Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotarsa decemlineata (Say)

Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotarsa decemlineata (Say)

YPEST-03852; No of Pages 7 Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx Contents lists available at ScienceDirect Pesticide Biochemistry...

1MB Sizes 8 Downloads 20 Views

YPEST-03852; No of Pages 7 Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/ypest

Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotarsa decemlineata (Say) M. Malekmohammadi a,⁎, H. Galehdari b a b

Department of Plant Protection, Faculty of Agriculture, Bu Ali Sina University, Hamedan, Iran Department of Genetics, Faculty of Science, Shahid Chamran University, Ahwaz, Iran

a r t i c l e

i n f o

Article history: Received 4 March 2015 Received in revised form 14 July 2015 Accepted 15 August 2015 Available online xxxx Keywords: Colorado potato beetle AChE gene Ldace2 T-ARMS-PCR Mutation

a b s t r a c t In the present study, we demonstrated the use and optimization of the tetra-primer ARMS-PCR procedure to detect and analyze the frequency of the R30K and I392T mutations in resistant field populations of CPB. The R30K mutation was detected in 72%, 84%, 52% and 64% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively. Overall frequencies of the I392T mutation were 12%, 8% and 16% of Bahar, Aliabad and Yengijeh populations, respectively. No I392T point mutation was found among samples from Dehpiaz field population. Moreover, only 31% and 2% of samples from the resistant field populations were homozygous for R30K and I392T mutations, respectively. No individual simultaneously had both I392T and S291G/R30K point mutations. The incidence of individuals with both S291G and R30K point mutations in the samples from Bahar, Dehpiaz, Aliabad, and Yengijeh populations were 31.5%, 44.7%, 41.6%, and 27.3% respectively. Genotypes determined by the tetra-primer ARMSPCR method were consistent with those determined by PCR sequencing. There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. Polymorphism in the partial L. decemlineata cDNA AChE gene Ldace2 of four field populations was identified by direct sequencing of PCR-amplified fragments. Among 45 novel mutations detected in this study, T29P mutation was found across all four field populations that likely contribute to the AChE insensitivity. Site-directed mutagenesis and protein expression experiments are needed for a more complete evaluation. © 2015 Elsevier Inc. All rights reserved.

1. Introduction The Colorado potato beetle (CPB,1 Leptinotarsa decemlineata Say), is the major pest of potatoes in Iran and many other parts of the world. L. decemlineata, was a key quarantine pest for Iran. This pest invaded Iran in the early 1980s, probably by imported potatoes from infested areas. After its initial detection in the province of Ardabil, in 1984 [1], it gradually established in northwestern Iran. Since then, it has spread westward, where potato is produced in large areas. Currently, its distribution covers almost all principal potato-growing provinces, and continues to expand its geographic distribution to central and northeastern Iran. Geographic expansion of CPB in Iran is shown in

⁎ Corresponding author. E-mail addresses: [email protected] (M. Malekmohammadi), [email protected] (H. Galehdari). 1 Abbreviations: CPB, Colorado potato beetle; AChE, acetylcholinesterase; OPs, organophosphates; CBs, carbamates; PBO, piperonyl butoxide; DEF, S,S,Stributylphosphorotrithioate; SS, susceptible strain; T-ARMS-PCR, tetra-primer amplification refractory mutation system polymerase chain reaction; SNP, single nucleotide polymorphism; PCR, polymerase chain reaction; AZR-R, azinphosmethyl-resistant CPB strain; BERTS, carbamate-resistant CPB strain; RFLP, restriction fragment length polymorphism; SSCP; single strand conformation polymorphism; bi-PASA, bi-directional PCR amplification of specific allele; CDS, coding regions.

Fig. 1. The need to control these beetles has involved the use of different insecticides. More than 30 active ingredients are registered for use against L. decemlineata all around the world [2]. All resistance mechanisms reported in insects have been demonstrated in CPB [3–11]. There are many reports demonstrating elevated efficiency or quantity of cytochrome P450 monooxygenases, esterases, and glutathion-Stransferases in insecticide-resistant CPBs [12,13]. However, alteration of acetylcholinesterase (AChE; EC 3.1.1.7) to an insensitive form associated with increased AChE activity has been proven as an important mechanism for resistance to organophosphates (OPs) and/or carbamates (CBs) in some insect species [14–17]. Previous studies have determined OP and CB resistance in CPB [4,18–28]. The high level of resistance to azinphosmethyl (136-fold) in a nearly isogenic CPB strain (AZ-R) was due to multiple resistance mechanisms, including reduced penetration, enhanced xenobiotic metabolism, and target site-insensitivity [27,29]. Continuous use of organophosphorous (OP) insecticides over a period of many years, as the major means of control of CPB in Iran has led to a growing concern that development of resistance is occurring. In these circumstances, it is important that populations under insecticide selection pressure are monitored. To date, very little background information is available concerning either the level of resistance to OPs, or of the mechanisms that may be involved. The first study aimed at investigating the presence and distribution of insecticide resistance in Iranian

http://dx.doi.org/10.1016/j.pestbp.2015.08.002 0048-3575/© 2015 Elsevier Inc. All rights reserved.

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

2

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Fig. 1. The geographical range of Colorado potato beetle in Iran. Top six potato producer provinces: 1: Hamedan, 2: Ardabil, 3: Esfahan, 4: East Azarbaijan, 5: Kordestan, 6: Zanjan.

populations started in 2004. Mohammadi Sharif et al. [30] reported resistance to endosulfan, ranging from 18–220-fold, in field populations of CPB from East Azarbaijan province. Two synergists, piperonyl butoxide (PBO) and S,S,S- tributylphosphorotrithioate (DEF), decreased resistance 2.3 and 3.5 times in the resistant strain, respectively, indicating that metabolic detoxification has a minor contribution to resistance. Results from the biochemical assays also indicate that there is no significant difference in glutathione S-transferase activity between the susceptible and resistant strains. In a subsequent study these authors [31] have also identified a point mutation resulting in the replacement of an alanine by a serine in the Rdl gene of the Colorado potato beetle that confers resistance to endosulfan. Resistance monitoring is crucial for a rational strategy of insecticide application. Phosalone (OP) was one of the most common insecticides used for CPB control in Hamedan, Iran. There is anecdotal evidence from local farmers of a reduction in the efficacy of control of CPB by phosalone, probably due to reduced susceptibility to the insecticide. Insecticide resistant populations of CPB with insensitive acetylcholinesterase (AChE) have recently been reported from commercial potato fields of Hamedan province in western Iran [32]. Bioassays involving topical application of phosalone to fourth instars revealed up to 252fold resistance in field populations compared with the susceptible strain (SS). Synergism studies showed that although esterase and/or glutathione S-transferase metabolic pathways were present and active against phosalone, they were not selected for and did not have a major role in resistance. So, the aims of the current study were: 1) To determine relative frequency of the R30K and I392T mutations in OP-resistant field populations of the Colorado potato beetle using the tetra-primer amplification refractory mutation system polymerase chain reaction (T-ARMS-PCR) method, 2) to investigate the possibility of new

mutations that may play a role in insecticide resistance. Additional knowledge of phosalone resistance mechanisms will increase our understanding of the evolution of insecticide resistance, and could provide new clues for the management of insecticide-resistant populations. 2. Materials and methods 2.1. Insects After preliminary screening, diagnostic dose bioassay, four field populations of CPB collected from commercial potato fields of Hamedan province in western Iran (Aliabad, Bahar, Dehpiaz, and Yengijeh) with the least mortality to phosalone treatments were used for the resistant allele monitoring study. Bioassays involving topical application of phosalone to fourth instars revealed up to 252 fold resistance in field populations compared with the SS strain. These populations were part of a larger sampling study performed from 2005 to 2008 to survey the resistance to phosalone in CPB populations from different commercial potato fields in Hamedan province [32]. An insecticide susceptible CPB, originally supplied by M. S. Goettel, Agriculture and Agri-Food Canada Research Center, Lethbridge was used as the reference laboratory-reared strain. 2.2. Resistance mutation diagnostic 2.2.1. Tetra-primer ARMS-PCR method Genomic DNA was extracted from individual insects using total DNA extraction kit (DNeasy Blood and Tissue Kit, Qiagen Gmbh) following the manufacturer's instructions. The arginine to lysine substitution at position 30 (R30K) and substitution of isoleucine for threonine at

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

position 392 (I392T) in the AChE gene Ldace2, were found previously in an azinphosmethyl-resistant strain [27] and a carbamate-resistant strain of CPB [22], respectively. In the present study, we demonstrated the use and optimization of the tetra-primer ARMS-PCR procedure to detect and analyze the frequency of the R30K and I392T mutations in resistant field populations of CPB. Tetra-primer ARMS-PCR method uses four primers in a single tube, two outer primers, non-allele-specific primers, and two inner primers, allele-specific primers in the opposite direction. A deliberate mismatch was incorporated into the allelespecific primers at position − 2 or − 3 from the 3′ terminal base, to improve allele specificity [33]. The two primer pairs overlap at a SNP (single nucleotide polymorphism) position but each matches completely with only one of the possible alleles. The mutant and wild type alleles are of different sizes and can easily be distinguished in an agarose gel electrophoresis either as heterozygous or homozygous. To verify each mutation, two sets of primers were designed directly from the L. decemlineata ace cDNA sequence (GenBank Accession no. L41180.1) (Table 1, Figs. 2 and 3). To achieve the optimal annealing temperature, gradient PCR for each set of primers with DNA of a heterozygote individual was performed. After individual optimization of each pair of primers, a tetra-primer ARMS PCR was performed. For R30K mutation, tetraprimer ARMS PCR was initiated by one preliminary denaturation step at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 1 min and 72 °C for 1 min, with a final extension step of 10 min at 72 °C. Tetra-primer ARMS PCR cycling conditions for I392T mutation were as follows: an initial denaturation at 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 58 °C for 1 min, and 72 °C for 1 min followed by a final extension at 72 °C for 10 min. The PCR products were electrophoresed on 2% agarose gel in TBE buffer and stained with DNA safe stain.

2.2.2. Total RNA extraction and cDNA synthesis from individual 4th instars Fresh 4th instar larvae from four field populations of CPB (30 mg) used in the AChE assays, were ground in liquid nitrogen. To detect point mutations possibly influencing the resistance to organophosphates, total RNA was extracted from the mesothoracic, metathoracic, and abdominal homogenates from individual starved larvae using RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. Using Sensiscript RT Kit (QIAGEN), cDNA was immediately synthesized with Oligo-dT primer following the manufacturer's instructions. Based on the published nucleotide sequence information on the AChE gene (GenBank L41180.1), two primer pairs were designed to amplify specific PCR products of 1067 bp (first fragment: codons 1 through 355), and 537 bp (second fragment: codons 421 through 598) of the AChE cDNA (Table 1).

3

The reaction conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 61 °C for 2 min, and 72 °C for 45 s followed by a final extension at 72 °C for 5 min for first fragment, 94 °C for 3 min followed by 40 cycles of 94 °C for 15 s, 59 °C for 1 min, and 72 °C for 1 min and a final extension at 72 °C for 5 min for the second fragment. The cDNA amplification products were sequenced to identify the DNA variations between the susceptible strain and resistant populations. Screened were 115 beetles of susceptible strain (15 beetles) and four field populations (25 of each). 2.3. Data analysis About 20 μl of PCR products from diagnostic tests were directly sequenced in both directions. The DNA sequences were analyzed by the BLAST program of the NCBI. Alignment to the sequence of the susceptible cDNA confirmed the synonymous and nonsynonymous mutations. 3. Results 3.1. T-ARMS-PCR diagnostic test for detection of R30K and I392T point mutations In order to detect and analyze the frequency of the R30K and I392T mutations in resistant field populations of CPB, the tetra-primer ARMS-PCR protocol was chosen and successfully optimized in terms of PCR conditions including primer concentrations, annealing temperature, and reaction components. The lengths of PCR products for the G to A mutation resulting in the R30K substitution were 516 bp, 458 bp, and 101 bp. The genotype GG was detected by a specific 458 bp fragment for allele G and one 516 bp control fragment. The genotype AA was determined by the presence of a small (101 bp) and a large (516 bp) fragment, and heterozygous alleles GA by 458 bp, 101 bp, and 516 bp fragments (Fig. 4). For the T to C mutation, resulting in the I392T substitution, three fragments of 695, 568, and 108 bp were amplified. One specific fragment with size 568 bp, and one 695 bp control fragment for genotype TT, a small (180 bp) and a large (695 bp) fragment for mutant genotype CC. The heterozygous genotype TC was detected by one specific fragment for each allele T (568 bp), and C (180 bp), and one control 695 bp fragment for both alleles (Fig. 4). The R30K mutation was detected in 72%, 84%, 52% and 64% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively. Overall frequencies of the I392T mutation were 12%, 8% and 16% of Bahar, Aliabad and Yengijeh populations, respectively. No I392T point mutation was found among samples from Dehpiaz field population. Moreover, only 31% and 2% of samples from the resistant field populations were homozygous for R30K and I392T

Table 1 Primers used in this study. The expected PCR products for each pair of primers are shown in the table. Mutation/cDNA Fragment

Primers

Sequences (5′–3′)

R30K

CD30-F CD30-R S30-G CD30-R CD30-F S30-A CD392-F CD392-R CD392-F S392-C S392-T CD392-R Ldace1F Ldace1R Ldace2F Ldace2R

GCTTTCGATCCTGTGCTTGT AAGGTTGCGGTACCACTCAT CCAAGTGACGAAACTACCACAAG AAGGTTGCGGTACCACTCAT GCTTTCGATCCTGTGCTTGT AGTCTTTGAATTGCGAGGGTT GGGATTCTCGGTTTTCCTTC GTAGCTCGGGGTCCTTTACC GGGATTCTCGGTTTTCCTTC AGGGCCGTCTTTCTCGAAGAAATCGG GAACGTATTTCCTTCTATACGATTTCAT GTAGCTCGGGGTCCTTTACC ATGGGCCAGCTTTCGATCCTGTGC AGTAGCACCCCCTCGATGGTGG GTCGACTCGAACGTGACGCCATCG ACGTGTTGACACAAGGAGCTTCC

I392T

Fragment 1 Fragment 2

Product size (bp) 516

Codons 1744

458

174–23

101

36–4

695

571–341

180

400–341

568

571–384

1067 537

355–1 598–421

F: forward primer; R: reverse primer.

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

4

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Fig. 2. Schematic diagram of tetra-primer ARMS-PCR method for detection of the R30K mutation in AChE gene.

mutations, respectively (Table 2). Genotypes determined by the tetraprimer ARMS-PCR method using the two pairs of primers described in Materials and methods were consistent with those determined by PCR sequencing. This study has demonstrated that the T-ARMS-PCR assay is an effective and efficient method for assaying molecular genetic variation in CPB populations. However, there was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation.

3.2. cDNA sequence analysis Polymorphism in the partial L. decemlineata cDNA AChE gene of four field populations was identified by direct sequencing of PCR-amplified fragments (Fig. 5). Alignment of the AChE gene sequences with the sequencing results revealed 47 point mutations (V17E, P23A, E26K, T29P, R30K, R30S, R80K, P86L, P89R, W90R, G92L, L94V, A96D, Q99H, P100L, N101I, E109K, E109D, Y110K, F114P, R144K, D215Y, F250L, Q278A, S291G, P316Q, M320I, C322G, R324I, R324K, K329R, S332W, Q334H, Q334L, Q335P, N337Y, G341V, I342N, F345Y, I351T, L437R, F463S, V466G, V494L, E518D, P538L, I565F) from the field populations of CPB (Table 3).

4. Discussion 4.1. T-ARMS-PCR diagnostic test for detection of R30K and I392T point mutations Although bioassays are essential to validate the presence of resistance in populations and to quantify the levels of resistance associated with particular mechanisms, biochemical and molecular monitoring techniques enable very accurate assessments of resistance gene frequency to be made. AChEs from the field populations in our previous study [32] had relatively greater hydrolysis activities using substrates with larger alkyl substitutions and were also less sensitive to inhibition by methoxy substituted insecticides as compared to the susceptible form. Thus, AChEs elicited structure–activity relationships similar to those previously reported for the native form of AChE [27]. These results are indicative of a typical negative cross-insensitivity of AChE to different organophosphorous inhibitors. Results of the study on the threedimensional structure of AChE from Torpedo [34] revealed that S291G could alter the position of the α–E′1 helix and lead to conformational changes in both catalytic and peripheral anionic binding sites [28]. In another study, site-directed mutagenesis and baculovirus expression system have been used to determine the functional attributes of R30K, S291G, and I392T point mutations, alone and in combination, associated

Fig. 3. Schematic diagram of tetra-primer ARMS-PCR method for detection of the I392T mutation in AChE gene.

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

5

Fig. 5. Agarose gel electrophoresis of the RT-PCR products.

Fig. 4. Tetra-primer ARMS-PCR analysis to detect the presence of the R30K and I392T mutations in individual beetles representing various susceptible and resistant genotypes.

with the full-length AChE cDNA of organophosphate- and carbamateresistant Colorado potato beetles [23]. Results showed that S291G enhanced the hydrolysis of substrates with larger alkyl substitutions and decreased the sensitivity to inhibition by methoxy substituted insecticides as compared to the susceptible form. The copresence of S291G and R30K mutations increased the hydrolysis of substrates with larger alkyl substitutions and the inhibitory potential of larger inhibitors. On the other hand, I392T substitution in conjunction with S291G weakened the effects of S291G resistance mutation, resulting in substrate specificity and inhibitory properties more similar to those described for the susceptible form of AChE. With respect to the above findings, in our previous work [35], PCRRFLP assays were used to monitor the frequency of the S291G resistance mutation in resistant field populations of CPB. Only 25% of samples from the resistant field populations were homozygous for S291G mutation (Table 2). There was no significant correlation between the mutation frequencies and resistance levels in the resistant populations, indicating that other mutations may contribute to this variation. In the present study, T-ARMS-PCR assays were used to monitor the frequency of the R30K and I392T mutations in resistant field populations of CPB (Fig. 2). Sequence analysis revealed that the Arg-Lys (AGA to AAA) mutation known to be associated with the azinphosmethyl resistance was present in all populations tested at a relatively low frequency. The relative frequency of the R30K mutation in field populations of Colorado potato beetle predicted by the T-ARMS-PCR assay (72%, 84%, 52% and 64% of Bahar, Dehpiaz, Aliabad and Yengijeh populations, respectively) agreed well with that determined by individual genotyping (71.4%, 84.4%, 52.2%, and 63.1%, respectively). However, the frequency of the I392T substitution in field populations of CPB detected by the T-ARMS-PCR assay (12%, 8%, and 16% of Bahar, Aliabad and Yengijeh populations, respectively) was similar to the frequency determined by sequencing (14%, 8%, 52.2%, and 15.7%, respectively), demonstrating

the reliability and accuracy of T-ARMS-PCR method in predicting resistance allele frequency. No individual simultaneously had both I392T and S291G/R30K point mutations. The incidence of individuals with both S291G and R30K point mutations in the samples from Bahar, Dehpiaz, Aliabad, and Yengijeh populations were 31.5%, 44.7%, 41.6%, and 27.3% respectively. The T-ARMS-PCR method is technically simpler than other techniques, can be used in most laboratories and is not very expensive. This approach has proved successful in many genome screening projects [33,36–39]. Similarly, two DNA-based genotyping techniques, bidirectional PCR amplification of specific allele (bi-PASA) and single stranded conformational polymorphism (SSCP), have been previously developed for detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle [5,40,41]. Kim et al. [42] evaluated the reliability and accuracy of these two genotyping techniques to monitor resistant and susceptible allele frequencies in CPB populations. Zhang et al. [25] developed an SSCP protocol and a minisequencing reaction to validate the S291G mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle. 4.2. Sequencing results analysis However, based on the present study there was no significant correlation between the resistance mutation (R30K, I392T) frequencies and resistance levels in the field collected populations (up to 252-fold resistance), indicating that other mutations may contribute to this variation. To detect genetic variation in the partial L. decemlineata cDNA AChE gene, direct sequencing of cDNA fragments produced from RT-PCR was applied. Mutations in the first fragment, which is 1067-bp long, were detected at much higher frequency. Alignment of the AChE gene sequences with the sequencing results revealed numerous single nucleotide polymorphisms (SNP). 113 SNPs were identified in the partial L. decemlineata cDNA AChE gene Ldace2 from four field populations, in which 46 substitutions are transversion (purine base replaces a pyrimidine base and the reverse) and 67 are transition (purine base exchanges another purine base or pyrimidine base exchanges another

Table 2 Frequencies of resistance alleles in L. decemlineata from susceptible strain vs. resistant populations. Population/strain

LD50 (95% CLa)b (μg/insect)

Resistance ratiob,c

nd

S291G allelic frequenciese (heterozygote/homozygote)

nd

R30K allelic frequencies (heterozygote/homozygote)

I392T allelic frequencies (heterozygote/homozygote)

Susceptible Bahar Dehpiaz Aliabad Yengijeh

2.42 (2.1–2.7) 373.9 (345.9–398.3) 610.1 (573.9–642.5) 548.8 (522.1–578.6) 485.9 (463.1–509.3)

– 154.5 252.1 226.7 200.8

10 15 15 15 15

– 66.6 (5/5) 73.3 (4/7) 53.3 (6/2) 26.6 (3/1)

15 25 25 25 25

– 72 (10/8) 84 (8/13) 52 (8/5) 64 (11/5)

– 12 (2/1) – 8 (2/0) 16 (3/1)

a b c d e

CL, confidence interval limit. Adapted from [32]. LD50 of resistant population/LD50 of susceptible strain. Sample size. Adapted from [35].

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

6

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Table 3 Number of nucleotide differences and amino acid substitutions found in the L. decemlineata cDNA AChE gene. Strain/population

Fragment 1

Fragment 2

Nucleotide differences (silent mutation)

Point mutation

Nucleotide differences (silent mutation)

Point mutation

Susceptible Bahar

– 31 (11)

– 5 (3)

– L437R, P538L

Dehpiaz

26 (10)

8 (5)

V466G, V494L, I565F

Aliabad Yengijeh

19 (9) 17 (7)

– V17E, T29P, R30K, P86L, L94V, Q99H, N101I, E109K, E109D, F114P, Q278A, S291G, P316Q, M320I, K329R, I342N P23A, T29P, R30S, R30K, R80K, A96D, P100L, R144K, D215Y, S291G, S332W, Q334H, Q334L, N337Y, I351T E26K, T29P, R30K, W90R, Y110K, F250L, S291G, C322G, R324I, Q335P T29P, R30K, P89R, G92L, S291G, R324K, G341V, F345Y

4 (2) 3 (3)

F463S, E518D –

pyrimidine base). 50 substitutions in protein coding regions (CDS) were synonymous (silent substitution) (Table 3). Three consistent nonsilent SNPs occurred in all resistant populations, T29P, R30K, and S291G. Among 45 novel mutations, the T29P mutation was found across all four field populations that likely contribute to the AChE insensitivity. Site-directed mutagenesis and protein expression experiments are needed for a more complete evaluation. However, there was no significant correlation between the mutation frequencies and resistance levels in the field collected populations (up to 252-fold resistance), indicating that other mutations may contribute to this variation. Resistance to organophosphate and carbamate insecticides in CPB based on reduced sensitivity of AChE has been associated with point mutations (S291G, R30K, and I392T) in the acetylcholinesterase (AChE) gene Ldace2, an ortholog of Drosophila melanogaster Dmace2. Recently, Revuelta et al. [43] cloned and sequenced Ldace1, an ortholog of Anopheles gambiae Agace1. They investigated for the first time the role of Ldace1in CPB insecticide resistance. Specific interference of Ldace1 by means of dsRNA injection on susceptibility to the organophosphorous insecticide, chlorpyrifos, indicated the importance of Ldace1 as the main target for chlorpyrifos. The authors concluded that the possible presence of point mutation in Ldace1 in resistant strains should be evaluated. 5. Conclusion Our previous study has provided some basic information concerning variation of AChE activity in different populations of CPB. The biochemical analysis results showed that the sensitivity of AChE from the resistant populations was different, which means some inconsistent mutations in individual strains may also contribute to AChE insensitivity. In this study, considerable SNPs and deduced amino-acid replacements were also identified in insensitive AChE genes from resistant field populations of CPB, probably reflecting the different nature of insecticide pressures and the fitness cost associated with resistance genes. Among 45 novel mutations, the T29P mutation was found across all four field populations that likely contribute to the AChE insensitivity. Site-directed mutagenesis and protein expression experiments are needed for a more complete evaluation. Acknowledgments This work was supported by the research deputy of Bu-Ali Sina University, Hamedan, Iran (32-2073). We appreciate the anonymous reviewers for their critical review of the manuscript. References [1] G. Nouri Ganbalani, G. Colorado Potato Beetle (in Persian), University of Tabriz Publications, 1986. [2] A. Alyokhin, M. Baker, D. Mota-Sanchez, G. Dively, E. Grafius, Colorado potato beetle resistance to insecticides, Am. J. Potato Res. 85 (2008) 395–413. [3] D. Anspaugh, D.G.G. Kennedy, R.M. Roe, Purification and characterization of a resistance-associated esterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 53 (1995) 84–96.

[4] J.A. Argentine, J.M. Clark, D.N. Ferro, Relative fitness of insecticide-resistant Colorado potato beetle strains (Coleoptera, Chrysomelidae), Environ. Entomol. 18 (1989) 705–710. [5] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, A.G. Zhang, DNA-based genotyping techniques for the detection of point mutations associated with insecticide resistance in Colorado potato beetle Leptinotarsa decemlineata, Pest Manag. Sci. 57 (2001) 968–974. [6] P.M. Ioannidis, E. Grafius, M.E. Whalon, Patterns of insecticide resistance to azinphosmethyl, carbofuran, and permethrin in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 84 (1991) 1417–1423. [7] P.M. Ioannidis, E.J. Grafius, J.M. Wierenga, M.E. Whalon, R.M. Hollingworth, Selection, inheritance and characterization of carbofuran resistance in the Colorado potato beetle (Coleoptera, Chrysomelidae), Pestic. Sci. 35 (1992) 215–222. [8] S.H. Lee, J.M. Clark, Purification and characterization of multiple-charged forms of permethrin carboxylesterase(s) from the hemolymph of resistant Colorado potato beetle, Pestic. Biochem. Physiol. 60 (1998) 31–47. [9] R.L. Rose, W.A. Brindley, An evaluation of the role of oxidative enzymes in Colorado potato beetle resistance to carbamate insecticides, Pestic. Biochem. Physiol. 23 (1985) 74–84. [10] J.M. Wierenga, R.M. Hollingworth, The role of metabolic enzymes in insecticideresistant Colorado potato beetles, Pestic. Sci. 40 (1994) 259–264. [11] K.Y. Zhu, S.H. Lee, J.M. Clark, A point mutation of acetylcholinesterase associated with azinphosmethyl resistance and reduced fitness in Colorado potato beetle, Pestic. Biochem. Physiol. 55 (1996) 100–108. [12] G.C. Cutler, J.H. Tolman, C.D. Scott-Dupree, C.R. Harris, Resistance potential of Colorado potato beetle (Coleoptera: Chrysomelidae) to novaluron, J. Econ. Entomol. 98 (2005) 1685–1693. [13] J. Zhao, B.A. Bishop, E.J. Grafius, Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 93 (2000) 1508–1514. [14] D. Fournier, J.M. Bride, F. Hoffman, F. Karch, Acetylcholinesterase: two types of modifications confer resistance to insecticide, J. Biol. Chem. 267 (1992) 14270–14274. [15] H. Hama, T. Iwata, T. Miyata, T. Saito, Some properties of acetylcholinesterase partially purified from susceptible and resistant green rice leafhoppers, Nephotetix cincticeps Uhler (Hemiptera: Deltocephalidae), Appl. Entomol. Zool. 15 (1980) 249–261. [16] F.W. Plapp, R.K. Tripathi, Biochemical genetics of altered acetylcholinesterase resistance to insecticides in the housefly, Biochem. Genet. 16 (1978) 1–12. [17] K.Y. Zhu, J.R. Gao, Increased activity associated with reduced sensitivity of acetylcholinesterase in organophosphate-resistant green bug, Schizaphis graminum (Homoptera: Aphididae), Pestic. Sci. 55 (1999) 11–17. [18] J.A. Argentine, J.M. Clark, D.N. Ferro, Genetics and synergism of resistance to azinphosmethyl and permethrin in the Colorado potato beetle (Coleoptera, Chrysomelidae), J. Econ. Entomol. 82 (1989) 698–705. [19] J.A. Argentine, K.Y. Zhu, S.H. Lee, J.M. Clark, Biochemical mechanisms of azinphosmethyl resistance in isogenic strains of Colorado potato beetle, Pestic. Biochem. Physiol. 48 (1994) 63–78. [20] J.A. Argentine, S.H. Lee, M.A. Sos, S.R. Barry, J.M. Clark, Permethrin resistance in a near isogenic strain of Colorado potato beetle, Pestic. Biochem. Physiol. 53 (1995) 97–115. [21] J.M. Clark, Insecticides as tools in probing vital receptors and enzymes in excitable membranes, Pestic. Biochem. Physiol. 57 (1997) 235–254. [22] H.J. Kim, J.B. Dunn, K.S. Yoon, J.M. Clark, Target site insensitivity and mutational analysis of acetylcholinesterase from a carbofuran-resistant population of Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 84 (2006) 165–179. [23] H.J. Kim, K.S. Yoon, J.M. Clark, Functional analysis of mutations in expressed acetylcholinesterase that result in azinphosmethyl and carbofuran resistance in Colorado potato beetle, Pestic. Biochem. Physiol. 88 (2007) 181–190. [24] J.M. Wierenga, R.M. Hollingworth, Inhibition of altered acetylcholinesterase from insecticide-resistant Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 86 (1993) 673. [25] A. Zhang, J.B. Dunn, J.M. Clark, An efficient strategy for validation of a point mutation associated with acetylcholinesterase sensitivity to azinphosmethyl in Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 65 (1999) 25–35. [26] K.Y. Zhu, J.M. Clark, Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect Biochem. Mol. Biol. 25 (1995) 1129–1138.

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002

M. Malekmohammadi, H. Galehdari / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx [27] K.Y. Zhu, J.M. Clark, Comparison of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and resistant strains of Colorado potato beetle, Pestic. Biochem. Physiol. 51 (1995) 57–67. [28] K.Y. Zhu, J.M. Clark, Validation of a point mutation of acetylcholinesterase in Colorado potato beetle by polymerase chain reaction coupled to enzyme inhibition assay, Pestic. Biochem. Physiol. 57 (1997) 28–35. [29] K.Y. Zhu, J.M. Clark, Purification and characterization of acetylcholinesterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect Biochem. Mol. Biol. 24 (1994) 453–461. [30] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Resistance status of the Colorado potato beetle, Leptinotarsa decemlineata, to endosulfan in East Azarbaijan and Ardabil provinces of Iran, J. Insect Sci. 7 (2007) 1–7. [31] M. Mohammadi Sharif, M.J. Hejazi, A. Mohammadi, M.R. Rashidi, Identification of the molecular basis of resistance to endosulfan in resistant populations of Colorado potato beetle, Proceedings of 18th Iranian Plant Protection Congress 2008, p. 147. [32] M. Malekmohammadi, M.S. Mossadegh, M.J. Hejazi, M.T. Goodarzi, M. Khanjani, H. Galehdari, Synergism of resistance to phosalone and comparison of kinetic properties of acetylcholinesterase from four field populations and a susceptible strain of Colorado potato beetle, Pestic. Biochem. Physiol. 98 (2010) 254–262. [33] S. Ye, S. Dhillon, X. Ke, A. Collins, I. Day, An efficient procedure for genotyping single nucleotide polymorphisms, Nucleic Acids Res. 29 (2001) e88. [34] J.L. Sussman, M. Harel, F. Frolow, C. Oefner, A. Goldman, L. Toker, I. Silman, Atomic structure of acetylcholinesterase from Torpedo californica: a prototypic acetylcholine-binding protein, Science 253 (1991) 872–879. [35] M. Malekmohammadi, M.J. Hejazi, M.S. Mossadegh, H. Galehdari, M. Khanjani, M.T. Goodarzi, Molecular diagnostic for detecting the acetylcholinesterase mutations in

[36] [37]

[38]

[39]

[40]

[41]

[42]

[43]

7

insecticide-resistant populations of Colorado potato beetle, Leptinotarsa decemlineata (Say), Pestic. Biochem. Physiol. 104 (2012) 150–156. E. Chiapparino, D. Lee, P. Donini, Genotyping single nucleotide polymorphisms in barley by tetra-primer ARMS-PCR, Genome 47 (2004) 414–420. Q. Liu, E.C. Thorland, J.A. Heit, S.S. Sommer, Overlapping PCR for bidirectional PCR amplification of specific alleles: a rapid one-tube method for simultaneously differentiating homozygotes and heterozygotes, Genome Res. 7 (1997) 389–398. Z. Lu, H. Sun, F. Wan, J. Guo, G. Zhang, High variation in single nucleotide polymorphisms (SNPs) and insertions/deletions (Indels) in the highly invasive Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Middle East-Asia Minor 1 (MEAM1), Neotrop. Entomol. 42 (2013) 521–526. Y.G. Yang, J.Y. Kim, S.J. Park, S.W. Kimd, O.H. Jeon, D.S. Kim, Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube, J. Biotechnol. 131 (2007) 106–110. S.H. Lee, J.B. Dunn, J.M. Clark, D.M. Soderlund, Molecular analysis of kdr-like resistance in a permethrin resistant strain of Colorado potato beetle, Pestic. Biochem. Physiol. 63 (1999) 63–75. C. Coustau, R.H. Ffrench-Constant, Detection of cyclodiene insecticide resistanceassociated mutations by single stranded conformation polymorphism analysis, Pestic. Sci. 43 (1995) 267–271. H.J. Kim, D.J. Hawthorne, T. Peters, G.P. Dively, J.M. Clark, Application of DNA-based genotyping for the detection of kdr-like pyrethroid resistance in field populations of Colorado potato beetle, Pestic. Biochem. Physiol. 81 (2005) 85–96. L. Revuelta, F. Ortego, J.R. Díaz-Ruíz, P. Castañera, F. Tenllado, P. Hernández-Crespo, Contribution of Ldace1 gene to acetylcholinesterase activity in Colorado potato beetle, Insect Biochem. Mol. Biol. 41 (2011) 795–803.

Please cite this article as: M. Malekmohammadi, H. Galehdari, Target site insensitivity mutations in the AChE enzyme confer resistance to organophosphorous insecticides in Leptinotar..., Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.08.002