Spinal injection of docosahexaenoic acid attenuates carrageenan-induced inflammatory pain through inhibition of microglia-mediated neuroinflammation in the spinal cord

Spinal injection of docosahexaenoic acid attenuates carrageenan-induced inflammatory pain through inhibition of microglia-mediated neuroinflammation in the spinal cord

Neuroscience 241 (2013) 22–31 SPINAL INJECTION OF DOCOSAHEXAENOIC ACID ATTENUATES CARRAGEENAN-INDUCED INFLAMMATORY PAIN THROUGH INHIBITION OF MICROGL...

1MB Sizes 0 Downloads 4 Views

Neuroscience 241 (2013) 22–31

SPINAL INJECTION OF DOCOSAHEXAENOIC ACID ATTENUATES CARRAGEENAN-INDUCED INFLAMMATORY PAIN THROUGH INHIBITION OF MICROGLIA-MEDIATED NEUROINFLAMMATION IN THE SPINAL CORD Y. LU, a,b L.-X. ZHAO, a D.-L. CAO a AND Y.-J. GAO a*

Key words: inflammatory pain, carrageenan, docosahexaenoic acid, microglia, cytokines, chemokines.

a

Institute of Nautical Medicine, Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong 226001, China

b

Department of Nutrition and Food Hygiene, Public Health School of Nantong University, Nantong 226001, China

INTRODUCTION Pain is one of the most common symptoms encountered in the clinic, and inflammatory pain represents an important type of pain (Woolf and Costigan, 1999; Kuner, 2010; Ji et al., 2011). Neuroinflammation in both peripheral and central nervous system plays an important role in the pathogenesis of chronic pain (White et al., 2005; Moalem and Tracey, 2006; Myers et al., 2006). In peripheral, multiple inflammatory mediators such as prostaglandin, nerve growth factor, and proinflammatory cytokines [e.g., tumor necrosis factor-a (TNF-a) and interleukin-1b (IL-1b)] are produced in inflamed or damaged tissues and sensitize the nerve endings (Abbadie et al., 2009; Stein and Lang, 2009). In the central nervous system, glial cells (e.g. microglia and astrocytes) release powerful neuromodulators such as cytokines and chemokines (e.g. CCL2, CCL3, CXCL10) and are involved in the modulation of the excitability of spinal cord sensory neurons (DeLeo and Yezierski, 2001; Abbadie et al., 2009; Milligan and Watkins, 2009; Gao and Ji, 2010a; Ji et al., 2011). Inhibition of the neuroinflammation that mediated by glial cells has been shown to attenuate inflammatory or neuropathic pain (Raghavendra et al., 2003; Ledeboer et al., 2005; Zhuang et al., 2006). Docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) are two major bioactive components of omega-3 polyunsaturated fatty acids (n-3 PUFAs), which were found in fatty fish and highly concentrated in the brain and retina in humans (Fliesler and Anderson, 1983; Lands, 1992). Compared to only 0.1% of EPA in total brain fatty acid, DHA comprises 10–20% and is the main n-3 PUFAs in the brain (McNamara and Carlson, 2006). Human studies have shown that an increased dietary intake of n-3 PUFAs is associated with reduced pain in rheumatoid arthritis (Ruggiero et al., 2009; Miles and Calder, 2012), inflammatory bowel disease (Bassaganya-Riera and Hontecillas, 2010), and dysmenorrheal (Harel et al., 1996). Rats treated with n-3 PUFAs have shown to markedly increase threshold for thermal pain (Yehuda and Carasso, 1993). However, the antinociceptive effect and the underlying mechanism of DHA in inflammatory pain still remain unclear.

Abstract—Neuroinflammation in the spinal cord plays a critical role in the processing of inflammatory pain. Docosahexaenoic acid (DHA), a predominant omega-3 polyunsaturated fatty acid in the central nervous system, is known to modulate inflammatory responses in various neurodegenerative disorders. In this study, we investigated whether DHA could reduce inflammatory pain and inhibit neuroinflammation in the spinal cord following carrageenan injection in mice. Intrathecal (i.t.) injection of DHA at 15 min before carrageenan injection blocked carrageenan-induced pain hypersensitivity for more than 6 h. In addition, i.t. injection of DHA at 3 h after carrageenan transiently reversed carrageenan-induced heat hyperalgesia and mechanical allodynia. Furthermore, DHA treatment reduced carrageenan-induced activation of microglia, phosphorylation of p38 mitogen-activated protein kinase (MAPK), and production of proinflammatory cytokines (tumor necrosisfactor-a – TNF-a and interleukin-1b – IL-1b) in the L4–5 spinal cord. In cultured microglial cells, DHA dose-dependently reduced lipopolysaccharide (LPS)-induced phosphorylation of p38, production of proinflammatory cytokines (TNF-a, IL-1b, IL-6) and chemokines (CCL2, CCL3 and CXCL10). p38 inhibitor SB203580 inhibited LPS-induced expression of proinflammatory cytokines and chemokines in a dosedependent manner. Taken together, these results provide evidence that DHA has antinociceptive effect in inflammatory pain, which may be attributed to, at least partially, suppressing a microglia-mediated inflammatory response through inhibition of p38 MAPK activation. Ó 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

*Corresponding author. Address: Institute of Nautical Medicine, Nantong University, 19 Qixiu Road, Nantong 226001 China. Tel: +86-513-85051799; fax: +86-513-85051796. E-mail address: [email protected] (Y.-J. Gao). Abbreviations: COX-2, cyclooxygenase-2; DHA, docosahexaenoic acid; DMEM, Dulbecco’s Modified Eagle’s Medium; EPA, eicosapentaenoic acid; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; IL-1b, interleukin-1b; iNOS, inducible NO synthase; i.t., intrathecal; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; n-3 PUFAs, omega-3 polyunsaturated fatty acids; PWL, paw withdrawal latency; PWT, paw withdrawal threshold; TNF-a, tumor necrosisfactor-a.

0306-4522/12 $36.00 Ó 2013 IBRO. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.neuroscience.2013.03.003 22

Y. Lu et al. / Neuroscience 241 (2013) 22–31

DHA has long been considered neuroprotective and anti-inflammatory (De Smedt-Peyrusse et al., 2008; Ebert et al., 2009). DHA-rich n-3 fatty acid supplementation decreases the release of IL-6 and IL-1b from peripheral blood mononuclear cells after stimulation with lipopolysaccharide (LPS) (Vedin et al., 2008), and changes the inflammation regulation-related gene expression in the blood (Vedin et al., 2012). DHA supplementation also significantly prevented hypoxia/ ischemia-induced upregulation of TNF-a, IL-1b, IL-6, cyclooxygenase-2 (COX-2) and inducible NO synthase (iNOS) in the cortex (Zhang et al., 2010). In addition, DHA suppresses interferon-c-induced inflammatory cytokine expression in BV2 microglial cultures (Lu et al., 2010). Whether DHA in the spinal cord level could regulate the production of pain-related inflammatory mediators is largely unknown. In the present study, we compared the prevention and reversal effect of the spinal injection of DHA on carrageenan-induced inflammatory pain, and checked the effect of DHA on carrageenan-induced activation of microglia and astrocytes in the spinal cord. As p38 mitogen-activated protein kinase (MAPK) has been implicated to play an important role in mediating the expression of inflammatory mediators (Ji and Suter, 2007), we further examined whether the antiinflammatory effect of DHA is mediated by inhibition of p38 MAPK in microglial cells in both spinal cord and cell cultures.

EXPERIMENTAL PROCEDURES Animals Male ICR mice (8-week-old), obtained from the Experimental Animal Center of Nantong University, were used in this study. The animals were maintained on a 12:12-light–dark cycle at a room temperature of 22 ± 1 °C with free access to food and water. Blinded experiments were performed according to the guidelines of the International Association for the Study of Pain. The experimental procedures were approved by the Animal Care and Use Committee of Jiangsu Province. Inflammatory pain was induced by intraplantar injection of 20-ll carrageenan (1%, Sigma, St. louis, MO, USA) in sterile 0.9% saline. The control group was injected with the same volume of saline.

Drugs and administration DHA salt (Sigma, St. louis, MO, USA) was dissolved in saline. For intrathecal injection, a spinal cord puncture was made with a 30-gauge needle between the L4 and L5 level to deliver the reagents (10 ll) to the cerebral spinal fluid. Immediately after the needle entry into subarachnoid space, a brisk tail flick could be observed.

Behavioral analysis Animals were habituated to the testing environment daily for at least 2 days before baseline testing. The room temperature and humidity remained stable for all experiments. For testing heat sensitivity, animals were put in plastic boxes placed on a glass plate, and the plantar surface was exposed to a beam of radiant heat through a transparent glass surface (Plantar Test Apparatus 390G, IITC Life Science, Woodland Hills, CA, USA).

23

The glass temperature was set at 30 °C during all experiments. The baseline latencies were adjusted to 10–14 s with a maximum of 20 s as cutoff to prevent potential injury. The latencies were averaged over three trials, separated by a 5-min interval. For testing mechanical sensitivity, animals were put in boxes on an elevated metal mesh floor and allowed 30 min for habituation before examination. The plantar surface of the hindpaw was stimulated with a series of von Frey hairs with logarithmically incrementing stiffness (0.02–2.56 g, Stoelting, Kiel, WI, USA), presented perpendicular to the plantar surface (2–3 s for each hair). The 50% paw withdrawal threshold (PWT) was determined using Dixon’s up-down method (Dixon, 1980).

Cell culture The microglial BV2 cells were seeded in a 6-well plate at a density of 3  105 cells/cm2 and cultured in a medium containing 10% FBS (fetal bovine serum) in high glucose DMEM (Dulbecco’s Modified Eagle’s Medium). For primary microglial culture, the cerebral hemispheres (neonatal mice, P2) were isolated and transferred to ice-cold Hank’s buffer and the meninges were carefully removed. Tissues were then minced into 1-mm pieces, triturated, filtered through a 100-lm nylon screen, and collected by centrifugation at 3000g for 5 min. The cell pellets were dispersed with a pipette and resuspended in a medium containing 10% FBS in high glucose DMEM. After trituration, the cells were filtered through a 10-lm screen and then plated into 75-cm2 flasks. The medium was replaced twice a week. After 12–14 days, the flasks were shaken on a rotary shaker at 220 rpm for 4 h. The resulting cell suspension, rich in microglia, was placed in a 6-well plate at a density of 5  105 cells/cm2. Prior to stimulation with LPS, OPTI-MEM was replaced. The cells were incubated with LPS for either 1 or 6 h. The treatment of the DHA (3, 10, 30 lM) or SB203580 (5, 50 lM) was started 30 min prior to LPS treatment. After the treatments, the cells were collected for Real-time PCR or Western blot.

Tissue collection Animals were rapidly killed after deep anesthesia with isoflurane, and the L4–5 spinal segments were quickly removed and frozen at 80 °C for later Real-time PCR or Western blot analysis.

Real-time PCR The total RNA of the spinal cord or cultured cells was extracted using Trizol reagent (Invitrogen). RNA quantity and purity were determined using Eppendorf Biophotometer. One microgram of total RNA was reverse transcribed using a mixture of random primers according to the manufacturer’s protocol (TaKaRa, Japan). Real-time quantitative PCR analysis was performed in the Real-time Detection System (Rotor-Gene 6000) by SYBR green I dye detection. The mRNA expressions of IBA-1 (ionized calcium binding adaptor molecule 1), GFAP (glial fibrillary acidic protein), TNF-a, IL-1b, IL-6, CCL2, CCL3, CXCL10 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were checked. The detailed primer sequences for each gene are listed in Table 1. The PCR reaction process for cells was first incubated at 95 °C for 30 s, followed by 40 cycles of thermal cycling at 95 °C for 5 s and 60 °C for 45 s. Data were collected after each cycle and displayed graphically (Rotor-Gene 6000 Series Software 1.7). Melt curves were performed on completion of the cycles to ensure that nonspecific products were absent. Quantification was performed by normalizing Ct (cycle threshold) values with GAPDH Ct and analyzed with the 2DDCt method.

24

Y. Lu et al. / Neuroscience 241 (2013) 22–31

Table 1. Summary of the real-time polymerase chain reaction (PCR) primers sequences Gene

Forward primer sequences (50 ?30 )

Reverse primer sequences (50 ?30 )

IBA-1 GFAP TNF-a IL-1b IL-6 CCL2 CCL3 CXCL10 GAPDH

ATGAGCCAAAGCAGGGATT CCAAGATGAAACCAACCTGA GTTCTATGGCCCAGACCCTCAC TCCAGGATGAGGACATGAGCAC CCACTTCACAAGTCGGAGGCTTA GCATCCACGTGTTGGCTCA CATGACACTCTGCAACCAAGTCTT TGAATCCGGAATCTAAGACCATCAA AAATGGTGAAGGTCGGTGTGAAC

CTTCAAGTTTGGACGGCAG TCCAGCGATTCAACCTTTC GGCACCACTAGTTGGTTGTCTTTG GAACGTCACCCAGCAGGTTA CCAGTTTGGTAGCATCCATCATTTC CTCCAGCCTACTCATTGGGATCA GAGCAAAGGCTGCTGGTTTCA AGGACTAGCCATCCACTGGGTAAAG CAACAATCTCC CTTTGCCACTG

Immunohistochemistry Animals were terminally anesthetized with isoflurane and perfused through the ascending aorta with saline followed by 4% paraformaldehyde. After the perfusion, the spinal cord segments (L4–5) were removed and postfixed in the same fixative overnight, then replaced with 15% sucrose overnight. Spinal sections (transverse, free-floating, 30 lm) were cut in a cryostat and blocked with 2% goat serum in 0.3% Triton for 1 h at RT and incubated over night at 4 °C with p-p38 or IBA-1 primary antibodies (anti-p-p38, 1:300, mouse, Cell Signaling, Beverly, MA, USA; anti-IBA-1, 1:3000, rabbit, Wako, Tokyo, Japan). The sections were then incubated for 1 h at RT with Cy3- or FITC-conjugated secondary antibodies (1:1000, Jackson ImmunoResearch, West Grove, PA, USA). The stained sections were examined with a Leica fluorescence microscope, and images were captured with a CCD Spot camera.

Western blot The spinal cord or cultured cells were homogenized in a SDS sample buffer containing a mixture of proteinase and phosphatase inhibitors (Sigma, St. Louis, MO, USA). Protein concentrations were determined by BCA Protein Assay (Pierce, Rockford, IL, USA). Protein samples (30 lg) were separated on SDS–PAGE gel and transferred to nitrocellulose blots. The blots were blocked with 5% milk and incubated overnight at 4 °C with antibody against p-p38 (rabbit, 1:500; Cell Signaling, Beverly, MA, USA), and b-actin (mouse, 1:20,000; Sigma, St. Louis, MO, USA). These blots were further incubated with HRP-conjugated secondary antibody, developed in enhanced chemiluminescence (ECL) solution, and exposed onto Hyperfilm (Amersham Biosciences) for 1–10 min. Specific bands were evaluated by apparent molecular size. The intensity of the selected bands was captured and analyzed using Image J software (NIH).

Quantification and statistics For behavioral studies, one-way ANOVA followed by Newman– Keuls post hoc test was used for comparison of temporal variations within the same group and student t-test was used for comparisons between groups. For the quantification of Western blot, the density of specific bands for p-p38, b-actin was measured with imaging analysis software (Image J, NIH). The size of rectangle was fixed for each band and the background near that band was subtracted. p-p38 levels was normalized to b-actin. The quantification of Real time-PCR was normalized to GAPDH. The Western blot and Real-time PCR data were analyzed with student t-test. All the data were presented as mean ± SEM, and P < 0.05 was considered statistically significant in all cases.

RESULTS Intrathecal injection of DHA inhibits carrageenaninduced heat hyperalgesia and mechanical allodynia We tested the paw withdrawal latency (PWL) to radiant heat stimulation and the PWT to von Fey filaments stimulation both before and 1, 3, 6, 24, and 48 h after unilateral injection of carrageenan or saline. As shown in Fig. 1A, carrageenan injection induced a significant decrease of PWL (P < 0.001). The PWL dropped from 13.0 ± 0.3 s to 8.4 ± 0.3 s at 1 h (P < 0.001 vs. baseline), 7.1 ± 0.2 s at 3 h (P < 0.001 vs. baseline), 8.2 ± 0.6 s at 24 h (P < 0.001 vs. baseline), and recovered at 48 h. Saline injection did not change the PWLs at all time points (P > 0.05). In addition, carrageenan also induced mechanical allodynia. The PWT dropped from 1.91 ± 0.2 g before carrageenan (baseline) to 0.42 ± 0.09 g at 1 h after carrageenan injection. The mechanical allodynia remained at the peak level for 6 h, and fully recovered at 48 h. The animals in saline group did not show significant changes of PWT (Fig. 1B). These results indicate that intraplantar carrageenan induces significant heat hyperalgesia and mechanical allodynia. To examine whether pretreatment of DHA could prevent the development of carrageenan-evoked pain hypersensitivity, DHA at the doses of 1, 3, and 10 lg were administered intrathecally 15 min before the injection of carrageenan. As shown in Fig. 1C, DHA at the dose of 10 lg blocked carrageenan-induced heat hyperalgesia. The effect appeared at 2 h after carrageenan injection (10.74 ± 0.47 s for DHA and 7.67 ± 0.23 s for vehicle, P < 0.001) and maintained for more than 24 h (11.28 ± 0.40 s for DHA and 8.63 ± 0.41 s for vehicle, P < 0.001). However, intrathecal injection 1 or 3-lg DHA had no significant effect on PWL (Fig. 1C). We also tested mechanical allodynia for animals injected with vehicle, 3-lg DHA, and 10-lg DHA. The results showed that pretreatment with 10-lg DHA attenuated carrageenan-induced mechanical allodynia from 0.5 h to 6 h. DHA at the dose of 3 lg only increased PWT at 3 h after carrageenan injection (Fig. 1D). To test whether DHA could reverse the established pain hypersensitivity, we intrathecally administered DHA at 3 h after carrageenan injection when heat hyperalgesia and mechanical allodynia were fully

Y. Lu et al. / Neuroscience 241 (2013) 22–31

25

Fig. 1. Intrathecal DHA reduces carrageenan-induced heat hyperalgesia and mechanical allodynia. (A, B) Intraplantar injection of carrageenan induces significant heat hyperalgesia and mechanical allodynia, which started from 1 h and maintained for more than 24 h. ⁄⁄⁄P < 0.001, vs. BL (baseline), n = 5. (C) i.t. injection of 10-lg DHA 15 min before carrageenan injection increases the PWL from 2 h and maintained for more than 24 h, whereas 1 or 3-lg DHA had no significant effect ⁄P < 0.05, ⁄⁄P < 0.01 and ⁄⁄⁄P < 0.001 vs. vehicle, n = 5. (D) i.t. injection of 10-lg DHA 15 min before carrageenan injection increases the PWT from 1 h and maintained for more than 6 h; 3-lg DHA increases the PWT at 3 h. ⁄P < 0.05, ⁄⁄ P < 0.01 and ⁄⁄⁄P < 0.001 vs. vehicle, n = 4. (E) i.t. injection of DHA (3 or 10 lg) given at 3 h post-carrageenan injection attenuates ongoing hyperalgesia, which starts from 0.5 h and lasts for more than 1 h, but 1-lg DHA had no effect. ⁄P < 0.05, ⁄⁄P < 0.01, and ⁄⁄⁄P < 0.001 vs. vehicle, n = 5. (F) i.t. injection of 10-lg DHA given at 3 h post-carrageenan injection attenuates mechanical allodynia at 0.5 h after DHA injecyion. 3-lg DHA had no effect on the PWT at all time points. ⁄⁄⁄P < 0.001 vs. vehicle, n = 4.

developed. As shown in Fig. 1E, intrathecal 10-lg DHA attenuated ongoing hyperalgesia (10.97 ± 0.39 s for DHA and 7.74 ± 0.23 s for vehicle, P < 0.01) and lasted for more than 1 h (9.73 ± 0.78 s for DHA and 7.47 ± 0.34 s for vehicle, P < 0.05). DHA at 3 lg also showed mild but significant analgesic effect, whereas

DHA at 1 lg had no effect (Fig. 1E). DHA at the dose of 10 lg, but not 3 lg partially reversed mechanical allodynia at 30 min after DHA injection (1.01 ± 0.06 g for DHA and 0.30 ± 0.05 g for vehicle, P < 0.001, Fig. 1F). These data suggest the analgesic effect of DHA by pretreatment persists longer than that by posttreatment.

26

Y. Lu et al. / Neuroscience 241 (2013) 22–31

Intrathecal DHA suppresses carrageenan-induced activation of microglia To investigate whether the effect of DHA on carrageenaninduced inflammatory pain is mediated through inhibition of glial activation, we checked the mRNA expression of microglial marker, IBA-1 and astrocytic marker, GFAP in the spinal cord after carrageenan injection by Real-time PCR. Carrageenan induced rapid IBA-1 mRNA increase, which began from 1 h, peaked at 3 h and maintained for more than 24 h. However, GFAP mRNA was only increased at 6 and 24 h after carrageenan injection (Fig. 2A). We then tested the effect of DHA on IBA-1 and GFAP mRNA expression. The mice were intrathecally injected 10-lg DHA 15 min prior to carrageenan injection. The mRNA expression of IBA-1 and GFAP in the spinal cord was checked at 3 h after carrageenan injection. As shown in Fig. 2B, intrathecal 10-lg DHA decreased carrageenan-induced upregulation of IBA-1 mRNA. But GFAP mRNA was not affected. These results indicate that microglial activation precedes astrocytic activation following carrageenan injection and pretreatment DHA reduces the activation of microglia. Intrathecal DHA suppresses carrageenan-induced activation of p38 MAPK in the spinal cord Studies have shown that spinal p38 MAPK is an important intracellular kinase in microglia and plays a crucial role in the pathogenesis of chronic pain (Ji and Suter, 2007). We then examined whether DHA could inhibit carrageenaninduced p38 activation in the spinal cord. The immunohistochemistry showed a marked increase in the number of p-p38 immunoreactivity (p-p38-IR) cells in the dorsal horn of carrageenan mice compared with naı¨ ve mice (Fig. 3A, B). IBA-1 immunostaining was also increased at 3 h after carrageenan injection (Fig. 3C, D). Double immunofluorescence indicated that p-p38 was co-localized with IBA-1 (Fig. 3E–G). We then checked p-p38 expression by Western blot. As shown in Fig. 3H, I, carrageenan increased p-p38 expression in the spinal cord at 3 h after injection (P < 0.05). Pretreatment with DHA blocked

carrageenan-induced upregulation (vehicle vs. DHA, P < 0.05).

of

p-p38

protein

Intrathecal DHA reduces carrageenan-induced upregulation of proinflammatory cytokines in the spinal cord It has been reported that the activated astrocytes and microglia can release a number of signaling molecules including the classic immune signals: cytokines (e.g. TNF-a, IL-1b and IL-6) and chemokines (e.g. CCL2, CCL3, and CXCL10), which play important roles in inflammatory pain (Ji and Suter, 2007; Gao and Ji, 2010a). Therefore, the mRNA expression of these proinflammatory cytokines and chemokines in the spinal cord was further examined by Real-time PCR. As shown in Fig. 4, high levels of TNF-a, IL-1b, IL-6 and CCL2 mRNA were observed at 3 h after carrageenan injection. Intrathecally injection of DHA (10 lg) attenuated upregulation of TNF-a and IL-1b induced by carrageenan, whereas the mRNA expression of other cytokines or chemokines did not change (Fig. 4).

DHA inhibits LPS-induced expression of proinflammatory cytokines and chemokines through p38 MAPK in cultured microglial cells To further check whether the inhibition effect of DHA on inflammatory mediators’ production is through p38 MAPK pathway in microglia, we cultured BV2 cells. BV2 is an immortalized murine microglial cell line which replicate readily and is easy to maintain in culture (Blasi et al., 1990). Based on others’ work (Lu et al., 2010; Zhang et al., 2010), the DHA doses of 3, 10, and 30 lM were chosen. Cells were pretreated with various concentrations of DHA for 30 min and then stimulated with LPS (1 lg/ml) for another 6 h. The Real-time PCR results showed that exposure to LPS induced a significant upregulation of TNF-a, IL-1b, IL-6, CCL2, CCL3 and CXCL10 compared with control. DHA at the dose of 30 lM effectively decreased LPS-induced production of these cytokines and chemokines,

Fig. 2. Intrathecal DHA suppresses carrageenan-induced activation of microglia. (A) Real-time PCR analysis shows that intraplantar carrageenan induces significant mRNA upregulation of IBA-1 (microglial marker) and GFAP (astrocytic marker) in the spinal cord. IBA-1 mRNA are increased from 1 to 24 h. GFAP mRNA are increased at 6 and 24 h. (B) Intrathecal DHA 15 min before carrageenan injection decreases carrageenan-induced mRNA upregulation of IBA-1 but not GFAP at 3 h after carrageenan. ⁄P < 0.05 and ⁄⁄P < 0.01 vs. naive; #P < 0.05 vs. vehicle, n = 5.

Y. Lu et al. / Neuroscience 241 (2013) 22–31

27

Fig. 3. Intrathecal DHA suppresses carrageenan-induced activation of p38 MAPK in the spinal cord. (A, B) Immunohistochemistry shows carrageenan increases expression of p-p38 (A, B) and IBA-1 (C, D) in the ipsilateral dorsal horn of spinal cord 3 days after inflammation. (E–G) Double staining shows a colocalization of p-p38 (E) and IBA-1 (F). (H) Western blot analysis shows intrathecal DHA suppresses spinal p-p38 levels induced by carrageenan. (I) shows the density of p-p38 band after being normalized to b-actin. ⁄P < 0.05 vs. naive, #P < 0.05 vs. vehicle, n = 5.

Fig. 4. Intrathecal injection of DHA reduces carrageenan-induced upregulation of proinflammatory cytokines in the spinal cord. Real-time PCR analysis shows carrageenan injection increases the mRNA expression of TNF-a, IL-1b, IL-6 and CCL2 at 3 h. Intrathecally administered DHA 15 min before carrageenan decreases upregulation of TNF-a and IL-1b mRNA expression, whereas has no effect on mRNA expression of IL-6, CCL2, CCL3, or CXCL10. ⁄P < 0.05, ⁄⁄P < 0.01 and ⁄⁄⁄P < 0.001 vs. naı¨ ve. #P < 0.05 and ##P < 0.01 vs. vehicle, n = 5.

compared with LPS treatment. DHA at the concentration of 3 and 10 lM had no significant effect (Fig. 5A). As Horvath et al. (2008) reported that BV2 cells partially model primary microglia, we then primarily cultured microglia and compared the effect of DHA. As shown in Fig. 5B, LPS induced similar mRNA increase of TNF-a, CCL2, CCL3, and CXCL10. The IL-1b expression in BV2 is higher than in primary cultures, whereas IL-6 expression in BV2 is lower than in primary cultures. However, pretreatment with 30 lM DHA significantly inhibited LPS-induced enhancement of TNF-a, IL-1b, IL-6, CCL2, CCL3 and CXCL10, and the inhibitory magnitude is similar to that in BV2, suggesting the similar role of DHA on the production of these inflammatory mediators in BV2 and in primary microglia (Fig. 5B). We then checked activation of p38 by Western blot in BV2. Cells were pretreated with 30 lM DHA for 30 min and then stimulated with LPS (1 lg/ml) for another 1 h. The Western blot results showed that LPS induced a

rapid activation (phosphorylation) of p38. Pretreatment of cells with 30 lM DHA decreased p38 activation (Fig. 6A, B). These results suggest that DHA suppresses p38 activation and inflammatory mediators’ production in cultured microglia. To assess whether p38 is involved in LPS-induced expression of proinflammatory mediators, the effect of p38 inhibitor SB203580 was tested. According to our previous experiment (Gao et al., 2009), the doses of 5 and 50 lM were chosen. Cells were pretreated with SB203580 for 30 min and then stimulated with LPS (1 lg/ml) for another 6 h. The Real-time PCR results showed pretreatment of 5 lM SB203580 had no effect on the expression of these mediators. But SB203580 at a dose of 50 lM effectively inhibited mRNA expression of TNF-a, IL-1b, IL-6, CCL2, CCL3, and CXCL10. These results suggest that p38 plays an important role in mediating the effects of LPS on production of inflammatory mediators (Fig. 6C).

28

Y. Lu et al. / Neuroscience 241 (2013) 22–31

Fig. 5. DHA dose-dependently reduces LPS-induced expression of proinflammatory cytokines and chemokines in BV2 microglial cells (A) and primary cultured microglia (B). DHA at the dose of 30 lM suppressed LPS-induced mRNA upregulation of TNF-a, IL-1b, IL-6, CCL2, CCL3 and CXCL10. Cells were pretreated with DHA (3, 10, and 30 lM) for 30 min and then exposed to LPS (1 lg/ml) for 6 h. ⁄P < 0.05, ⁄⁄P < 0.01, and ⁄⁄⁄ P < 0.001, vs. control. #P < 0.05, ##P < 0.01, and ###P < 0.001, vs. LPS treatment (positive control), n = 3.

Fig. 6. DHA inhibits LPS-induced p38 activation in BV2 microglial cells. (A) Western blot shows protein levels of p38 phosphorylation after stimulation with LPS or pretreated with DHA. Cells were pretreated with DHA (30 lM) for 30 min and then exposed to LPS (1 lg/ml) for 1 h. (B) The panel shows the density of p-p38 band after being normalized to b-actin. ⁄P < 0.05, vs. control. #P < 0.05, vs. LPS treatment (positive control), n = 3. (C) p38 inhibitor SB203580 inhibits LPS-induced production of proinflammatory cytokines and chemokines in BV2 microglial cells in a dosedependent manner. ⁄⁄P < 0.01 and ⁄⁄⁄P < 0.001, vs. control. #P < 0.05 and ##P < 0.01, vs. LPS treatment (positive control), n = 3.

Y. Lu et al. / Neuroscience 241 (2013) 22–31

DISCUSSION In this study, we investigated the antinociceptive effect of DHA on carrageenan-induced inflammatory pain and explored possible mechanisms. We demonstrated that DHA exhibited a significant antinociceptive effect in a dose-dependent manner. In particular, the effect of pretreatment is more persistent than that of posttreatment. We further illustrated that pretreatment with DHA blocked carrageenan-induced microglial activation, p38 MAPK phosphorylation and TNF-a and IL-1b mRNA expression in the spinal cord. DHA also inhibited LPS-induced inflammatory mediators’ production through activation of p38 in cultured microglia. DHA prevents carrageenan-induced inflammatory pain A meta-analysis demonstrates that dietary omega-3 fatty acids alleviate inflammatory pain in patients (Goldberg and Katz, 2007). Rats treated with a high n-3/n-6 PUFA ratio diet exhibit a markedly increased threshold for thermal pain and neuropathic pain (Yehuda and Carasso, 1993; Perez et al., 2005). In addition, recent study showed that oral administration of DHA dosedependently reduced pain-related behaviors induced by formalin (Nakamoto et al., 2010). Our study for the first time examined the prevention and reversal effect of spinal DHA on carrageenan-induced inflammatory pain. Intrathecal injection DHA (10 lg) 15 min before carrageenan effectively prevented the development of heat hyperalgesia and mechanical allodynia, and the effect persists for 24 h for heat hyperalgesia and 6 h for mechanical allodynia. However, the reversal effect of DHA is only 1 h for heat hyperalgesia and 30 min for mechanical allodynia. Xu et al. (2010) showed that intrathecal injection of DHA attenuated complete Freund’s adjuvant (CFA)-induced heat hyperalgesia for 30 min. These results suggest that dietary supplement DHA may play an important role in the prevention of inflammatory pain, whereas the treatment effect of DHA is relatively weak. In addition, the effect of DHA on heat hyperalgesia persists longer than on mechanical allodynia. DHA inhibits microglia activation and P38 activation In recent years, non-neuronal cells such as immune cells and glial cells (microglia and astrocytes) have been implicated to play a critical role in the pathogenesis of chronic pain (Milligan et al., 2003; Tsuda et al., 2004; Marchand et al., 2005; Chiang et al., 2007; RomeroSandoval et al., 2008). Although both microglia and astrocytes were activated in the spinal cord following peripheral nerve injury or tissue injury, microglial activation precedes astrocytic reaction in most cases (Ji and Suter, 2007; Gao and Ji, 2010b). Behavioral studies have shown that inhibition of microglial activation by minocycline prevents/delays neuropathic pain development (Raghavendra et al., 2003; Ledeboer et al., 2005), whereas inhibition of astrocytes’ function reverses nerve-injury- or nerve inflammation-induced

29

mechanical allodynia (Milligan et al., 2003; Zhuang et al., 2006), suggesting the respective role of microglia and astrocytes in the development and maintenance of neuropathic pain. In this study, carrageenan injection induced early microglial activation and late astrocytic activation. Pretreatment with DHA in the spinal cord blocked carrageenan-induced pain and decreased IBA-1 mRNA upregulation. It was reported that intrathecal administration of microglial inhibitor minocycline attenuates carrageenan-induced hyperalgesia (Wirkner et al., 2007). These data support the pivotal role of microglia in the initiation of carrageenan-induced inflammatory pain. The MAPKs -JNK (c-Jun N-terminal kinase), ERK (extracellular signal-regulated kinase), and p38 are important molecules in chronic pain sensitization and are differentially activated in spinal cord glial cells (Ji et al., 2009). In particular, p38 MAPK has been shown to be activated in spinal microglia after nerve injury or tissue injury (Jin et al., 2003; Tsuda et al., 2004). Behavioral studies showed that i.t. injection of p38 inhibitor SB203580, FR167653 or CNI-1493 prevents the development of neuropathic pain (Jin et al., 2003; Tsuda et al., 2004; Hains and Waxman, 2006; Wen et al., 2007). Our study showed that carrageenan induced p38 activation in the spinal cord microglia at 3 h after injection, which was reduced by pretreatment with DHA. Our in vitro data also showed DHA (30 lM) diminished LPS-induced p38 activation in BV2 microglia. Other studies using different cells showed that DHA reduced the basal expression of p-p38 in CD4 (+) T-cells (Attakpa et al., 2009) and lung cancer cells (Serini et al., 2008). DHA also suppresses the activity of p38 MAPK in LPS-stimulated dendritic cells (Wang et al., 2007) and TNF-a-stimulated endothelial cells (Xue et al., 2006). These data indicate that the analgesic effect of DHA may be mediated by inhibition of p38 activation in microglia.

DHA reduces inflammatory mediators’ production It has been demonstrated that activated microglia and astrocytes release neuromodulators, such as growth factors, proinflammatory cytokines, and chemokines, which contribute to pain facilitation (Watkins et al., 2001; Gao and Ji, 2010a; Gwak et al., 2012; Yang et al., 2012). Our results showed that carrageenan induced pain hypersensitivity that associated with increased mRNA expression of TNF-a, IL-1b, IL-6 and CCL2 in the spinal cord at 3 h after injection. However, CCL3 and CXCL10 mRNA expression was not changed, suggesting they, in the spinal cord level, may not be related with carrageenan-induced inflammatory pain at this time point. Electrophysiological studies have shown that TNF-a, IL-1b, IL-6, and CCL2 could directly regulate synaptic transmission in dorsal horn neurons (Kawasaki et al., 2008; Gao et al., 2009). Milligan et al. (2003) showed that inhibition of TNF-a and IL-1b prevent or reverse inflammatory neuropathy in rats. Here DHA intrathecal administration decreased TNF-a and IL-1b expression, suggesting the antinociceptive

30

Y. Lu et al. / Neuroscience 241 (2013) 22–31

effect of DHA may be through inhibition of the proinflammatory cytokines TNF-a and IL-1b. Although intrathecal DHA only reduced the expression of TNF-a and IL-1b mRNA in the spinal cord, our in vitro data showed that DHA reduced LPS-induced mRNA expression of more other mediators, including IL-6, CCL2, CCL3, and CXCL10. The discrepancy may be due to the low expression of these chemokines in the spinal cord and the relative low dose of DHA given by intrathecal. It was reported that DHA supplementation significantly prevented hypoxia/ischemia-induced upregulation of TNF-a, IL-1b, IL-6, COX-2 and iNOS in the ipsilateral cortex (Zhang et al., 2010). DHA also reduced expressions of TNF-a, IL-6, iNOS induced by IFN-c in BV2 microglial cells (Lu et al., 2010). Given that DHA blocked LPS-induced p38 activation and p38 inhibitor decreased LPS-induced expression of inflammatory mediators, the inhibition effect of DHA on inflammatory mediators’ production is through the p38 MAPK pathway in microglia.

CONCLUSIONS Inflammatory pain, such as arthritis pain, is a growing health problem. The commonly used opioids and COX inhibitors for treating inflammatory pain are limited by side effects. Our results showed that intrathecally given DHA mainly targeting at the spinal cord level could effectively block carrageenan-induced pain hypersensitivity, suggesting dietary supplementation of DHA or n-3 PUFA may have preventive effect on inflammatory pain. Furthermore, our in vivo and in vitro data indicate that the analgesic effect of DHA in the spinal cord may be through p38 MAPK-mediated microglia activation and subsequent inflammatory mediators’ production. Collectively, our results provide a novel implication of antinociceptive mechanism of DHA. Acknowledgements—This study was supported by the National Natural Science Foundation of China (NSFC 31171062), the Program for New Century Excellent Talents (NCET-09-0164), the Natural Science Foundation of Jiangsu Province (BK2010273), the Science and Technology Planning Project of Nantong (BK2011049) and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions. The authors declare no conflicts of interest.

REFERENCES Abbadie C, Bhangoo S, De Koninck Y, Malcangio M, MelikParsadaniantz S, White FA (2009) Chemokines and pain mechanisms. Brain Res Rev 60:125–134. Attakpa E, Hichami A, Simonin AM, Sanson EG, Dramane KL, Khan NA (2009) Docosahexaenoic acid modulates the expression of T-bet and GATA-3 transcription factors, independently of PPARalpha, through suppression of MAP kinase activation. Biochimie 91:1359–1365. Bassaganya-Riera J, Hontecillas R (2010) Dietary conjugated linoleic acid and n-3 polyunsaturated fatty acids in inflammatory bowel disease. Curr Opin Clin Nutr Metab Care 13:569–573. Blasi E, Barluzzi R, Bocchini V, Mazzolla R, Bistoni F (1990) Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. J Neuroimmunol 27:229–237.

Chiang CY, Wang J, Xie YF, Zhang S, Hu JW, Dostrovsky JO, Sessle BJ (2007) Astroglial glutamate-glutamine shuttle is involved in central sensitization of nociceptive neurons in rat medullary dorsal horn. J Neurosci 27:9068–9076. De Smedt-Peyrusse V, Sargueil F, Moranis A, Harizi H, Mongrand S, Laye S (2008) Docosahexaenoic acid prevents lipopolysaccharide-induced cytokine production in microglial cells by inhibiting lipopolysaccharide receptor presentation but not its membrane subdomain localization. J Neurochem 105:296–307. DeLeo JA, Yezierski RP (2001) The role of neuroinflammation and neuroimmune activation in persistent pain. Pain 90:1–6. Dixon WJ (1980) Efficient analysis of experimental observations. Annu Rev Pharmacol Toxicol 20:441–462. Ebert S, Weigelt K, Walczak Y, Drobnik W, Mauerer R, Hume DA, Weber BH, Langmann T (2009) Docosahexaenoic acid attenuates microglial activation and delays early retinal degeneration. J Neurochem 110:1863–1875. Fliesler SJ, Anderson RE (1983) Chemistry and metabolism of lipids in the vertebrate retina. Prog Lipid Res 22:79–131. Gao YJ, Ji RR (2010a) Chemokines, neuronal-glial interactions, and central processing of neuropathic pain. Pharmacol Ther 126:56–68. Gao YJ, Ji RR (2010b) Targeting astrocyte signaling for chronic pain. Neurotherapeutics 7:482–493. Gao YJ, Zhang L, Samad OA, Suter MR, Yasuhiko K, Xu ZZ, Park JY, Lind AL, Ma Q, Ji RR (2009) JNK-induced MCP-1 production in spinal cord astrocytes contributes to central sensitization and neuropathic pain. J Neurosci 29:4096–4108. Goldberg RJ, Katz J (2007) A meta-analysis of the analgesic effects of omega-3 polyunsaturated fatty acid supplementation for inflammatory joint pain. Pain 129:210–223. Gwak YS, Kang J, Unabia GC, Hulsebosch CE (2012) Spatial and temporal activation of spinal glial cells: role of gliopathy in central neuropathic pain following spinal cord injury in rats. Exp Neurol 234:362–372. Hains BC, Waxman SG (2006) Activated microglia contribute to the maintenance of chronic pain after spinal cord injury. J Neurosci 26:4308–4317. Harel Z, Biro FM, Kottenhahn RK, Rosenthal SL (1996) Supplementation with omega-3 polyunsaturated fatty acids in the management of dysmenorrhea in adolescents. Am J Obstet Gynecol 174:1335–1338. Horvath RJ, Nutile-McMenemy N, Alkaitis MS, Deleo JA (2008) Differential migration, LPS-induced cytokine, chemokine, and NO expression in immortalized BV-2 and HAPI cell lines and primary microglial cultures. J Neurochem 107:557–569. Ji RR, Gereau RWt, Malcangio M, Strichartz GR (2009) MAP kinase and pain. Brain Res Rev 60:135–148. Ji RR, Suter MR (2007) P38 MAPK, microglial signaling, and neuropathic pain. Mol Pain 3:33. Ji RR, Xu ZZ, Strichartz G, Serhan CN (2011) Emerging roles of resolvins in the resolution of inflammation and pain. Trends Neurosci 34:599–609. Jin SX, Zhuang ZY, Woolf CJ, Ji RR (2003) P38 mitogen-activated protein kinase is activated after a spinal nerve ligation in spinal cord microglia and dorsal root ganglion neurons and contributes to the generation of neuropathic pain. J Neurosci 23:4017–4022. Kawasaki Y, Zhang L, Cheng JK, Ji RR (2008) Cytokine mechanisms of central sensitization: distinct and overlapping role of interleukin1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord. J Neurosci 28:5189–5194. Kuner R (2010) Central mechanisms of pathological pain. Nat Med 16:1258–1266. Lands WE (1992) Biochemistry and physiology of n-3 fatty acids. FASEB J 6:2530–2536. Ledeboer A, Sloane EM, Milligan ED, Frank MG, Mahony JH, Maier SF, Watkins LR (2005) Minocycline attenuates mechanical allodynia and proinflammatory cytokine expression in rat models of pain facilitation. Pain 115:71–83.

Y. Lu et al. / Neuroscience 241 (2013) 22–31 Lu DY, Tsao YY, Leung YM, Su KP (2010) Docosahexaenoic acid suppresses neuroinflammatory responses and induces heme oxygenase-1 expression in BV-2 microglia: implications of antidepressant effects for omega-3 fatty acids. Neuropsychopharmacology 35:2238–2248. Marchand F, Perretti M, McMahon SB (2005) Role of the immune system in chronic pain. Nat Rev Neurosci 6:521–532. McNamara RK, Carlson SE (2006) Role of omega-3 fatty acids in brain development and function: potential implications for the pathogenesis and prevention of psychopathology. Prostaglandins Leukot Essent Fatty Acids 75:329–349. Miles EA, Calder PC (2012) Influence of marine n-3 polyunsaturated fatty acids on immune function and a systematic review of their effects on clinical outcomes in rheumatoid arthritis. Br J Nutr 107(Suppl 2):S171–184. Milligan ED, Twining C, Chacur M, Biedenkapp J, O’Connor K, Poole S, Tracey K, Martin D, Maier SF, Watkins LR (2003) Spinal glia and proinflammatory cytokines mediate mirror-image neuropathic pain in rats. J Neurosci 23:1026–1040. Milligan ED, Watkins LR (2009) Pathological and protective roles of glia in chronic pain. Nat Rev Neurosci 10:23–36. Moalem G, Tracey DJ (2006) Immune and inflammatory mechanisms in neuropathic pain. Brain Res Rev 51:240–264. Myers RR, Campana WM, Shubayev VI (2006) The role of neuroinflammation in neuropathic pain: mechanisms and therapeutic targets. Drug Discov Today 11:8–20. Nakamoto K, Nishinaka T, Mankura M, Fujita-Hamabe W, Tokuyama S (2010) Antinociceptive effects of docosahexaenoic acid against various pain stimuli in mice. Biol Pharm Bull 33:1070–1072. Perez J, Ware MA, Chevalier S, Gougeon R, Shir Y (2005) Dietary omega-3 fatty acids may be associated with increased neuropathic pain in nerve-injured rats. Anesth Analg 101:444–448. table of contents. Raghavendra V, Tanga F, DeLeo JA (2003) Inhibition of microglial activation attenuates the development but not existing hypersensitivity in a rat model of neuropathy. J Pharmacol Exp Ther 306:624–630. Romero-Sandoval EA, Horvath RJ, DeLeo JA (2008) Neuroimmune interactions and pain: focus on glial-modulating targets. Curr Opin Investig Drugs 9:726–734. Ruggiero C, Lattanzio F, Lauretani F, Gasperini B, Andres-Lacueva C, Cherubini A (2009) Omega-3 polyunsaturated fatty acids and immune-mediated diseases: inflammatory bowel disease and rheumatoid arthritis. Curr Pharm Des 15:4135–4148. Serini S, Trombino S, Oliva F, Piccioni E, Monego G, Resci F, Boninsegna A, Picci N, Ranelletti FO, Calviello G (2008) Docosahexaenoic acid induces apoptosis in lung cancer cells by increasing MKP-1 and down-regulating p-ERK1/2 and p-p38 expression. Apoptosis 13:1172–1183. Stein C, Lang LJ (2009) Peripheral mechanisms of opioid analgesia. Curr Opin Pharmacol 9:3–8. Tsuda M, Mizokoshi A, Shigemoto-Mogami Y, Koizumi S, Inoue K (2004) Activation of p38 mitogen-activated protein kinase in spinal hyperactive microglia contributes to pain hypersensitivity following peripheral nerve injury. Glia 45:89–95.

31

Vedin I, Cederholm T, Freund-Levi Y, Basun H, Garlind A, Irving GF, Eriksdotter-Jonhagen M, Wahlund LO, Dahlman I, Palmblad J (2012) Effects of DHA-rich n-3 fatty acid supplementation on gene expression in blood mononuclear leukocytes: the OmegAD study. PloS one 7:e35425. Vedin I, Cederholm T, Freund Levi Y, Basun H, Garlind A, Faxen Irving G, Jonhagen ME, Vessby B, Wahlund LO, Palmblad J (2008) Effects of docosahexaenoic acid-rich n-3 fatty acid supplementation on cytokine release from blood mononuclear leukocytes: the OmegAD study. Am J Clin Nutr 87:1616–1622. Wang H, Hao Q, Li QR, Yan XW, Ye S, Li YS, Li N, Li JS (2007) Omega-3 polyunsaturated fatty acids affect lipopolysaccharideinduced maturation of dendritic cells through mitogen-activated protein kinases p38. Nutrition 23:474–482. Watkins LR, Milligan ED, Maier SF (2001) Glial activation: a driving force for pathological pain. Trends Neurosci 24:450–455. Wen YR, Suter MR, Kawasaki Y, Huang J, Pertin M, Kohno T, Berde CB, Decosterd I, Ji RR (2007) Nerve conduction blockade in the sciatic nerve prevents but does not reverse the activation of p38 mitogen-activated protein kinase in spinal microglia in the rat spared nerve injury model. Anesthesiology 107:312–321. White FA, Bhangoo SK, Miller RJ (2005) Chemokines: integrators of pain and inflammation. Nat Rev Drug Discov 4:834–844. Wirkner K, Sperlagh B, Illes P (2007) P2X3 receptor involvement in pain states. Mol Neurobiol 36:165–183. Woolf CJ, Costigan M (1999) Transcriptional and posttranslational plasticity and the generation of inflammatory pain. Proc Natl Acad Sci U S A 96:7723–7730. Xu ZZ, Zhang L, Liu T, Park JY, Berta T, Yang R, Serhan CN, Ji RR (2010) Resolvins RvE1 and RvD1 attenuate inflammatory pain via central and peripheral actions. Nat Med 16:592–597. 591p following 597. Xue H, Wan M, Song D, Li Y, Li J (2006) Eicosapentaenoic acid and docosahexaenoic acid modulate mitogen-activated protein kinase activity in endothelium. Vascul Pharmacol 44:434–439. Yang JL, Xu B, Li SS, Zhang WS, Xu H, Deng XM, Zhang YQ (2012) Gabapentin reduces CX3CL1 signaling and blocks spinal microglial activation in monoarthritic rats. Mol Brain 5:18. Yehuda S, Carasso RL (1993) Modulation of learning, pain thresholds, and thermoregulation in the rat by preparations of free purified alpha-linolenic and linoleic acids: determination of the optimal omega 3-to-omega 6 ratio. Proc Natl Acad Sci U S A 90:10345–10349. Zhang W, Hu X, Yang W, Gao Y, Chen J (2010) Omega-3 polyunsaturated fatty acid supplementation confers long-term neuroprotection against neonatal hypoxic–ischemic brain injury through anti-inflammatory actions. Stroke 41:2341–2347. Zhuang ZY, Wen YR, Zhang DR, Borsello T, Bonny C, Strichartz GR, Decosterd I, Ji RR (2006) A peptide c-Jun N-terminal kinase (JNK) inhibitor blocks mechanical allodynia after spinal nerve ligation: respective roles of JNK activation in primary sensory neurons and spinal astrocytes for neuropathic pain development and maintenance. J Neurosci 26:3551–3560.

(Accepted 4 March 2013) (Available online 14 March 2013)