound to the α-amylase during the coupling process. Due to low molecular masses (<1 kDa) of SyP1 (690 Da), SyP3 (843 Da), SyP6 (691 Da) and SyP7 (916 Da), they could not be detected in SDS-PAGE. Fig. 2(b) showed an example of SyP1 in lane 2, where there was no band detected in the gel. Therefore, a reversal pull down assay was conducted. The coupling process of the bead was carried out using the SyP instead and the binding interaction was performed by incubating the αamylase with the SyP-coupled beads. It could be observed that α-amylase was successfully bound to the SyP as the α-amylase band could be observed in lane 3 whereas lane 4 was used as negative control where the α-amylase was not bound onto the beads which blocked by the skim milk. To strengthen this point of view, further analysis using the LC MS/MS approach was carried out to detect the presence of these peptides in the peptide-coupled beads where α-amylase was bound. The obtained MS/MS spectra would confirm the presence of these SyP. For example, Fig. 3 shows the representative MS/MS spectra of the eluted SyP7 from the pull down assay. The fragmentation method used was collision-induced 14

dissociation (CID) as b- and y-ions could be observed in Fig. 3(a). In a CID MS/MS, many copies of the same peptide were fragmented at the peptide backbone to form b and y ions. A high resolution of 60,000 was applied for identification and confirmation of the peptide sequences based on the accuracy of the molecular ions [14]. Fig. 3(b) and (c) show the MS/MS fragments accompanied by the ion table. It was observed that the targeted sequence PLPLHMLP (P7) was found within the fragment spectra. It possessed high signal-to-noise ratio with a complete or near complete backbone fragmentation. A mass error less than 0.8 Da in Fig. 3(d) was also observed, indicating the high accuracy in deriving SyP7. Similar results were also obtained by SyP1, SyP3 and SyP6. Thus, the interactions between SyP1, SyP3, SyP6 and SyP7 and α-amylase have been firmly assured.

3.4

α-Amylase inhibitory activity of phage-cloned peptide (PhP) The binding characteristic of a peptide in phage ELISA would only reflect the

binding interaction of the peptide to α-amylase only. It does not indicate the functionality of the peptides in terms of their inhibitory activity. Therefore, the selected five phagecloned peptides (PhP1, PhP3, PhP6, PhP7 and PhP9) were used to screen for their potential in α-amylase inhibitory activity whereas M13KO7 and PhP11 (i.e. Irrelevant peptide) were used as negative controls. Any of these clones did not show positive response will not be synthesized for the following state of analysis. Fig. 4 shows that all selected PhP gave positive responses while M13KO7 and PhP11 did not show any inhibitory activities. This result indicated that there were no influence of M13KO7 or irrelevant peptide on the inhibitory activity. All the positive 15

values of the PhP confirmed the ability of these peptides to inhibit the α-amylase activity. PhP9 (8.93%) had the highest inhibitory activity followed by PhP7 (6.89%), PhP3 (6.28% 0), PhP6 (6.08%) and PhP1 (4.43%) at 1011cfu/ml. It could be observed that when the concentration of PhP increased, the inhibitory activity of the PhP was also increased. At low concentration (107 cfu/ml), only a trace amount inhibitory activity was detected, whereas at a higher concentration (109 cfu/ml), a more apparent inhibitory activity could be observed. For examples, PhP3 and PhP9 exhibited inhibitory effect of 2.25 and 3.07%, respectively. Other peptides such as PhP1 (0.30%), PhP6 (0.50%) and PhP7 (0.70%) showed a lower inhibitory activity. Overall, it could be observed that the responses were below 10% of the activity. A possible reason behind this finding may be due to the fact that the peptides were still attached to the phage particle during the inhibition assay causing steric hindrance for proper and complete inhibition [13]. These results might not be representing the true value of the inhibitory activity, but they could be used as an indication of the potential in the activity. Therefore, these peptides were synthesized and used to determine the actual inhibitory activity in Section 3.5

3.5

α-Amylase inhibitory activity of synthesized peptides Fig. 5 shows the α-amylase inhibitory activities of the chemically synthesized

peptide (SyP) (i.e. SyP1, SyP3, SyP6, SyP7 and SyP9). These promising values further confirmed the ability of PBBP in inhibiting α-amylase. SyP9 exhibited the highest inhibitory activity per 100 µg (66.72%) followed by SyP1 (48.86%), SyP3 (31.17 %), SyP7 (27.88%) and SyP6 (23.96%). In the present work, IC50 value was also used as an indication to evaluate the α-amylase inhibitory activity. A lower IC50 value indicates a 16

higher α-amylase inhibitory activity of the peptide. Table 2 shows that SyP9 gave the lowest IC50 value (1.97 mg ml-1) followed by SyP1, SyP3, SyP7 and SyP6 with IC50 values of 8.96, 14.63, 18.45 and 20.56 mg ml-1, respectively. Therefore, it was confirmed that SyP9 had the best capability in inhibiting α-amylase activity followed by SyP1, SyP3, SyP7 and SyP6.

3.6

Structure-activity relationship (SAR) study α-Amylase catalyses the hydrolysis of internal α-1,4-glucosidic linkages in starch

polymers with a net retention of anomeric configuration [15]. An overview of the mechanism on how α-amylase works has been discussed in our previous publication [8]. It was also stated that PBBP were suggested to interact or bind to the active domain, which ultimately restricts the structural requirement and affects the degree of enclosure of the substrate. Thus, resulting in a higher α-amylase inhibitory activity [8]. In the current work, a more in-depth investigation of the mechanism was performed using SAR study. In this study, CABS-dock server was applied. The CABS-dock server provides an interface for modelling protein-peptide interactions using a highly efficient protocol by performing simulation search for the binding site allowing for full flexibility of the peptide and small fluctuations of the receptor backbone [16]. Another advantage of the server is the capability to support the peptide sequence up to the maximum length of 30 amino acids. Generated output in terms of interactive charts or known as contact maps were then analysed. The value of the contact cutoff distance (i.e. the distance between the closest heavy atoms of the residues) was fixed at 4.5 Å.

17

The results suggested that the inhibition activity might be due to the residues of Tyr-54, Leu-194, Met-195, Asp-229, Ala-230, His-233 and Asp-326 in α-amylase were strongly bound to the peptides (Fig. 6). Other binding sites, such as Trp-11, Trp-39, Asp51, Asp-98, Glu-187, Phe-188, Tyr-191, Lys-232, Glu-259, Trp-261, His-325 and Leu333 might also contribute to the inhibitory activity depending on the presence of individual peptide used. It was proposed that the identified amino acid residues in the binding site of α-amylase play an essential role in forming the enzyme/substrate complex. But, this was not the case when they were bound to PBBP. The α-amylase/PBBP complex has also altered the position of the carbohydrate residues by drifting them further away from the catalytic residues, resulting in a very low occurrence of carbohydrate breakdown. This result was supported by Sajedi et al. who reported that Asp-231, Asp-328 and Glu-261, which found in the active site located in a cleft at the interface of domains A (consisting of a central (β/α)8-barrel flanking the active site) and domain B (overlaying the active site), act as proton receptor or donor in the catalytic mechanism of α-amylase [17]. The same finding was reported by Yang et al. with a slight difference in terms of the position of the amino acids (i.e. Glu-250 and Asp-218, Asp-311) [18]. These minor differences in the position were due to the different source of αamylase used in the study. Even though residues such as tryptophan and tyrosine have known to be less active in participating in the catalytic reaction due to their bulkiness [15], Trp-11, Trp-39, Tyr-54, Tyr-191 and Trp-261 were found frequently bound by the PBBP and caused the inhibition. It was suggested that binding these residues would reduce the flexibility of the α-amylase, thus affecting the displacement of the protein loop, and causing the enzyme unable to participate in the docking with starch. 18

In terms of the binding sites of the peptides, it was clearly seen that His-484 in P1 was the most active binding site followed by Pro-487, Leu-486, Met-485, Pro-483 and Pro-482, as shown in Fig. 6(a). As for P3, Pro-482 was found to be the most active binding site followed by Phe-489, Leu-483, Trp-485, Gly-486, Gly-488, Pro-484 and Ala-487 (Fig. 6(b)). A similar observation was found in P7 which Pro-482, Leu-485 and His-486 acted as the active binding sites (Fig. 6(d)). On the other hand, Met-485 in P6 dominated in the binding activity followed by Pro-488, His-484, Pro-482, Pro-483, Gly486 and Gly-487, as illustrated in Fig. 6(c). As for P9, shown in Fig. 6(e), Met-487, Met497 and Ala-492 were the most active binding sites. In general, active binding sites of PBBP were found to be histidine, proline and methionine. These findings were supported by the work of Guo et al. who identified α-amylase inhibitor peptides from wheat [19]. It can be concluded that the amino acid composition of the peptide as well as their sequences played an important role in the inhibitory mechanism.

4.

Conclusion Five Pinto bean bioactive peptides (PBBP) were identified to be α-amylase inhibitor

peptides. The SAR study showed that these peptides were able to bind to α-amylase rigidly and resulted in a lesser surface interaction between α-amylase and carbohydrate. Thus, inhibiting the carbohydrate breakdown activity. In conclusion, phage display technique enhanced the bioactive peptide discovery process and the approach was successfully verified.

19

Acknowledgement This project is financially supported by RUI Grant (1001/CAATS/814257).

References [1] S.S. Nair, V. Kavrekar, A. Mishra, In vitro studies on α-amylase

and alpha

glucosidase inhibitory activities of selected plant extracts, Eur. J. Exp. Biol. 3 (1) (2013) 128-132. [2] N. Uddin, M. R. Hasan, M. M. Hossain, A. Sarker, A. H. M. N. Hasan, A. F. M. M. Islam, M. M. H. Chowdhury, M. S. Rana, In vitro α-amylase inhibitory activity and in vivo hypoglycaemic effect of methanol extract of Citrus macroptera Montr. Fruit, Asian Pac. J. Trop. Biomed. 4 (6) (2014) 473-479. [3] C. Ma, C. Li, D. Jiang, X. Gao, J. Han, N. Xu, Q. Wu, G. Nie, W. Chen, F. Lin, Y. Hou, Screening of a specific peptide binding to esophageal squamous carcinoma cells from phage displayed peptide library, Mol. Cell. Probe. 29 (2015) 182-189. [4] P. Zhao, T. Grabinski, C. Gao, R. S. Skinner, T. Giambernadi, Y. Su, E. Hudson, J. Resau, M. Gross, G. F. V. Woude, R. Hay, B. Cao, Identification of a Met-Binding Peptide from a Phage Display Library. Cli. Cancer Res. 13 (20) (2007) 6049-6055. [5] Z. Liu, J. Liu, K. Wang, W. Li, W. L. Shelver, Q. X. Li, J. Li, T. Xu, Selection of phage-displayed peptides for the detection of imidacloprid in water and soil, Anal. Biochem. 485 (2015) 28-33. [6] S. S. Sidhu, Engineering M13 for phage display, Biomol. Eng. 18 (2001) 57-63.

20

[7] N. Cukkemane, F. J. Bikker, K. Nazmi, H. S. Brand, E. C. I. Veerman, Identification and characterization of a salivary-pellicle-binding peptide by phage display, Arch. Oral Biol. 59 (2014) 448-454. [8] Y. Y. Ngoh, C. Y. Gan, Enzyme-assisted extraction and identification of antioxidative and a-amylase inhibitory peptides from Pinto beans (Phaseolusvulgaris cv. Pinto), Food Chem. 190 (2016) 331-337. [9] J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. [10] Q. T. Loh, S. W. Leong, G. J. Tye, Y. S. Choong, T. S. Lim, Improved Fab presentation on phage surface with the use of molecular chaperone coplasmid system, Anal. Biochem. 477 (2015) 56-61. [11] H. L. Siow, C. Y. Gan, Extraction of antioxidative and antihypertensive bioactive peptides from Parkiaspeciosa seeds, Food Chem. 141 (2013) 3435–3442. [12] V. Worthington, Α-amylase. In V. Worthington (Ed.), Worthington Enzyme Manual Freehold, NJ: Worthington Biochemical Corp., 1993, pp. 36–41. [13] C.F. Chin, S.J. Tan, C.Y. Gan, T.S. Lim, Identification of Peptide Based Inhibitors for a-Amylase by Phage Display, Int. J. Peptide Res. Therap. (2015) DOI 10.1007/s10989-015-9456-x [14] M.Z. Abedin, A.A. Karim, C.Y. Gan, F.C. Ghazali, Z. Barzideh, W. Zzaman, I.S.M. Zaidul, Identification of angiotensin I converting enzyme inhibitory and radical scavenging bioactive peptides from sea cucumber (Stichopus vastus) collagen hydrolysates through optimization, Int. Food Res. J. 22 (3) (2015) 1074-1082.

21

[15] N. Tamamura, W. Saburi, A. Mukai, N. Morimoto, T. Takehana, S. Koike, H. Matsui, H. Mori, Enhancement of hydrolytic activity of thermophilic alkalophilic αamylase from Bacillus sp. AAH-31 through optimization of aminoacid residues surrounding the substrate binding site, Biochem. Eng. J. 86 (2014) 8-15. [16] M. Kurcinski, M. Jamroz, M. Blaszczyk, A. Kolinski, S. Kmiecik, CABS-dock web server for the flexible docking of peptides to proteins without prior knowledge of the binding site, Nucleic Acid Res. Vol. 43 (2015) 419-424. [17] R.H. Sajedi, M. Taghdir, H.N. Manesh, K. Khajeh, B. Ranjbar, Nucleotide Sequence, Structural Investigation and Homology Modeling Studies of a Ca2+independent α-amylase with Acidic pH-profile, J. Biochem. Mol. Biol. Vol. 40 No.3 (2007) 315-324. [18] H.Q.Yang, L. Liu, H.D. Shin, R.R. Chen, J.H. Li, G.C. Du, J. Chen, Structure-based engineering of histidine residues in the catalytic domain of α-amylase from Bacillus subtilis for improved protein stability and catalytic efficiency under acidic conditions, J. Biotech. 164 (2013) 59-66. [19] H.F. Guo, R. Michael, S.C. Ming, J.K. Karl, D.M. Thomas, R.R. Gerald, α-Amylase Inhibitors from Wheat: Amino Acid Sequences and Patterns of Inhibition of Insect and Human a-Amylases, Insect Biochem. Mol. Biol. Vol. 26 No. 5 (1996) 419-426.

22

g

4.50

Absorbance (405nm)

4.00 f

3.50 3.00 2.50 2.00 1.50 1.00 0.50

e d

c b

b a

a

a

a

0.00

Phage cloned peptide (PhP)

Fig. 1 ELISA results of phage-cloned peptide (PhP) binding to α-amylase. M13KO7 was used as a negative control. Values, which are not followed by the same letter, are significantly (p < 0.05) different according to Duncan’s test (n=3).

23

Fig. 2 (a) Pull-down assay of SyP9 against α-amylase: Lane 1: protein standard marker; Lane 2: SyP9 only; Lane 3: SiMAG-Amine beads coupled with α-amylase and then incubated with SyP9; Lane 4: SiMAG-Amine beads which was first blocked by skim milk and then incubated with SyP9; Lane 5: skim milk only; Lane 6: α-amylase only; (b) Reverse pulldown assay of SyP1 against α-amylase: Lane 1: protein standard marker; Lane 2: SyP1 only; Lane 3: SiMAG-Amine beads coupled with SyP1 and then incubated with αamylase; Lane 4: SiMAG-Amine beads which was first blocked by skim milk and then incubated with α-amylase; Lane 5: skim milk only; Lane 6: α-amylase only. 24

(a)

(b)

(c)

(d)

Fig. 3 Example of MS/MS spectra showing (a) current spectrum view; (b) ion table; (c) spectrum alignment view; and (d) error map of SyP7

25

107

109

1011

Fig. 4 α-Amylase inhibition activity (% inhibition) using 107, 109 and 1011 cfu/ml of phagecloned peptides (PhP) with M13KO7 as negative control and PhP11 as irrelevant peptide. Values, which are not followed by the same letter, are significantly (p < 0.05) different according to Duncan’s test (n=3).

26

Fig. 5 Chemically synthesized peptides (SyP) and their α-amylase inhibitory activities (% inhibition/100 µg). Values, which are not followed by the same letter, are significantly (p < 0.05) different according to Duncan’s test (n=3).

27

(a)

28

(b)

29

(c)

30

(d)

31

Fig. 6 Contact maps of PBBP and α-amylase: (a) P1, (b) P3, (c) P6, (d) P7 and (e) P9, generated from CABS Dock server

32

Table 1 Codes of PBBP sequences and their DNA sequences Codes PBPI peptide sequences

DNA sequences (5’ – 3’)

P1

PPHMLP

CCACCGCACATGTTGCCG

P2

PPMHLP

CCTCCTATGCACTTACCG

P3

PLPWGAGF

CCATTACCGT GGGGTGCTGGATTT

P4

GDAACCGLPLLP

GGTGATGCTGCCTGCTGTGGTTTGCCTCTG CTGCCT

P5

PLPPHMLP

CCTCTTCCACCACATATGTT GCCA

P6

PPHMGGP

CCACCGCATATGGGTGGACC T

P7

PLPLHMLP

CCGTTACCGCTTCACATGCT GCCA

P8

ACSNHSPLGWRGH

GCTTGTAGTAACCATTCACCACTGGGTTGG CGCGGCCAT

P9

LSSLEMGSLGALFVCM

CTGTCTAGCTTAGAGATGGGTTCTTTGGGT GCGCTGTTTG TATGTATG

P10

PLPPHDLL

CCTTTGCCAC CGCATGATCT GCTG

P11

FNPFPSPHTP

TTTAATCCGT TTCCGTCTCC ACATACTCCA

33

Table 2 Inhibitory activities in IC50 values of the chemically synthesized peptides (i.e. SyP1, SyP3, SyP6, SyP7 and SyP9) against α-amylase SyP IC50 (mg ml-1) SyP1

8.96 ± 0.33b

SyP3

14.63 ± 0.44c

SyP6

20.56 ± 2.42d

SyP7

18.45 ± 0.25d

SyP9

1.97 ± 1.72a

Means within the same column not followed by the same letter are significantly different at p < 0.05 level of significance according to Duncan’s test.

34