Sequence analysis of the pig phosphoglucose isomerase gene promoter region

Sequence analysis of the pig phosphoglucose isomerase gene promoter region

Biochimica et Biophysica Acta, 1087 (1990) 339-340 339 Elsevier BBAEXP ~ 2 ~ BBA Report - Short Sequence-Paper Sequence analysis of the pig phosph...

289KB Sizes 0 Downloads 38 Views

Biochimica et Biophysica Acta, 1087 (1990) 339-340

339

Elsevier BBAEXP ~ 2 ~

BBA Report - Short Sequence-Paper

Sequence analysis of the pig phosphoglucose isomerase gene promoter region V i c t o r C l a e s 1, A n n e N o E l l e T a q u e t 2, R i c h a r d K e t t m a n n 1 a n d A r s ~ n e B u r n y 1,2 Faculty of Agronomy, Gembloux (Belgium) and 2 University of Brussels (ULB), Department of Molecular Biology, Rhode-St-GenOse (Belgium)

(Received 28 August 1990)

Key words: Phosphoglucoseisomerase;Promoter; Nucleotidesequence A cDNA for pig phosphoglucose isomerase (PGI) was used to isolate genomic clones representing the 5' portion of the corresponding gene. A total of 656 bases of the pig PGI gene were obtained that include 5'-flanking information and part of exon 1. A major transcription start was localized at 74 nucleotides from the translation start. The sequence organization of the pig PGI promoter is similar to that of other housekeeping genes. This GC-rich region includes a TATA-like box, two putative Spl recognition sites but no CCAAT box.

Phosphoglucose isomerase (EC 5.3.1.9) is the second enzyme in the glycolytic pathway. This enzyme catalyses the conversion of glucose 6-phosphate to fructose 6-phosphate. Because of its biochemical role and its ubiquitous presence in all cell types and organisms thus far analyzed [1], PGI can be regarded as the product of a typical housekeeping gene. A cDNA clone for pig PGI was isolated in our laboratory from a lambda gt 11 muscle library and sequenced to establish its identity [2]. In this report, we present the sequence organization of the pig PGI 5'-flanking region. A 273 bp E c o R I - S m a I fragment in the 5' portion of the pig PGI cDNA was used to screen a lambda GEM pig genomic library of blood leukocyte DNA. Twelve positively hybridizing clones covering the 5' region of the pig PGI gene were obtained. Six of them were scored positive when probed with a 21 bp oligomer (PGIC1) complementary to codons 1 to 7 of the pig PGI cDNA. Southern blot analysis using this oligonucleotide probe revealed that five of these clones contained a single 4.7 kb B a m H I hybridization band. A restriction map of this BarnHI fragment was established (data not shown) and a 656 bp B a m H I - K p n I fragment was subcloned in the bluescript vector (pPROPGI) for sequence determination by the Sanger dideoxynucleo-

The sequence data in this paper have been submitted to the EMBL/Genbank Data Librariesunder the accession number X53719 Correspondence:A. Burny,Facult6des Sciences Agronomiques,Unit6 de BiologieMolrculaireet de PhysiologieAnimale,Avenue Marrchal Juin 13, 5800 Gembloux,Belgium.

tide chain termination method [3] on double-stranded DNA, using a modified T7 D N A polymerase (Sequenase). This insert contains 531 nucleotides of the 5'-flanking region and 125 nucleotides of exon 1 (Fig. 1). For primer extension, the PGIC1 oligonucleotide was 5' end-labeled with [7-32p]ATP (Amersham) and polynucleotide kinase (Promega) [4]. The labeled oligonucleotide (2.105 cpm) was annealed to 3/~g of poly(A) + RNA from pig muscle for 3 min at 70 °C and then for 4 h at 5 5 ° C in 10 /~1 of 280 mM KC1, 20 mM Tris-HC1 (pH 8.3) and 1 mM EDTA (pH 8.0). The hybridization mixture was diluted in 40 ~tl of extension buffer (12.5 mM MgC12, 12.5 mM Tris-HC1 (pH 8.3), 5 mM DTT and 625 /zM dNTPs) and incubated for 60 min at 4 2 ° C with 25 U of AMV reverse transcriptase (Boehringer). Extension products were analyzed by electrophoresis through a 6% acrylamide-7 M urea gel. As shown in Fig. 2, two extension products, 94 and 95 nucleotides in size, were detected. The + 1 position was assigned to the most intense band and corresponds to a C residue. This indicates that the message for phosphoglucose isomerase contains 74 nucleotides of 5'-untranslated sequence upstream of the ATG which initiates the open reading frame encoding the protein. The pig PGI 5'-flanking region exhibits several noteworthy features. An ATAAA sequence is present at position - 2 7 and corresponds to the TATA box which determines by its position the transcription start site [5]. This degenerated TATA box and the transcription start site are embedded within a highly GC-rich region. Two GC boxes are found in this region at nt - 6 1 and - 5 0 . They perfectly match the decanucleotide consensus

016%4781/90/$03.50 © 1990 Elsevier Science Publishers B.V. (BiomedicalDivision)

340 ( K G G G C G G R R Y where K = G or T, R = A or G a n d Y = C or T) for the transcriptional factor S p l which is an i m p o r t a n t c o m p o n e n t of several viral a n d cellular promoters [6]. Two 8 - 1 0 b p m a t c h i n g G C - b o x sequences are also f o u n d in reverse o r i e n t a t i o n at p o s i t i o n + 12 and + 16. It is n o t k n o w n if putative G C boxes occurring within the 5' n o n - c o d i n g region of the m R N A have a n y function. N o C C A A T element, frequently present at - 7 0 a n d - 9 0 bp in various eukaryotic genes a n d k n o w n to affect the level of transcription, is f o u n d in either direct or opposite o r i e n t a t i o n [7]. N o other potential regulatory elements have b e e n identified. A 12 bp dyad s y m m e t r y T T C A C T A G T G A A a n d a 28 bp long inverted repeat are also revealed at position - 4 2 6 a n d - 6 5 , respectively. This p r o m o t e r organization: high G + C content, presence of a modified T A T A box a n d absence of other regulatory element is consistent with that of other housekeeping genes [8]. This work was supported b y the ' I n s t i t u t p o u r l'encouragement de la Recherche Scientifique d a n s l'industrie et l'agriculture'. R. K e t t m a n n is ' M a i t r e de Recherches' of the F o n d s N a t i o n a l Belge de la Recherche Scientifique. -531

gatccttaacccactgatcaaggccagggatcgaaccccaaacgtcatgg

-481

ttcctagccggattcgtttccgctgcaggacgacgggaactccctcaaat

-431

DS__~_ gccact~6ca~cactagtgaattttccattgaccattctattcaatattgcaac

-381

ctctattcccagctttccttttctcagtagcacttaccagcatctgacat

-331

gccatacgtcttacttgtcacacatgtatctgcaacacctataacactgc

-281

ctggaacatggaaggtgttgcgtgagtgaatgaatgaactaatgaagcag

-231

gccggggcaagggggctcggcctctgttccccagtcacttccaggcagag

-181

gtcggcagagaggcagcgcaagtggccgcctggtgtcaagaaggacgaga

-131

cgtcccgagccactgctgctgaccaagtcttccccgcgccggcgccgaca

-81

IR gaagggcagagggccgg~gccq~q~caaaqcc~qoacaqaqcc~gcgcctg

-31

+I cgccataaagtccgctgggcgcctcccgcctCCGCCTGCAGCGCGCCGCC

+20

CGCCCCGCTTCCTCGTTCGCGTCCGCAGGGGTCCGTGTTTCCAGCCGCTT

+70

T C G C C A.T.G.G.C.T. G. C. A. C. T. C C. C. A. G .A .A .C C C G C A G T T C A A G A A G C T G C A G A C C .A .C ..

1ACGT

/ /

1I:

\

/

/

/

/

/ i/

/ /

G -15 G G C G C C 7 C C C G C C T C+I C G C C Y G C A G C G C G C +15

Fig. 2. Primer extension analysis of the PG! mRNA start site. A 21 base oligomer complementary to the 5' region of the pig PGI cDNA was annealed to poly(A)+ RNA obtained from pig muscle and polymerized with reverse transcriptase (lane 1). Sequencing reactions primed with the same oligonucleotide on a corresponding genomic template (pPROPGI) were co-run to allow exact determination of the transcription start site (lanes A, C, G and T). The sequence in the vicinity of the start site is shown at the right. Two arrows indicate the initiation sites.

References

M +120

A

A

L

T

Q

N

P

Q

F

K

K

L

Q

T

TGGTAC W

Y

Fig. 1.5' Upstream sequence of pig PGI gene. Nucleotide numbering begins at the major transcription start site (+ 1); upstream nucleotides have negative numbers. Exon 1 sequence is in capital letters and the protein-coding region is indicating by the one-letter code for amino acids. The 5' potential regulatory elements (TATA box, GC box) are underlined. The dyad symmetry dement (DS) and the long GC-rich inverted repeat (IR) are indicated by arrow pairs. Dotted underline shows the position of the 21-mer used for primer extension analysis.

1 Gracy, R.W. (1982) in Isozymes: Current Topics in Biological and Medical Research, Vol 6, pp. 169-205, Academic Press, New York. 2 Chaput, M., Claes, V., Portetelle, D., Cludts, I., Cravador, A., Burny, A., Gras, H. and Tartar, A. (1988) Nature 332, 454-455. 3 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 4 Woods, D. (1984) Focus 6, 1-3. 5 Breathnach, R. and Chambon, P. (1981) Annu. Rev. Biochem. 50, 349-383. 6 Kadonaga, J.T., Jones, K.A. and Tjian, R. (1986) Trends Biochem. Sci. 11, 20-23. 7 Esfradiatis, A., Posakony, J.W., Maniatis, T., Lawn, R.M., O'Connell, C., Spiritz, R.A., De Rid, J.K., Forget, B.G., Slighton, L., Blechl, A.E., Smithies, O., Barralle, F.E., Shoulders, C.C. and Proudfoot, N.J. (1980) Cell 21,653-668. 8 Martini, G., Toniolo, D., Vulliamy, T., Luzzato, L., Dono, R., Vighetto, G., Paonessa, G., D'Urso, M. and Persico, M.G. (1986) EMBO J. 5, 1849-1855.