Target site insensitivity mutations in the AChE and LdVssc1 confer resistance to pyrethroids and carbamates in Leptinotarsa decemlineata in northern Xinjiang Uygur autonomous region

Target site insensitivity mutations in the AChE and LdVssc1 confer resistance to pyrethroids and carbamates in Leptinotarsa decemlineata in northern Xinjiang Uygur autonomous region

Pesticide Biochemistry and Physiology 100 (2011) 74–81 Contents lists available at ScienceDirect Pesticide Biochemistry and Physiology journal homep...

683KB Sizes 0 Downloads 4 Views

Pesticide Biochemistry and Physiology 100 (2011) 74–81

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

Target site insensitivity mutations in the AChE and LdVssc1 confer resistance to pyrethroids and carbamates in Leptinotarsa decemlineata in northern Xinjiang Uygur autonomous region Wei-Hua Jiang a, Wen-Chao Guo b, Wei-Ping Lu a, Xiao-Qin Shi a, Man-Hui Xiong a, Zhi-Tian Wang a, Guo-Qing Li a,⇑ a Department of Entomology, Nanjing Agricultural University, Key Laboratory of Monitoring and Management of Plant Diseases and Pests, Ministry of Agriculture, Nanjing 210095, China b Department of Plant Protection, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China

a r t i c l e

i n f o

Article history: Received 1 December 2010 Accepted 20 February 2011 Available online 24 February 2011 Keywords: Carbamate Pyrethroid Resistance Point mutation Target insensitivity

a b s t r a c t A survey of resistance to five conventional insecticides was conducted in 2009 and 2010 for the first generation 4th-instar larvae of Leptinotarsa decemlineata from Urumqi, Changji, Qitai and Qapqal. Compared with the Tekes population, a reference susceptible population, the Changji and Qapqal populations exhibited very high to moderate levels of resistance to cyhalothrin and deltamethrin, moderate to high levels of resistance to carbosulfan and carbofuran, and low levels of resistance to azinphosmethyl. Moreover, the Urumqi and the Qitai populations reached a high and a moderate level of resistance to carbosulfan, respectively. Synergistic effects of triphenyl phosphate, diethylmeleate, and piperonyl butoxide on cyhalothrin and carbosulfan in Changji population revealed that cytochrome P450s were involved in the resistance to cyhalothrin but not carbosulfan. A modified bi-PASA was developed to simultaneously detect point mutations of S291G in the AChE and L1014F in the LdVssc1 genes. The former mutation resulted in the resistance to carbamates and the latter in the resistance to pyrethroids. The rates of homozygous and heterozygous resistant individuals to carbamates (S291G mutation) were 17.6% and 14.7%, 50.6% and 42.2%, 49.9% and 41.7%, 51.3% and 41.4%, and 44.8% and 47.4%; to pyrethroids (L1014F mutation) were 5.8% and 8.7%, 36.1% and 27.0%, 41.8% and 24.8%, 12.2% and 9.7%, and 7.9% and 10.6%, respectively, in samples from Tekes, Changji, Qapqal, Urumqi and Qitai. I392T point mutation in the AChE was detected by RT-PCR among 18 individuals from Changji, Qapqal, Urumqi and Qitai. These results demonstrated that point mutations of S291G in the AChE and L1014F in the LdVscc1 are responsible for, at least partially, the resistance to carbamates and pyrethroids in L. decemlineata in some field populations in northern Xinjiang Uygur autonomous region. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction The Colorado potato beetle, Leptinotarsa decemlineata (Say), is a notorious defoliator of potato in the world. The beetle invaded in northwest of Xinjiang Uygur autonomous region in 1993, and now it is widely distributed through most of northern Xinjiang, and often causes extremely large potato yield losses. Spraying chemical insecticides become normal control measure. This leads to the development of resistance to various insecticides [1–13] in many countries throughout North America, Europe, and parts of Asia. In Xinjiang, the beetles have developed resistance to several insecticides, such as carbosulfan and cyhalothrin [14,15]. In order to efficiently control L. decemlineata and manage insecticide

⇑ Corresponding author. E-mail address: [email protected] (G.-Q. Li). 0048-3575/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.pestbp.2011.02.008

resistance, dynamic resistance monitoring and resistance mechanism exploration are necessary. Bidirectional PCR amplification of specific allele (bi-PASA) is a rapid method to detect single-base change. It is an efficient, reliable, and cheap diagnostic procedure and can simultaneously distinguish wild-type susceptible alleles (WW), mutant homozygous resistant alleles (MM), and heterozygote (MW) genotypes in one PCR by utilizing novel primer design with appropriate cycling conditions. Previous studies have revealed that the resistance to carbamates in L. decemlineata is autosomal, essentially monofactorial and associated with an A to G point mutation that results in a serine to glycine amino acid change (S291G) in the AChE [16,17] and resistance to pyrethroids is sex-linked [18,19], and is caused by a single amino acid substitution L1014F in the Vssc1 voltage-sensitive sodium channel [4,9,20–24]. These offer the feasibility for molecular detection of L. decemlineata resistance to carbamates and pyrethroids in Xinjiang.

75

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81

In the present paper, we found that some L. decemlineata field populations had developed resistance to carbamates, pyrethroids, and organophosphates. Synergistic assays revealed that enzyme detoxification only played a minor role. We developed a modified bi-PASA and discovered that target site insensitivity mutations in the AChE and LdVssc1 conferred resistance to carbamates and pyrethroids, respectively. 2. Materials and methods 2.1. Insects and chemicals Potato is a single-season crop growing from May to August or September in Xinjiang Uygur autonomous region in China. The overwintered adults emerge and feed on the leaves of potato plants in the early to mid-May. Overwintered-adult samples from Urumqi city (43.71N, 87.39E, 2010), Changji city (43.87N, 87.25E, 2009 and 2010), Qitai (44.03N, 89.56E, 2010), Qapqal (43.81N, 81.20E, 2010) and Tekes (43.23N, 81.82E, 2009 and 2010) counties in northern Xinjiang were collected from potato field. Sampled locations were usually chosen at random in the study areas. Adults were routinely reared in an insectary at 28 ± 1 °C under a 16 h:8 h light–dark photoperiod and 50–60% relative humidity using fresh potato foliage as food. And the first generation 4th-instar larvae were used in experiments. A total of five conventional insecticides (technical-grade active ingredients) used in the present paper are detailed in Table 1. These insecticides represent three classes including two pyrethroids (cyhalothrin and deltamethrin), two carbamates (carbofuran and carbosulfan) and an organophosphate (azinphosmethyl). Triphenyl phosphate (TPP) was obtained from Beijing Chemical Reagent in China. Diethylmeleate (DEM) was kindly provided by Shanghai Chemical Reagent in China, and Piperonyl butoxide (PBO) was acquired from Sigma. Acetone was from Nanjing Chemical Reagent Co., Ltd. in China. All belonged to the analytical grade. These chemicals were kept in a refrigerator between the experimental sessions. 2.2. Bioassays A topical bioassay was used to assess the susceptibilities of L. decemlineata to the insecticides. Technical-grade active ingredients were dissolved in analytical-grade acetone and, for each of the insecticides, at least five concentrations within a mortality range near 0–100% based on preliminary assays were used. Ten 4th-instar larvae were treated individually with 0.22 lL of insecticide solution applied by a 10 lL microsyringe connected to a microapplicator (Hamilton Company, Reno, NV) to the 4th dorsal abdominal segment. Each control larva received 0.22 lL of acetone. Control mortality was typically less than 10%. Three to five replications per concentration were performed. The synergistic effects of TPP, DEM and PBO on several insecticides were estimated. TPP, DEM and PBO were normally considered as the inhibitor of esterases, glutathione S-transferase and

Table 1 Details of five technical grade insecticides.

cytochrome P450 monooxygenases, respectively. These chemicals were dissolved in analytical-grade acetone and applied individually to the 4th dorsal abdominal segment 1 h prior to insecticide application at a dose of 5 lg per 4th-instar larva, an amount having no obvious influence on the larvae in a preliminary test. Acetone was applied as blank. After treatment, the larvae were placed in Petri dishes (9 cm in diameter and 1.5 cm in height) containing fresh potato leaves and kept under environmental conditions outlined for larval rearing. For some insecticides, such as avermectin analogs and neonicotinoids, a considerable number of beetles remained moribund 72 h after treatment [3,25]. However, the insecticides in the present paper could rapidly kill the larvae. Therefore, mortalities were assessed 24 h later according to the previous results [14,15]. The treated larvae were considered as alive if they could move their legs and body after touching one leg with a fine needle, a criterium presented by Sharif et al. [11]. Abbott’s formula was used to correct the data for control mortality [26]. Probit analysis was used to estimate the doses needed to cause 50% mortality (LD50), their fiducial limits, and the slope of the line relating probit mortality to the log dose by POLO software. Resistance ratio (RR) was determined by comparing the LD50 value of each local population to each of the insecticides with corresponding LD50 value of a reference population. Insecticide resistance level was classified by using RRs on the basis of following standard: susceptibility (RR = 1–2), low-resistance (RR = 2.1–10), moderate resistance (RR = 10.1–30), high resistance (RR = 30.1–100) and very high resistance (RR > 100) [27]. Synergism ratio was calculated by dividing the LD50 value of unsynergized treatment with the LD50 value of synergized treatment. 2.3. Bidirectional polymerase chain reaction amplification of specific alleles (bi-PASA) Genomic DNA was isolated from whole body homogenate of individual larvae from Changji in 2009, and from Tekes, Changji, Qapqal, Urumqi and Qitai in 2010, using Universal Genomic DNA Extraction Kit (TaKaRa Biotechnology (Dalian) Co., Ltd.) according to the manufacturer’s instructions. A bi-PASA method described previously by Clark et al. [21] and Kim et al. [24] was used to detect point mutation S291G in AChE and L1014F in LdVssc1 genes. Amplified DNA fragments were separated using 2% agarose gel (Cambrex Corporation, NJ) electrophoresis and visualized by ethidium bromide staining. A GeneRuler 100 bp Plus DNA ladder (Fermentas) was used to estimate fragment sizes. To simultaneously detect mutation S291G in the AChE and L1014F in the LdVssc1, a modified bi-PASA was developed by designing two new non-specific outer primers (Table 2) in the AChE gene (Fig. 1). Each 25 lL PCR contained 1 lL of genomic DNA tem-

Table 2 Primers used in bi-PASA for detection of mutant resistant alleles and in RT-PCR for sequencing the AChE fragment. Primer

Sequence (50 –30 ) GACATCACGCTGACAAACCTAC CGTTCCTTCATCGTGATTACTCC

Insecticide

Purity (%)

Manufacture

Bi-PASA Allele non-specific forward primer of AChE Allele non-specific reverse primer of AChE

Cyhalothrin

95.0

Deltamethrin Azinphosmethyl Carbofuran Carbosulfan

98.0 98.9 97.0 90.0

Haili Guixi Chemical Industry Pesticide Factory Nanjing Red Sun Group Limited Company Sigma–Aldrich Jiangsu Tongzhou Zhengda Pesticide Factory Nanjing Red Sun Group Limited Company

PCR amplification for the AChE fragments External AChEeF AChEeR Internal AChEiF AChEiR

TGACAAACCTACAATCGACAGAC GTTCAAAGGATGACCAAACACG AATAACGCTCTTTGGTGAATCTGC CGTATACTGGAAAACGATGGC

76

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81

plate, 2.5 lL of 10 PCR Buffer, 2 lL of MgCl2 (25 mM), 2 lL of dNTP mixture (2.5 mM/each), 0.5 lL of two new allele non-specific outer primers (10 lM) each, 1 lL of the other primers (10 lM) each, 0.25 lL of TaKaRa Ex Taq (5 U/lL) and 10.25 lL of ddH2O. Allele specific fragments were amplified by stringent PCR condition to prevent non-specific binding of primers using the following thermal cycle program: denaturing at 94 °C for 4 min; 16 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 1 min; 2 cycles of 94 °C for 30 s, 57 °C for 30 s, lowering 0.5 °C each cycle and 72 °C for 1 min; 15 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min; 2 cycles of 94 °C for 30 s, 56 °C for 30 s, lowering 0.5 °C each cycle and 72 °C for 1 min; 9 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 7 min. Ten microliters of PCR products was separated using a 2% agarose gel by electrophoresis at 100 V constant voltage for 40 min and visualized by ethidium bromide staining. Correlation analyses between mutant allele frequencies and resistance to insecticides in different populations were performed by the program SPSS for Windows (SPSS Inc., Chicago, IL, USA).

2.4. PCR amplification for the AChE fragments To confirm the bi-PASA results and to detect I392T mutation in the AChE, a point mutation influencing in the resistance to carbamates [28], total RNA was extracted from whole body homogenate of individual larvae from Changji, Qapqal, Urumqi and Qitai using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Shanghai, China), and were treated for 30 min at 37 °C with RNase free DNase I (Ambion, Austin, TX) to eliminated traces of chromosomal DNA. The purity and amount of RNA was determined by NanoDrop ND-1000 spectrophotometer (Nanodrop Technologies, Rockland, DE, USA). First-strand cDNA was synthesized from the total RNA using the reverse transcriptase XL (AMV) (Takara Co., Otsu, Japan) and an oligo (dT18) primer, and was used as a template for PCR. To obtain a high degree of sensitivity, a nested PCR protocol was designed and optimized to clone a nucleotide fragment corresponding to amino acids 279–414 of the AChE in the GenBank (Accession No. gi:758685). The external amplification was performed using external primers AChEeF and AChEeR (Table 2). Each

25 lL PCR contained 1 lL of cDNA template, 2.5 lL of 10 Ex Taq Buffer (Mg2+ Free), 2 lL of MgCl2 (25 mM), 2 lL of dNTP mixture (2.5 mM/each), 1 lL AChEeF primer (10 lM), 1 lL AChEeR primer (10 lM), 0.25 lL of TaKaRa Ex Taq (5 U/lL) and 15.25 lL of ddH2O. The external amplification was performed by using a ‘‘touchdown’’ PCR technique where the annealing temperature was lowered 0.5 °C per cycle, from 60 to 46 °C, for a total of 28 cycles with each annealing step lasting 50 s. Ten more cycles was then performed with the annealing temperature at 46 °C for 50 s. Denaturation steps were all executed at 94 °C (for 1 min) and extensions at 72 °C (for 50 s). Following this, a final extension at 72 °C for 10 min was performed, and then the reaction was cooled at 12 °C. Internal amplification was performed using internal primers AChEiF and AChEiR (Table 2). Each 50 lL PCR contained 1 lL of the external PCR amplification, 5 lL of 10 Ex Taq Buffer (Mg2+ Free), 4 lL of MgCl2 (25 mM), 4 lL of dNTP mixture (2.5 mM/each), 2 lL AChEiF primer (10 lM), 2 lL AChEiR lM primer (10 lM), 0.25 lL of TaKaRa Ex Taq (5 U/lL) and 31.75 lL of ddH2O. Thermal cycling conditions were 94 °C for 3 min, 94 °C for 1 min, 55 °C for 50 s, and 72 °C for 50 s, for 34 cycles with the annealing temperature reduced 0.5 °C per cycle. The last cycle was followed by final extension at 72 °C for 10 min. The negative control contained all of the PCR reagent and sterile distilled water. The amplified products obtained above were separated onto agarose gel and purified using the Wizard PCR Preps DNA Purification System (Promega). Purified DNA was ligated into the pGEM-T easy vector (Promega) and four independent subclones for each sample were sequenced from both directions by Invitrogen, Shanghai, China.

3. Results 3.1. Resistance levels of the 4th-instar larvae from four sites In 2009, two field populations were collected from Tekes and Changji, and susceptibilities to the five insecticides were evaluated. Compared with the Tekes population, a reference susceptible population [15], the Changji population exhibited a very high and a moderate level of resistance to cyhalothrin and deltamethrin, respectively, a moderate level of resistance to carbosulfan and

Fig. 1. Schematic diagram of bi-PASA for simultaneous detection of mutation points of S291G in AChE and L1014F in LdVssc1 genes.

77

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81 Table 3 Toxicities of five conventional insecticides to the 4th-instar larvae from Tekes and Changji in 2009, and from Qapqal, Urumqi and Qitai in 2010. Insecticides

a

Population

No. of tested individuals

LD50 (lg/larva) (95%FL)a

Slope (b)

4

4

3

v2 value (P value)

RR

Cyhalothrin

Tekes Changji Qapqal Urumqi Qitai

240 180 270 212 241

0.8305 1.1523 1.0419 2.5894 1.1875

5.01  10 5.45  102 1.13  102 1.01  103 6.04  104

(1.04  10 –1.95  10 ) (2.13  102–1.51  101) (7.35  103–1.88  102) (7.04  104–1.50  103) (4.04  104–1.01  103)

4.12 3.15 6.03 1.31 2.56

(>0.25) (>0.50) (>0.10) (>0.90) (>0.75)

1.0 108.8 225.5 2.0 1.2

Deltamethrin

Tekes Changji Qapqal Urumqi Qitai

185 241 258 234 258

0.5362 1.4587 1.4538 1.3427 1.1424

2.01  104 6.13  103 8.58  103 7.32  104 3.47  104

(1.03  104–3.64  103) (3.87  103–9.85  103) (1.15  104–1.93  102) (2.76  104–1.19  103) (1.34  104–5.60  104)

1.78 1.33 1.04 4.20 2.01

(>0.75) (>0.75) (>0.90) (>0.25) (>0.50)

1.0 30 42.7 3.6 1.7

Carbofuran

Tekes Changji Qapqal Urumqi Qitai

180 241 239 180 208

1.4989 1.8567 1.8678 1.3424 1.4579

2.33  102 4.23  101 2.34  101 3.34  102 2.87  102

(1.44  103–3.76  101) (2.67  101–6.76  101) (1.34  101–4.05  101) (1.05  103–6.57  102) (1.36  103–3.85  102)

3.04 1.73 0.97 1.79 3.32

(>0.25) (>0.75) (>0.90) (>0.75) (>0.50)

1.0 18.2 10.1 1.4 1.2

Carbosulfan

Tekes Changji Qapqal Urumqi Qitai

241 210 240 210 210

1.8167 3.1835 3.0446 6.4446 2.6626

1.12  102 2.75  101 1.81  101 3.49  101 1.37  101

(5.74  103–2.19  102) (2.35  101–3.22  101) (1.43  101–2.30  101) (3.24  101–3.76  101) (1.15  101–1.64  101)

1.68 3.21 2.47 3.01 4.23

(>0.75) (>0.50) (>0.50) (>0.50) (>0.25)

1.0 24.5 16.2 31.2 12.2

Azinphosmethyl

Tekes Changji Qapqal Urumqi Qitai

180 211 240 210 210

1.3898 1.9657 2.1835 3.4513 2.9053

3.33  101 (1.48  101–7.48  101) 1.93  100 (1.43  100–2.41  100) 8.51  101 (6.37  101–1.14  100) 9.41  101 (7.83  101–1.13  100) 2.36  101 (1.90  101–2.93  101)

1.48 1.73 1.02 2.39 3.37

(>0.75) (>0.75) (>0.90) (>0.50) (>0.25)

1.0 5.8 2.6 2.8 0.7

LD50 is the doses that cause 50% mortality, FL represents fiducial limits of LD50 at P = 0.05. The same as Table 4.

Table 4 Synergistic effects of several enzyme inhibitors on carbosulfan and cyhalothrin in the 4th-instar larvae from Changji in 2009. Insecticides Carbosulfan

Cyhalothrin

Treatment

No. of tested individuals

LD50 (lg/larva) (95%FL) 1

1

1

v2 value (P value)

Synergistic ratio

+acetone +PBO +DEM +TPP

214 212 238 229

2.75  10 1.92  101 1.74  101 2.86  101

(2.35  10 –3.22  10 ) (1.21  101–2.63  101) (9.65  102–2.51  101) (1.64  101–4.08  101)

3.21 1.15 2.48 2.29

(>0.50) (>0.75) (>0.50) (>0.50)

1.4 1.6 1.0

+acetone +PBO +DEM +TPP

180 268 239 241

5.45  102 1.51  102 4.24  102 5.12  102

(2.13  102–1.51  101) (1.04  102–2.01  102) (3.01  102–5.47  102) (2.26  102–7.98  102)

3.15 1.24 2.37 1.73

(>0.50) (>0.75) (>0.50) (>0.75)

3.6 1.3 1.1

carbofuran, respectively, and a low level of resistance to azinphosmethyl (Table 3). In 2010, susceptibilities of other three field populations were tested. The Qapqal population showed a very high and a high level of resistance to cyhalothrin and deltamethrin, respectively, moderate levels of resistance to carbosulfan and carbofuran. Moreover, the Urumqi and the Qitai populations reached a high and a moderate level of resistance to carbosulfan, respectively (Table 3). 3.2. Synergistic effects of several enzyme inhibitors The synergisms of PBO, TPP and DEM on carbosulfan and cyhalothrin in the Changji populations were tested in 2009. These three synergists only had slight or no synergistic effects on carbosulfan. In contrast, PBO exhibited significant synergistic effect on cyhalothrin (Table 4). 3.3. Detection of carbamate and pyrethroid mutant resistant allele in Changji population Carbamate and pyrethroid mutant resistant alleles in Changji population in 2009 were detected by the bi-PASA method described previously by Clark et al. [21] and Kim et al. [24]. The percentages of homozygous mutant (MM), heterozygous mutant

(MW) and homozygous wild-type (WW) individuals in the population to carbamates were 52.3%, 47.7% and 0%, respectively. Moreover, the rates of individuals having MM, MW and WW genotypes to pyrethroids were 32.3%, 25.4% and 42.3%, respectively. No individual was simultaneously having WW genotypes to both carbamates and pyrethroids. The incidence of individuals that simultaneously have MM genotypes to carbamates and pyrethroids was 17.7%. The incidences of individuals that had MW genotype to carbamates and MM genotype to pyrethroids, MW genotype to both types of insecticides, and MM genotype to carbamates and MW genotype to pyrethroids were 14.6%, 11.5%, and 13.8%, respectively (Fig. 2). 3.4. Development of a modified bi-PASA and its application To simultaneously detect mutation S291G in the AChE and L1014F in the LdVssc1, a modified bi-PASA was developed. Among four pairs of primers, a pair of outer primers from the AChE gene was redesigned (Table 2) and the other three pairs were adopted according to Clark et al. [21] and Kim et al. [24]. Consequently, homozygous resistant (MM) alleles of the AChE gene are determined by the presence of a small (299 bp) and a large (720 bp) fragment, and homozygous susceptible (WW) are determined by the presence of 456 bp- and 720 bp-fragments, and heterozygous

78

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81

Fig. 2. Resistant alleles to carbosulfan and cyhalothrin detected by a bi-PASA in Changji field populations of Colorado potato beetle in 2009.

Fig. 3. Simultaneous detection of mutation points of S291G in AChE and L1014F in LdVssc1 genes using a modified bi-PASA. A pair of outer primers from the AChE gene was redesigned (Table 2) and the other three pairs were adopted according to Clark et al. [21] and Kim et al. [24].

alleles (MW) by 720 bp-, 299 bp-, and 456 bp-fragments, respectively (Figs. 1 and 3). When re-examining the samples of Changji field population collected in 2009 with the modified bi-PASA, the same results of the resistance alleles to both carbamates and pyrethroids were obtained (data not shown). In 2010, the samples from five field populations were examined using the modified bi-PASA. The percentages of individuals possessing MM, MW and WW genotypes from Changji population to carbamates were 50.6%, 42.2%, and 7.1%, respectively, to pyrethroids were 36.1%, 27.0%, and 36.8%, respectively, similar to those in 2009. The percentages of individuals possessing MM and MW genotypes to carbamates were 17.6% and 14.7% in Tekes population, 49.9% and 41.7% in Qapqal population, 51.3% and 41.4% in Urumqi population, and 44.8% and 47.4% in Qitai population, respectively, to pyrethroids were 5.8% and 8.7%, 41.8% and 24.8%, 12.2% and 9.7%, and 7.9% and 10.6%, in samples from Tekes, Qapqal, Urumqi, and Qitai population, respectively (Table 5). In comparison with the results detected by the modified biPASA, four cDNA subset samples from Changji, Qapqal, Urumqi and Qitai were cloned and sequenced. The rates of individuals having MM and MW genotypes to carbamates were 50.0% and 25.0%,

50.0% and 50.0%, 66.7% and 16.7%, and 33.3% and 0.0% in samples from Changji, Qapqal, Urumqi, and Qitai, respectively (Fig. 4). These data also showed a very high rate of individuals having MM genotype and a low rate of individuals possessing WW genotype to carbamates in samples from these four sites. Correlation analyses revealed that neither the rate of individuals possessing MM nor the rate of individuals having both MM and MW genotypes from the five field populations were positively correlated with the resistance ratio to carbosulfan (r = 0.40 and 0.47, t = 0.76 and 0.93, p > 0.4 and 0.4), or to carbofuran (r = 0.78 and 0.85, t = 2.14 and 2.74, p > 0.1 and 0.1), respectively. In contrast, the rate of MM individuals from the five field populations were positively correlated with the resistance ratios to cyhalothrin (r = 0.95, t = 5.01, p < 0.05) and deltamethrin (r = 0.99, t = 12.18, p < 0.005), respectively. 3.5. Detection of I392T point mutation in the AChE in four field populations by RT-PCR It was found that the individuals with both S291G and I392T point mutations in the AChE were susceptible to both

79

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81

Table 5 Percentages of homozygous mutant (MM), heterozygous mutant (MW) and homozygous wild-type (WW) individuals of the AChE and LdVssc1 detected by a modified bi-PASA in five field populations from Xinjiang in 2010. Tested individuals

Tekes Changji Qapqal Urumqi Qitai

34 57 48 41 38

Genotypes (S291G in AChE/ L1014F in LdVssc1) (%) WW/MM

WW/MW

WW/WW

MW/MM

MW/MW

MW/WW

MM/MM

MM/MW

MM/WW

2.9 1.8 2.1 0 0

2.9 1.8 2.1 2.4 5.3

61.8 3.5 4.1 4.9 2.6

2.9 16 18.7 7.3 2.6

2.9 10.4 10.5 2.4 5.3

8.9 15.8 12.5 31.7 39.5

0 18.3 21 4.9 5.3

2.9 14.8 12.2 4.9 0

14.7 17.5 16.7 41.5 39.5

Fig. 4. Deduced amino acid sequences from aa 280 to aa 300 and from aa 380 to aa 400 of the AChE from four field populations aligned with corresponding region of documented sequence in L. decemlineata, with emphasis upon mutation sites of S291G and I392T.

azinphosmethyl and carbofuran [28]. A nested PCR protocol was designed to test whether or not the beetles in northern Xinjiang possessing both S291G and I392T point mutations. No I392T point mutation was found among 18 individuals from Changji, Qapqal, Urumqi and Qitai field populations (Fig. 4).

4. Discussion Leptinotarsa decemlineata invaded China in the 1990s from Kazakhstan. Since then, it has spread eastward, and currently distributed through most of northern Xinjiang. After its initial outbreak, growers usually apply systemic formulation of carbofuran to the whole field as an in-furrow application at planting or as a seed treatment in order to ensure a high yield. A few years later, three pyrethroids, cyhalothrin, deltamethrin and a-cypermethrin, became the major chemicals after a considerable decrease in car-

bofuran efficiency. The high frequency of insecticide application usually causes development of resistance [3–5,9,10,29]. Our previous results showed that the adults of some field populations had developed resistance to cyhalothrin, deltamethrin, a-cypermethrin, carbofuran, and carbosulfan [15]. Since the resistance in L. decemlineata may vary markedly from region to region and from field to field, depending on the patterns of use of insecticide and pressure, and between adults and larvae [30–33], we expanded monitoring to gather data in 2009 and 2010 and evaluated insecticide resistance of the 4th-instar larvae. The data demonstrated that the Changji and Qapqal populations exhibited resistance to cyhalothrin, deltamethrin, carbosulfan and carbofuran, the Urumqi and Qitai populations was resistant to carbosulfan, and the Changji population showed a low level of resistance to azinphosmethyl. Based on the results obtained in the present paper, it is apparent that the continued heavy reliance on carbamates and pyrethroids will be problematic in northern Xinjiang. High resistance level to insecticides in L. decemlineata may mainly result from two distinct but additive mechanisms: the target site insensitivity to and an increased metabolism of the insecticides [5,9,10,14,15,29]. In the present paper, the degree of synergism of three enzyme inhibitors (TPP, an esterase inhibitor; PBO, a cytochrome P450-dependent monooxygenase inhibitor; and DEM, a glutathione S-transferase inhibitor) to cyhalothrin and carbosulfan was investigated. These three synergists only had slight or no synergistic effects on carbosulfan. In contrast, PBO exhibited significant synergistic effect on cyhalothrin. These results demonstrated that cytochrome P450-dependent monooxygenases mediated detoxification of, and was partially responsible for the resistance to, cyhalothrin in the 4th-instar larvae. Our previous results showed that TPP, DEM, and PBO had little synergism to cyhalothrin in CJ and QPQL adult samples. In contrast, PBO and TPP exhibited some synergistic effects to carbofuran in the QPQL population, indicating the involvement of monooxygenases and esterases in conferring carbofuran resistance [15]. Although both our previous and present results demonstrated that enhanced detoxications only had slight effect on resistance to carbamates and pyrethroids, there are some differences between adults and larvae in synergistic results of TPP, DEM, and PBO, indicating various insecticide metabolism pathways between adults and larvae. Consistent with our results, the resistance levels vary greatly between beetle life stages in L. decemlineata [30–33]. It seems that there are additional mechanisms involved. In fact, target site insensitivity is an important mechanism of insecticide resistance [5]. It has been documented that an amino acid change (leucine to phenylalanine, L1014F) in an a-subunit of the sodium channel resulted in the resistance to pyrethroids in some L. decemlineata strains [9,20,24]. In the present paper, we examined this point mutation in five field samples. The rates of individuals having MM and MW genotypes to pyrethroids were 5.8% and 8.7%, 36.1% and 27.0%, 41.8% and 24.8%, 12.2% and 9.7%, and 7.9% and 10.6% in samples from Tekes, Changji, Qapqal, Urumqi, and Qitai, respectively. Our inheritance studies showed that the resistance to pyrethroids is semirecessive (Jiang et al., unpublished

80

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81

results), similar to that documented in other resistant strains [19], we calculated the correlation between the rate of MM individuals and the resistance ratios in the five field populations. As expected, the positive correlation was confirmed between them for both cyhalothrin and deltamethrin. Our inheritance studies (Jiang et al., unpublished results) and the documented results [18,19] showed that the resistance to pyrethroids is due to a sex-linked factor, and the sex determination system in L. decemlineata is XO. This means that the resistant phenotype will therefore be expressed in all males carrying the resistance-conferring allele and all the MW individuals are females. Consequently, more males survived under the selection pressure of pyrethroids. In the present paper, we found that the rates of homozygous resistant individuals in samples from Changji and Qapqal were much higher than those in Tekes, Urumqi and Qitai samples. It is possible that most individuals with homozygous resistant allele in samples from Changji and Qapqal are males. Further field investigations will shed light on this issue. It has been documented that point mutation of S291G in the AChE plays a critical role in resistance to organophosphates and carbamates [4,9,10,23,28,34–37]. According to resistant ratios to carbosulfan and carbofuran, higher incidences of L. decemlineata individuals with resistance allele to carbamates was expected in samples from Changji, Qapqal, Urumqi, and Qitai than in samples from Tekes. Such relationships between resistant ratios and incidence of resistance alleles were proved. The resistant ratio of Tekes, Changji, Qapqal, Urumqi, and Qitai field populations to carbofuran was 1.0, 17.6, 10.1, 1.4, and 1.2, respectively, to carbosulfan was 1.0, 24.5, 16.2, 31.2, and 12.2, respectively. The rates of individuals possessing MM and MW genotypes to carbamates were 17.6% and 14.7%, 50.6% and 42.2%, 49.9% and 41.7%, 51.3% and 41.4%, and 44.8% and 47.4% in these five samples. We can find similar variation tendency between resistant ratios and incidence of resistance alleles, although the correlation was not statistically significant. It has been reported that BERTS-R, possessed only S291G in the AChE, showed a high and a moderate level resistance to carbofuran and azinphosmethyl, respectively. In contrast, the BERTS-S substrain possessed both S291G and I392T, and was susceptible to both azinphosmethyl and carbofuran [28]. In the present paper, we found there was no I392T point mutation in the AChE among 18 individuals from Changji, Qapqal, Urumqi, and Qitai field populations. In summary, our results demonstrated that point mutations of S291G in the AChE and L1014F in the LdVscc1 are responsible for, at least partially, the resistance to carbamates and pyrethroids in L. decemlineata in some field populations in northern Xinjiang Uygur autonomous region. Reducing insecticide resistance of L. decemlineata populations is very important and urgent. Rotation between insecticides with different modes of action may reduce the development of insecticide resistance. Neonicotinoids, which have different mode of action from carbamates, pyrethroids, and organophosphates, have been successfully used by potato growers in some counties in northern Xinjiang, and they should be applied in sites where L. decemlineata beetles have developed high level of resistance to pyrethroids and/or carbamates. Acknowledgments The research is supported by a special project with public benefit in agriculture (200803024 and 201103026). We are very grateful to Mr. Jiang He, Mr. Guo-An Yang, Mrs. Li-Hong Qu, Mr. Zhen-Han Xia, Mr. Fu-Wang Liu, Mrs. Wen-Jun Fu, Mr. Meng-Qiang Tian, Mr. Xin-Yue Jing, Mr. Xuan-Kai Zhang, Mr. Xiao-Hui Chen, Miss Li-Jun Wang and Miss Di Lina for help in insect rearing and collection. We would like to thank other field entomologists and technicians at Urumqi, Fukang, Changji, Altay, Ili, Nilka, and Tekes

counties (cities) in northern Xinjiang Uygur autonomous region in China for technical and other assistance. We wish to thank Drs. Z. Han, F. Li and S. Dong of our laboratory for useful discussions during the course of this research. References [1] P. Wegorek, Current status of resistance in Colorado potato beetle (Leptinotarsa decemlineata Say) to selected active substances of insecticides in Poland, Journal of Plant Protection Research 45 (2005) 309–319. [2] T. Leontieva, G. Benkovskaya, M. Udalov, A. Poscryakov, Insecticide resistance level in Leptinotarsa decemlineata Say population in the South Ural, Resistant Pest Management Newsletter 15 (2006) 25–26. [3] D. Mota-Sanchez, R. Hollingworth, E. Grafius, D. Moyer, Resistance and crossresistance to neonicotinoid insecticides and spinosad in the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae), Pest Management Science 62 (2006) 30–37. [4] G. Ben’kovskaya, M. Udalov, E. Khusnutdinova, The genetic base and phenotypic manifestations of Colorado potato beetle resistance to organophosphorus insecticides, Russian Journal of Genetics 44 (2008) 553–558. [5] A. Alyokhin, M. Baker, D. Mota-Sanchez, G. Dively, E. Grafius, Colorado potato beetle resistance to insecticides, American Journal of Potato Research 85 (2008) 395–413. [6] M. Azimi, A. Pourmirza, M. Safaralizadeh, G. Mohitazar, Studies on the lethal effects of spinosad on adults of Leptinotarsa decemlineata (Say) (Coleóptera: Chrysomelidae) with two bioassay methods, Asian Journal of Biological Sciences 2 (2009) 1–6. [7] N. Alioghli, G. Nouri-Ganbalani, S. Fathi, M. Hassanpour, Separate and combined effect of Bt, imidachloprid and fenvalerate on the control of the Colorado potato beetle, Leptinotarsa decemlineata (Say), in Sarab region, Iran, World Applied Sciences Journal 8 (2010) 1351–1358. [8] Z. Laznik, T. Tóth, T. Lakatos, M. Vidrih, S. Trdan, Control of the Colorado potato beetle (Leptinotarsa decemlineata [Say]) on potato under field conditions: a comparison of the efficacy of foliar application of two strains of Steinernema feltiae (Filipjev) and spraying with thiametoxam, Journal of Plant Diseases and Protection 117 (2010) 129–135. [9] T. Zichová, F. Kocourek, J. Salava, K. Nad’ová, J. Stará, Detection of organophosphate and pyrethroid resistance alleles in Czech Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) populations by molecular methods, Pest Management Science 66 (2010) 853–860. [10] M. Mohamadi, M. Mossadegh, M. Hejazi, M. Goodarzi, M. Khanjani, H. Galehdari, Synergism of resistance to phosalone and comparison of kinetic properties of acetylcholinesterase from four field populations and a susceptible strain of Colorado potato beetle, Pesticide Biochemistry and Physiology 98 (2010) 254–262. [11] M. Sharif, M. Hejazi, A. Mohammadi, M. Rashidi, Resistance status of the Colorado potato beetle, Leptinotarsa decemlineata, to endosulfan in East Azarbaijan and Ardabil provinces of Iran, Journal of Insect Science 31 (2007) 1–7. [12] M. Baker, A. Alyokhin, A. Porter, D. Ferro, S. Dastur, N. Galal, Persistence and inheritance of costs of resistance to imidacloprid in Colorado potato beetle, Journal of Economic Entomology 100 (2007) 1871–1879. [13] A. Alyokhin, G. Dively, M. Patterson, C. Castaldo, D. Rogers, M. Mahoney, J. Wollam, Resistance and cross-resistance to imidacloprid and thiamethoxam in the Colorado potato beetle Leptinotarsa decemlineata, Pest Management Science 63 (2007) 32–41. [14] W. Jiang, M. Xiong, Z. Wang, G. Li, A survey of insecticide resistance in the Colorado potato beetle (Leptinotarsa decemlineata) among northern Xinjiang Uygur autonomous region, Resistant Pest Management Newsletter 19 (2010) 17–23. [15] W. Jiang, Z. Wang, M. Xiong, W. Lu, P. Liu, W. Guo, G. Li, Insecticide resistance status of Colorado potato beetle (Coleoptera: Chrysomelidae) adults in northern Xinjiang Uygur autonomous region, Journal of Economic Entomology 103 (2010) 1365–1371. [16] K. Zhu, J. Clark, Validation of a point mutation of acetylcholinesterase in Colorado potato beetle by polymerase chain reaction coupled to enzyme inhibition assay, Pesticide Biochemistry and Physiology 57 (1997) 28–35. [17] K. Zhu, S. Lee, J. Clark, A point mutation of acetylcholinesterase associated with azinphosmethyl resistance and reduced fitness in Colorado potato beetle, Pesticide Biochemistry and Physiology 55 (1996) 100–108. [18] D. Heim, G. Kennedy, F. Gould, J. Van Duyn, Inheritance of fenvalerate and carbofuran resistance in colorado beetles-Leptinotarsa decemlineata (Say)-from North Carolina, Pesticide Science 34 (1992) 303–311. [19] J. Argentine, J. Clark, D. Ferro, Genetics and synergism of azinphosmethyl and permethrin resistance in the Colorado potato beetle (Coleoptera: Chrysomelidae), Journal of Economic Entomology 82 (1989) 698–705. [20] S. Lee, J. Dunn, J. Marshall Clark, D. Soderlund, Molecular analysis of kdr-like resistance in a permethrin-resistant strain of Colorado potato beetle, Pesticide Biochemistry and Physiology 63 (1999) 63–75. [21] J. Clark, S. Lee, H. Kim, K. Yoon, A. Zhang, DNA-based genotyping techniques for the detection of point mutations associated with insecticide resistance in Colorado potato beetle Leptinotarsa decemlineata, Pest Management Science 57 (2001) 968–974.

W.-H. Jiang et al. / Pesticide Biochemistry and Physiology 100 (2011) 74–81 [22] D. Hawthorne, AFLP-based genetic linkage map of the Colorado potato beetle Leptinotarsa decemlineata sex chromosomes and a pyrethroid-resistance candidate gene, Genetics 158 (2001) 695–700. [23] H. Kim, J. Dunn, K. Yoon, J. Clark, Target site insensitivity and mutational analysis of acetylcholinesterase from a carbofuran-resistant population of Colorado potato beetle, Leptinotarsa decemlineata (Say), Pesticide Biochemistry and Physiology 84 (2006) 165–179. [24] H. Kim, D. Hawthorne, T. Peters, G. Dively, J. Clark, Application of DNA-based genotyping techniques for the detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle, Pesticide Biochemistry and Physiology 81 (2005) 85–96. [25] J. Zhao, B. Bishop, E. Grafius, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), Journal of Economic Entomology 93 (2000) 1508–1514. [26] W. Abbott, A method of computing the effectiveness of an insecticide, Journal of Economic Entomology 18 (1925) 265–267. [27] L. Torres-Vila, M. Rodriguez-Molina, A. Lacasa-Plasencia, P. Bielza-Lino, Insecticide resistance of Helicoverpa armigera to endosulfan, carbamates and organophosphates: the Spanish case, Crop Protection 21 (2002) 1003– 1013. [28] H. Kim, K. Yoon, J. Clark, Functional analysis of mutations in expressed acetylcholinesterase that result in azinphosmethyl and carbofuran resistance in Colorado potato beetle, Pesticide Biochemistry and Physiology 88 (2007) 181–190. [29] A. Alyokhin, Colorado potato beetle management on potatoes: current challenges and future prospects, Fruit, Vegetable and Cereal Science and Biotechnology 3 (2009) 10–19.

81

[30] A. Pourmirza, Local variation in susceptibility of Colorado potato beetle (Coleoptera: Chrysomelidae) to insecticide, Journal of Economic Entomology 98 (2005) 2176–2180. [31] G. Zehnder, W. Gelernter, Activity of the M-ONE formulation of a new strain of Bacillus thuringiensis against the Colorado potato beetle (Coleoptera: Chrysomelidae): relationship between susceptibility and insect life stage, Journal of Economic Entomology 82 (1989) 756–761. [32] G. Zehnder, Timing of insecticides for control of Colorado potato beetle (Coleoptera: Chrysomelidae) in eastern Virginia based on differential susceptibility of life stages, Journal of Economic Entomology 79 (1986) 851–856. [33] C. Silcox, G. Ghidium, A. Forgash, Laboratory and field evaluation of piperonyl butoxide as a pyrethroid synergist against the Colorado potato beetle (Coleoptera: Chrysomelidae), Journal of Economic Entomology 78 (1985) 1399–1405. [34] J. Clark, Insecticides as tools in probing vital receptors and enzymes in excitable membranes, Pesticide Biochemistry and Physiology 57 (1997) 235– 254. [35] J. Wierenga, R. Hollingworth, Inhibition of altered acetylcholinesterases from insecticide-resistant Colorado potato beetles (Coleoptera: Chrysomelidae), Journal of Economic Entomology 86 (1993) 673–679. [36] P. Ioannidis, E. Grafius, J. Wierenga, M. Whalon, R. Hollingworth, Selection, inheritance and characterization of carbofuran resistance in the Colorado potato beetle (Coleoptera: Chrysomelidae), Pesticide Science 35 (1992) 215– 222. [37] S. Stankovi, A. Zabel, M. Kostic, B. Manojlovic, S. Rajkovic, Colorado potato beetle [Leptinotarsa decemlineata (Say)] resistance to organophosphates and carbamates in Serbia, Journal of Pest Science 77 (2004) 11–15.