db mice

db mice

Biomedicine & Pharmacotherapy 118 (2019) 109389 Contents lists available at ScienceDirect Biomedicine & Pharmacotherapy journal homepage: www.elsevi...

15MB Sizes 0 Downloads 12 Views

Biomedicine & Pharmacotherapy 118 (2019) 109389

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Therapeutic potential of NaoXinTong Capsule on the developed diabetic nephropathy in db/db mice

T

Shu Yanga,b, Yuanli Chenb, Yajun Duanb, Chuanrui Mac, Lipei Liud, Qi Lid, Jie Yangd, Xiaoju Lid, ⁎⁎ Buchang Zhaoe, Yong Wange, Ke Qiane, Mengyang Liuf, Yan Zhuf, Xiaoxiao Yangb, , ⁎ Jihong Hand,b, a

Department of Endocrinology, The 2nd Clinical Medical College of Jinan University, Shenzhen People's Hospital, Shenzhen, China Department of Pharmacological Sciences, Key Laboratory of Metabolism and Regulation for Major Diseases of Anhui Higher Education Institutes, College of Food and Biological Engineering, Hefei University of Technology, Hefei, China c First Teaching Hospital of Tianjin University of Traditional Chinese Medicine, Tianjin, China d Department of Biochemistry and Molecular Biology, College of Life Science, State Key Laboratory of Medicinal Chemical Biology, Key Laboratory of Bioactive Materials of Ministry of Education, Nankai University, Tianjin, China e Buchang Pharmaceutical Co. Ltd., Xi’an, China f Tianjin University of Traditional Chinese Medicine, Tianjin, China b

ARTICLE INFO

ABSTRACT

Keywords: db/dbmice Diabetic nephropathy Glucose metabolism NaoXinTong Capsule Renal functions

The current treatment for diabetic nephropathy (DN) is still limited. NaoXinTong Capsule (NXT) is a Chinese Medicine prescribed to patients with cardiovascular disease. It can also ameliorate metabolic syndromes in patients indicating its anti-diabetic properties. Herein we report the therapeutic effects of NXT on the developed DN. The db/db diabetic mice at ˜12 weeks old, the age with DN at middle/advanced stages, were treated with NXT for 12 weeks. We found NXT treatment reduced diabetes-induced hyperglycemia and dyslipidemia, thereby substantially reduced DN progress. In the kidney, NXT reduced mesangial matrix expansion and glomerulosclerosis by inhibiting extracellular matrix accumulation through activation of matrix metalloproteinase 2/9 and inactivating transforming growth factor β1 expression. NXT reduced podocyte injury by reducing renal inflammation and expression of adhesion molecules. Mechanically, NXT potently activated AMPKα in multiple tissues thereby enhancing energy metabolism. In the liver, NXT increased glucokinase expression and insulin sensitivity by increasing insulin receptor substrate 1/2 and protein kinase B (AKT) 1/2 expression/phosphorylation. In skeletal muscle, NXT activated expression of glucose transporter type 4, AKT, glycogen synthase and peroxisome proliferator activated receptor α/γ. In adipose tissue, NXT reduced fatty acid synthase while activating hormone-sensitive lipase expression. Taken together, our study demonstrates that NXT reduced progress of the developed DN by ameliorating glucose, lipid and energy metabolism, maintaining renal structural and functional integrity. Our study also indicates the potential application of NXT for DN treatment in clinics.

Abbreviations: ACC, acetyl-CoA carboxylase; ACE, angiotensin converting enzyme; ACOX1, peroxisomal acyl-coenzyme A oxidase 1; AGE, advanced glycation endproduct; AMPKα, protein kinase AMP-activated catalytic subunit α; AGER, receptors for AGEs; AKT, protein kinase B; ALP, alkaline phosphatase; ALT, alanine transaminase; ARB, angiotensin II type 1 receptor blocker; AST, aspartate transaminase; BUN, blood urea nitrogen; CPT1, carnitine palmitoyltransferase; COL1A2, collagen type I α2; COL4A1/3, collagen type IV α1/3; CTGF, connective tissue growth factor; DN, diabetic nephropathy; ESRD, end-stage renal disease; ECM, extracellular matrix; ERK1/2, extracellular signal-regulated kinase 1 and 2; FABP4, adipocyte fatty acid binding protein; FASN, fatty acid synthase; GBM, glomerular basement membrane; GFB, glomerular filtration barrier; GCK, glucokinase; GLUT4, glucose transporter type 4; G6Pase, glucose-6-phosphatase; GS, glycogen synthase; GSK3β, glycogen synthase kinase 3β; HSL, hormone-sensitive lipase; IRS1/2, insulin receptor substrate 1/2; ICAM-1, intercellular adhesion molecule 1; IL, interleukin; LDL-C, low-density lipoprotein cholesterol; MMP, matrix metalloproteinase; MFI, mean fluorescence intensity; MI, mean intensity; NXT, NaoXinTong Capsule; PPARγ, peroxisome proliferator activated receptor γ; PCK1, phosphoenolpyruvate carboxykinase 1; ROS, reactive oxygen species; TGF-β1, transforming growth factor β1; TGFβR2, TGF-β1 receptor II; T−CHO, total cholesterol; TG, triglycerides; TNF-α, tumor necrosis factor α; UAlb, urinary albumin; UCr, urinary creatinine; VCAM-1, vascular cell adhesion molecule 1; VEGFA, vascular endothelial growth factor A; VLDL-C, very low-density lipoprotein cholesterol; WT-1, Wilm’s tumor 1 ⁎ Corresponding author at: Department of Biochemistry and Molecular Biology, College of Life Sciences, State Key Laboratory of Medicinal Chemical Biology, Key Laboratory of Bioactive Materials of Ministry of Education, Nankai University, Tianjin, China. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (X. Yang), [email protected] (J. Han). https://doi.org/10.1016/j.biopha.2019.109389 Received 11 June 2019; Received in revised form 9 August 2019; Accepted 22 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

1. Introduction

Radix et Rhizoma (Danshen), Persicae Semen (Taoren), Angelicae Sinensis Radix (Danggui), Achyranthis bidentatae Radix (Niuxi), Chuanxiong Rhizoma (Chuanxiong), Spatholobi Stem (Jixueteng), Cinnamomi Ranulus (Guizhi), Carthami Flos (Honghua) and Mori Ramulus (Sangzhi)], 2 kinds of resin medicines [Olibanum (Ruxiang) and Myrrha (Moyao)], and 3 kinds of animal medicines [Scorpio (Quanxie), Pheretima (Dilong) and Hirudo (Shuizhi)] [19]. In clinics, NXT has been demonstrated multiple cardioprotective effects, such as anti-inflammation, anti-oxidative stress, improvement of endothelial function and amelioration of lipid and glucose metabolism [19,21,22]. In addition, NXT can reduce platelet aggregation, especially in patients with one or two copies of nonfunctional cytochrome P450 2C19 (CYP2C19), who are not sensitive to the clopidogrel treatment. Co-treatment of NXT with clopidogrel to patients can increase the catalytic activities of CYP2C19 enzyme on clopidogrel in vivo, thereby demonstrating much better effect on patients than either clopidogrel or NXT alone. NXT also enhances the post stroke recovery [23–25]. In addition, the clinical observations also indicate that NXT can ameliorate hyperglycemia. In the animal study, NXT treatment before the onset of diabetes can target several diabetes related pathways, such as inflammation, oxidative stress and apoptosis, thereby preventing diabetes and its complications including DN. However, it remains unknown if NXT can demonstrate therapeutic effect on the developed diabetes or its complications, which can suggest the potential application of NXT in clinics. Therefore, in this study, we treated db/db mice at ˜12 weeks old, the age that animals have developed diabetes and complications to middle/advanced stages, with NXT to determine its therapeutic effects on DN and unveil the involved mechanisms.

Diabetes is an integrative metabolic disease caused by insulin deficiency or resistance [1]. According to the 8th edition of the Global Diabetes Map from the International Diabetes Federation in 2017, currently more than 425 million adults (20–79 years old) have diabetes worldwide with a prevalence of ˜8.8%. Diabetic nephropathy (DN) is one of the most common diabetic complications. About 20–40% of diabetic patients eventually develop DN within 15–20 years after the onset of diabetes [2]. About a half of patients with all end-stage renal disease (ESRD) is due to diabetes, and they have to be conducted the painful and costly dialysis often [3]. Pathologically, the structural and functional changes of DN can be divided into glomerular, tubulointerstitial and vascular changes. The glomerular changes are defined as mesangial expansion, basement membrane thickening, nodular glomerulosclerosis (Kimmelstiel-Wilson nodules formation), endothelial cell fenestration reduction and podocyte disruption. At molecular levels, DN pathogenesis includes alternations of hemodynamic factors (such as angiotensin II), metabolic factors [reactive oxygen species (ROS) and advanced glycation endproducts (AGEs)], cytokines [transforming growth factor β1 (TGF- β1), vascular endothelial growth factor A (VEGFA) and connective tissue growth factor (CTGF)], cell signaling and transcription molecules [mitogen-activated protein kinases (MAPKs), protein kinases B (AKT)], and inflammatory molecules [interleukin 1β (IL-1 β), IL-6 and tumor necrosis factor α (TNF-α)]. These factors or pathways overlap and interact each other to different extents, which are usually considered as results from hemodynamic and glucose-dependent pathway interactions. In addition to the damages to renal cells, such as podocytes, mesangial, tubular and endothelial cells, hyperglycemia also increases formation of AGEs and production of growth factors including TGF-β1 and angiotensin II [4,5]. Compared with healthy controls, ˜2-fold AGEs can be found in patients with ESRD [6]. Furthermore, activated receptors for AGEs (AGER) function as signaling molecules to induce inflammation through activation of inflammatory signaling pathways, such as ROS, NF-κB and MAPKs [7,8]. AGEs also enhance VEGFA expression, a protein maintaining the survival of endothelial cells and mesangial cells. Coordinately, VEGFA and TGF-β1 induce CTGF expression to enhance extracellular matrix (ECM) production, subsequent fibrosis and finally tubulointerstitial damage and glomerulosclerosis [9–11]. Current strategies for DN treatment mainly focus on blood glucose and pressure control [12]. The standard therapy recommended by the American Diabetes Association includes angiotensin converting enzyme (ACE) inhibitors or angiotensin II type 1 receptor blockers (ARBs) [13]. However, these medicines are not effective in certain normotensive diabetic patients [14]. The dual therapy of ACE inhibitor plus ARB is supposed to work better than monotherapy in proteinuria reduction. However, it may cause more and severer adverse effects including hyperkalemia which can increase risk of cardiovascular disease or even death, particularly in the elderly patients and/or patients with comorbidities [15–18]. Thus, the effective drugs or strategies with sound safety profiles are still required for DN treatment, at least in some subpopulations of DN patients. The recent efforts in developing new therapeutic strategies can be simply divided into two groups: the multifactorial treatment based (such as the simultaneous blood glucose and pressure control) and the target key factors based on the DN pathogenetic mechanisms. NaoXinTong Capsule (NXT) is a traditional Chinese medicine. It was approved by the China Food and Drug Administration (CFDA) with an approved number of 2002ZD0001 in 2002, indicating it has been used in clinics for more than 17 years. In fact, NXT is often prescribed to patients with cardiovascular diseases, such as coronary heart disease, coronary syndrome and myocardial infarction, in China [19,20]. NXT is a fine powder mixture containing 11 medicinal herbs [Astragali Radix (Huangqi), Paeoniae Radix Rubra (Chishao), Salviae miltiorrhizae

2. Materials and methods 2.1. Materials NXT was kindly provided by Xianyang Buchang Pharmaceutical Co. Ltd (Xianyang, Shanxi, China). Rabbit anti-phosphoenolpyruvate carboxykinase 1 (PCK1), glucokinase (GCK), peroxisome proliferator activated receptor γ (PPARγ), PPARα, glycogen synthase kinase 3β (GSK3β), vascular cell adhesion molecule 1 (VCAM-1), insulin receptor substrate 1 (IRS1) antibodies and HRP-conjugated affinipure goat antirabbit IgG (H + L) polyclonal antibody were purchased from Proteintech Group (Chicago, IL, USA). Goat anti-AGEs antibody was purchased from Novus Biologicals (Littleton, CO, USA). Rabbit antiAKT1, phosphorylated AKT (p-AKT), glycogen synthase (GS), phosphorylated GS (p-GS), acetyl-CoA carboxylase (ACC), phosphorylated GSK3β (p-GSK3β), extracellular signal-regulated kinase 1 and 2 (ERK1/ 2), phosphorylated ERK1/2 (p-ERK1/2), IRS2, protein kinase AMP-activated catalytic subunit α (AMPKα), phosphorylated AMPKα (pAMPKα) antibodies and mouse anti-AKT2 antibody were purchased from Cell Signaling Technology Inc (Danvers, MA, USA). The following antibodies were purchased from Santa Cruz Inc. (Dallas, TX, USA): rabbit anti-matrix metalloproteinase 2 (MMP2), glucose-6-phosphatase (G6Pase), fatty acid synthase (FASN), hormone-sensitive lipase (HSL), fibronectin, TGF-β1, TGF-β1 receptor 2 (TGFβR2) and Smad2/3 antibodies, goat anti-MMP9, collagen type I α2 (COL1A2), collagen type IV α1/3 (COL4A1/3), phosphorylated Smad2/3 (p-Smad2/3), adipocyte fatty acid binding protein (FABP4), intercellular adhesion molecule 1 (ICAM-1) and CTGF antibodies, and mouse anti-glucose transporter type 4 (GLUT4), β-actin, α-tubulin and TNF-α antibodies. Mouse insulin and microalbuminria ELISA kits were purchased from Elabscience (Wuhan, Hubei, China). TNF-α ELISA kit was purchased from Sino Biological (Beijing, China). Masson Trichrome staining assay kit was purchased from Solarbio (Beijing, China). Periodic acid-Schiff (PAS) staining assay kit was purchased from Yuanye Bio (Beijing, China).

2

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

2.2. Animals

Table 1 The sequences of primers for qRT-PCR analysis.

The in vivo study was approved by the Ethics Committee of Nankai University and conformed to the Guide for the Care and Use of Laboratory Animals published by NIH (NIH Publications No. 8023, revised 1978). Male type 2 diabetic (BKS.C g–m +/+ Leprdb/J, db/db) and C57BLKS/J wild type mice (12 weeks old) were purchased from the Animal Center of Nanjing University (Nanjing, Jiangsu, China). They were maintained at the Animal Center of Nankai University with free access to food and drinking water. Based on the clinical usage and our previous study [21,26,27], the dose of NXT used to mice was converted as 620 mg/day/kg bodyweight (mpk). C57BLKS/J wild type mice (WT) were used as the non-diabetic or normal control. The db/db mice were randomly divided into two groups (10 mice/group) and received the following treatment: Control group (Ctrl), mice were fed normal chow; NXT treatment group (NXT), mice were fed normal chow containing NXT (620 mpk). The treatment was lasted for 12 weeks.

Gene

Forward

Backward

ACOX1 AGER CTGF CPT1 IL-1β IL-6 MMP9 MMP2 TGF-β1 TGFβR2 TNF-α WT-1 β-actin

TAACTTCCTCACTCGAAGCCA CTTGCTCTATGGGGAGCTGTA GGGCCTCTTCTGCGATTTC CTCCGCCTGAGCCATGAAG GCAACTGTTCCTGAACTCAACT TAGTCCTTCCTACCCCAATTTCC CTGGACAGCCAGACACTAAAG CAAGTTCCCCGGCGATGTC CTCCCGTGGCTTCTAGTGC CCGCTGCATATCGTCCTGTG CCCTCACACTCAGATCATCTTCT GAGAGCCAGCCTACCATCC GGCTGTATTCCCCTCCATCG

AGTTCCATGACCCATCTCTGTC GGAGGATTTGAGCCACGCT ATCCAGGCAAGTGCATTGGTA ACCAGTGATGATGCCATTCT ATCTTTTGGGGTCCGTCAACT TTGGTCCTTAGCCACTCCTTC CTCGCGGCAAGTCTTCAGAG TTCTGGTCAAGGTCACCTGTC GCCTTAGTTTGGACAGGATCTG AGTGGATGGATGGTCCTATTACA GCTACGACGTGGGCTACAG GGGTCCTCGTGTTTGAAGGAA CCAGTTGGTAACAATGCCATGT

ACOX1: peroxisomal acyl-coenzyme A oxidase 1; AGER: receptor for advanced glycosylation end product; CTGF: connective tissue growth factor; CPT1: carnitine palmitoyltransferase; IL-1β/6: interleukin 1β or 6; MMP2/9: matrix metalloproteinase 2/9; TGF-β1: transforming growth factor β1; TGFβR2: TGFβ receptor 2; TNF-α: tumor necrosis factor α; WT-1: Wilm’s tumor 1.

2.3. Determination of serum glucose and insulin levels

GSK3β, p-GS, GS, AKT2, GLUT4, p-AMPKα, AMPKα, PPARγ, PPARα and β-actin in skeletal muscle were determined by Western blot [21]. Total RNA was extracted from a piece of kidney or liver followed by cDNA synthesis using a reverse transcription kit (Promega, Madison, WI, USA) and real time PCR with SYBR Green Master Mix (Bio-Rad, Los Angeles, CA, USA). The sequences of primers are listed in Table 1. The relative mRNA expression was normalized by β-actin mRNA in the corresponding sample.

During the treatment, the fasting blood glucose were determined weekly with the blood sample withdrawn from mouse tail vein using the OneTouch glucometer and test strips (LifeScan, Milpitas, CA, USA). Serum insulin levels were determined using mouse insulin ELISA kit at the end of treatment. 2.4. Determination of renal functions At the indicated time points, wild type, control db/db or NXTtreated db/db mice were transferred into metabolic chambers to collect urine samples for a 24-h duration while the animals were free to access food and drinking water. Levels of urinary albumin, nitrogen and creatinine levels were determined using the assay kits. The ratio of albumin to creatinine in urine was then calculated.

2.8. Data analysis All experiments were repeated at least 3 times, and the representative results are presented. All values are expressed as mean ± SEM. After capture, the intensity of each image was quantified by who was blinded to the treatment with the segmentation colorthreshold analysis using morphometry software (IP Laboratory, Scanalytics, Rockville, MD). The raw data were initially conducted analysis of normal distribution using Shapiro-Wilk method. ANOVA with subsequent LSD test was used to determine the significant difference in multiple comparisons (SPSS 16.0, IBM) on the data in normal distribution with P < 0.05.

2.5. HE, PAS, oil red O and Masson trichrome staining The 5-μm kidney sections were prepared and used to determine glomerular areas, carbohydrate macromolecules, lipid and collagen content by HE, PAS, oil red O and Masson trichrome staining, respectively [21]. 2.6. Determination of protein expression by immunofluorescent and immunohistochemical staining

3. Result 3.1. Improvement of glucose and lipid metabolism in the developed diabetic mice by NXT treatment

The 5-μm sections of kidney were subject to immunofluorescent or immunohistochemical staining for determination of fibronectin, AGEs, AGER, COL1A2, COL4A1/3, CTGF, ERK1/2, p-ERK1/2, MMP2, MMP9, Smad2/3, p-Smad2/3, ICAM-1, TGF-β1, TGFβR2, VCAM-1, VEGFA and WT-1 protein expression [21]. At the end of staining, slides were adequately dried and then photographed using a Leica microscope. The mean intensity (MI) or mean fluorescence intensity (MFI) of images was quantified by the segmentation color-threshold analysis using morphometry software (IP Lab, Scanalytics, Rockville, MD) and normalized by the value in control db/db mice [21].

The db/db mice can develop diabetes spontaneously after weaning. Some diabetic parameters, such as bodyweight, fasting blood glucose and urine albumin, increase quickly as they grow up. In fact, db/db mice at ˜12 weeks old can be determined the typical features of diabetes at the middle/advanced stages [28]. Therefore, the bodyweight, fasting blood glucose levels or albuminuria would be in the peaks [28–30]. To determine if NXT can slow the progression of the developed diabetes, db/db mice at ˜12 weeks old were divided into 2 groups and fed normal chow or normal chow containing NXT, while the age-matched C57BLKS/Jwild type mice were used as the non-diabetic controls. NXT treatment was lasted for another 12 weeks. During the course of treatment, bodyweight and fasting blood glucose were determined weekly and the dead animals were monitored at any time. Indeed, we found 2 of 10 db/db mice in control group died at around week 6 of the treatment (˜18 weeks old), while all the db/db mice receiving NXT treatment survived well till the end of treatment. Although the obesity is a risk factor for diabetes, associated with

2.7. Determination of protein or mRNA expression by Western blot or quantitative real-time PCR (qRT-PCR) A piece of liver, white adipose tissue or skeletal muscle was used to extract total proteins. Expression of IRS1, IRS2, AKT1, AKT2, p-AKT, PCK1, G6Pase, GCK, AMPKα, p-AMPKα, ACC, FASN, β-actin and αtubulin in the liver, FASN, HSL, FABP4, TNF-α, PPARγ, PPARα, pAMPKα, AMPKα, β-actin or α-tubulin in white adipose tissue, p-GSK3β, 3

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

progression of diabetes, the reduction of bodyweight from its peak can be determined either in patients or diabetic animals, which might be due to the severe disorders of energy metabolism resulting in reduced food intake. Meanwhile, the appropriate treatment for diabetes can correct abnormal lipid and energy metabolism which may lead to amelioration of obesity. The bodyweight in wild type mice was increased ˜10% after 12 weeks of treatment. We determined the bodyweight of control db/db mice at ˜12 weeks old (the beginning of NXT treatment) was ˜50 g, which is around the peak of bodyweight. Therefore, during the following 12 weeks of normal chow feeding, we did not observe any increase of bodyweight. In contrast, it was dropped ˜9% from the peak. Interestingly, more reduction of bodyweight was found in db/db mice receiving NXT treatment from the 3rd week of treatment, and it was reduced ˜17% at the end of 12 weeks NXT treatment (Fig. 1A). At the beginning of NXT treatment, we also determined the fasting blood glucose was close to 30 mM, indicating the fasting blood glucose reached its peak range. Compared with wild type mice, the fasting blood glucose levels in control db/db mice at the beginning of treatment was ˜5-fold of wild type mice. However, the hyperglycemia was reduced quickly after NXT treatment. At the end of experiment, it was reduced > 1/4 (Fig. 1B). NXT also reduced megalohepatia in db/db mice (Fig. 1C), indicating the protection of NXT against liver injury. At the end of NXT treatment, the increased circulating insulin levels in control db/db mice were also substantially reduced by NXT (Fig. 1D). The results of biochemical analysis in serum further confirm the protection of NXT against diabetes-induced lipid disorders and liver injury (Table 2). For instance, increased total cholesterol (T−CHO) and low-density lipoprotein cholesterol levels (LDL-C) in control db/db mice were restored to that in non-diabetic wild type mice, while very lowdensity lipoprotein cholesterol levels (VLDL-C) were substantially reduced. Activity of alanine transaminase (ALT) or aspartate transaminase (AST) was increased several folds in control db/db mice, which was also substantially reduced by NXT. Taken together, the results in Fig. 1 and Table 2 clearly demonstrate that NXT can ameliorate serum glucose and lipid metabolism in mice

Table 2 NXT treatment ameliorates serum index in db/db mice. Group

Wild type mice

db/db mice Control

T-CHO (mM) LDL-C (mM) HDL-C (mM) VLDL-C (mM) TG (mM) ALT (U/L) AST (U/L) ALP (U/L) BUN (mM) Creatinine (μM) TNF-α (pg/ml)

0.77 0.07 0.61 0.09 0.25 9.25 50.5 24.3 1.65 9.37 44.5

± ± ± ± ± ± ± ± ± ± ±

0.16 0.02 0.14 0.02 0.07 2.87 31.1 4.2 0.20 2.92 11.7

NaoXinTong *

2.29 ± 0.19 0.40 ± 0.06* 0.80 ± 0.08 1.08 ± 0.06* 0.41 ± 0.03* 35.0 ± 7.21* 259.3 ± 81.4* 23.0 ± 3.6 2.35 ± 0.39* 18.40 ± 2.74* 230.4 ± 64.9*

1.17 ± 0.18*,# 0.12 ± 0.05*,# 0.71 ± 0.13 0.34 ± 0.04*,# 0.33 ± 0.04# 18.7 ± 8.14*,# 79.5 ± 50.8# 29.5 ± 7.2 1.84 ± 0.13# 12.92 ± 1.29# 69.7 ± 15.9#

Male db/db mice (12 weeks old) randomly in two groups (10/group) received the treatment as indicated in Fig. 1. At the end of study, levels of serum T−CHO, LDL-C, HDL-C, VLDL-C, triglyceride (TG), ALT, AST, alkaline phosphatase (ALP); blood urea nitrogen (BUN) and TNF-α were determined. * p < 0.05 vs. wild type mice. # p < 0.05 vs. control db/db mice (WT or NXT group, n = 10; Ctrl group, n = 8).

having developed diabetes, suggesting the potent anti-diabetic activities of NXT. 3.2. NXT reduces DN features by improving renal functions of the developed diabetic mice In addition to hyperglycemia and dyslipidemia, db/db mice at ˜12 weeks old can be determined the typical DN features, such as increased glomerular surface area, the ratio of mesangial matrix area/glomerular area and urinary albuminuria [28], indicating the DN is at middle/ advanced stages. Indeed, as shown in Table 3, compared with wild type mice, much higher nitrogen (˜5.6-fold), albumin (˜94-fold) and ratio of albumin to creatinine (UAlb/UCr) (˜83-fold) in urine samples of control Fig. 1. NXT reduces diabetes-induced obesity, hyperglycemia and hyperinsulinemia in db/db mice. Male db/db mice (˜12 weeks old) in two groups (10/group) were fed normal chow (Ctrl group) or normal chow containing NXT (NXT group) for another 12 weeks, while the age-matched C57BLKS/J wild type (WT) mice on normal chow were used as negative controls. A, B: during the treatment, mouse bodyweight and fasting blood glucose levels were determined weekly; C, D: at the end of 12 weeks experiment, mouse liver and blood samples were collected. Liver sample was weighted and calculated the ratio of liver weight to bodyweight (%). Blood was used to prepare serum, followed by determination of serum insulin levels using an ELISA assay kit. *p < 0.05 vs. WT mice, # p < 0.05 vs. control db/db mice (WT or NXT group, n = 10; Ctrl group, n = 10 or 8).

4

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

mice (Fig. 2F). In contrast, NXT restored WT-1 expression to normal, indicating NXT protects podocytes against diabetes-caused destruction or loos. Lack of VEGFA expression can lead to thrombotic microangiopathy. However, high VEGFA expression in kidneys induces neovascularization to enhance DN development and influence functions of glomeruli [33]. Indeed, we observed induction of VEGFA expression in control db/db mouse kidney, but the induction was clearly blocked by NXT treatment (Fig. 2G). Combining the results of reduced blood urea nitrogen and creatinine (Table 2) and urinary albumin excretion (Table 3), and ameliorated structure of glomerulus and expression of related molecules (Fig. 2B-G), we can conclude that NXT can increase glomerular filtration rate in mice having developed diabetes, slower DN progression, and improve renal functions.

db/db mice were observed at the beginning of NXT treatment. Although NXT treatment had no effect on urine nitrogen levels, it reduced both urinary albumin levels and UAlb/UCr values progressively along with treatment (Table 3). For instance, the secreted albumin in control db/db mice was ˜135-fold of wild type mice, while it was reduced to ˜24-fold by NXT treatment. The ratio of albumin to creatinine in urine (UAlb/ UCr) was also reduced from ˜127-fold of wild type mice in control db/db mice to ˜30-fold in NXT-treated db/db mice. Correspondingly, at the end of treatment, blood urea nitrogen (BUN) and creatinine levels were also substantially decreased by NXT treatment (Table 2). Therefore, it is clear that NXT treatment reduces the features of developed DN, implying the improvement of renal functions. At the end of treatment, mouse kidneys were collected. Initially, we observed severe atrophied kidneys in 6 of 8 control db/db mice (middle photos, left panel of Fig. 2A; 2 of control db/db mice died at ˜week 6 of the treatment), while only 1 of 10 mice had atrophied kidneys receiving NXT treatment. Statistically, the ratio of kidney weight to bodyweight in control db/db mice was decreased moderately with no significant difference (right panel, Fig. 2A), which could be attributed to that diabetes can cause either kidney atrophy or hypernephrotrophy. NXT slightly increased the ratio of kidney weight to bodyweight. To determine the effect of NXT on the structure of glomerulus, kidney sections were conducted HE staining. Clearly, the abnormal morphology in glomeruli (top panel, Fig. 2B) with increased glomerular areas (top panel, Fig. 2C) were determined in control db/db mice, which was associated with accumulation of carbohydrate macromolecules determined by PAS staining (bottom, Fig. 2B). Therefore, the glomerulosclerosis scores were significantly increased (bottom panel, Fig. 2C). These results suggest that glomerular basement membrane (GBM) thickening, mesangial expansion, glomerular hypertrophy and glomerulosclerosis occurred to control db/db mice having the developed diabetes. However, NXT treatment mainly reversed these diabetes-induced histological DN features (Fig. 2B, C). To further confirm the inhibition of glomerulosclerosis by NXT, we determined collagen levels in the kidney by Masson Trichrome staining. As shown in Fig. 2D, diabetes reduced myofiber (red areas) while increasing collagen content (blue areas) in the kidney. However, both were corrected by NXT treatment, which further supports the antiglomerulosclerotic properties of NXT. Fibronectin, an ECM component, is an important marker for glomerulosclerosis in diabetic patients [31]. Compared with wild type mice, fibronectin expression was significantly increased in glomeruli of control db/db mice, which was dramatically reduced by NXT treatment (Fig. 2E). The key event leading to glomerulosclerosis is the destruction and/ or loss of podocytes, the highly differentiated epithelial cells forming the outermost layer (urinary side) of the glomerular filtration barrier (GFB). Wilm’s tumor 1 (WT-1) is the marker for podocytes [32]. Expression of WT-1 protein in situ or mRNA was reduced in control db/db

3.3. NXT decreases ECM accumulation by inhibiting ECM production and activating ECM degradation ECM accumulation is another important process during the DN development. It leads to mesangial expansion and glomerulosclerosis, the typical glomerular abnormities in the developed DN [34]. To determine the NXT actions on ECM in detail, we initially determined expression of both type I and type IV collagens, the markers for ECM, by immunofluorescent and immunohistochemical staining of kidney sections, with antibodies against COL1A2 and COL4A1/3, the main components of ECM. As shown in Fig. 3A, expression of COL1A2 and COL4A1/3 were potently induced in control db/db mice, but the induction was substantially reduced by NXT treatment. The ECM accumulation can be caused by increased its production and/or reduced degradation. MMP2/9 are the molecules responsible for degradation of many proteinaceous components in ECM [35]. They are also the most important proteolytic enzymes and inhibited associated with DN development [36]. As shown in Fig. 3B and C, NXT treatment significantly recovered diabetes-reduced MMP2/9 expression at both protein and mRNA levels. TGF-β1 and AGEs-AGER axis are important mediators for ECM production. In fact, activation of TGF-β1 and its downstream molecule, CTGF, can enhance ECM synthesis. As shown in Fig. 4A and B, TGF-β1 and its receptor, TGFβR2, were activated in diabetic mouse kidney, but both were substantially reduced by NXT treatment. Correspondingly, expression of Smad2/3 or p-Smad2/3 and CTGF protein or mRNA were significantly activated in control db/db mouse kidney, which were substantially decreased by NXT treatment (Fig. 4C-E). Taken together, the results in Figs. 3 and 4 suggest that reduction of ECM accumulation in diabetic mouse kidney by NXT can be attributed to both reduced ECM production and enhanced its degradation. Hyperglycemia results in production of AGEs, a critical player in the

Table 3 NXT treatment reduces urinary protein excretion in db/db mice. Time of treatment (days)

Urine nitrogen (mM) Wild type

0 15 30 45 60 75

20.4 ± 1.31 32.5 ± 2.69 28.9 ± 3.15 35.6 ± 4.06 29.7 ± 2.14 25.8 ± 2.87

Urine albumin (μg/24h)

Control (db/db) *

114.5 ± 13.3 111.7 ± 13.2* 109.9 ± 5.32* 112.9 ± 11.8* 110.7 ± 9.17* 108.1 ± 9.51*

NXT (db/db)

Wild type *

119.3 ± 13.8 128.9 ± 7.0* 133.9 ± 8.8* 130.7 ± 8.8* 125.0 ± 5.6* 134.4 ± 12.1*

UAlb/UCr (μg/μM)

Control (db/db)

2.60 ± 0.41 3.60 ± 0.25 4.16 ± 0.79 5.37 ± 0.36 3.64 ± 0.24 2.02 ± 0.71

*

245 ± 16.6 325 ± 14.1* 317 ± 17.1* 209 ± 18.2* 292 ± 14.8* 273 ± 16.4*

NXT (db/db) *

205 ± 35.5 117 ± 9.04*,# 93.0 ± 20.2*,# 71.7 ± 13.5*,# 67.6 ± 11.9*,# 47.5 ± 8.39*,#

Wild type 0.005 ± 0.002 0.007 ± 0.003 0.011 ± 0.004 0.013 ± 0.005 0.007 ± 0.002 0.005 ± 0.003

Control (db/db) *

0.415 ± 0.03 0.601 ± 0.03* 0.613 ± 0.03* 0.504 ± 0.04* 0.688 ± 0.04* 0.634 ± 0.04*

NXT (db/db) 0.360 ± 0.06* 0.198 ± 0.02*,# 0.160 ± 0.04*,# 0.164 ± 0.03*,# 0.143 ± 0.03*,# 0.152 ± 0.03*,#

During the treatment as indicated in Fig. 1, wild type, control db/db mice and db/db mice receiving NXT treatment were placed in metabolic chambers at the indicated time points to collect urine samples for a 24 h duration. Levels of nitrogen, albumin and creatinine were determined respectively, followed by calculation of the ratio of albumin to creatinine in urine (UAlb/UCr). * p < 0.05 vs. wild type mice. # p < 0.05 vs. control db/db mice [Wild type group, n = 10; Control db/db group, n = 10 (first 3 time points) or 8 (the rest time points); NXT-treated db/db group, n = 10]. 5

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

Fig. 2. NXT reduces diabetes-induced renal injury in db/db mice. A: at the end of experiment, mouse kidneys were collected, photographed and weighed for calculation of the ratio of kidney weight to bodyweight. Kidney sections were prepared and conducted HE and PAS staining (B) with quantitation of glomerular area and glomerulosclerosis scores (C); Masson Trichrome staining with quantitation of myofiber and collagen content (D); fibronectin expression by immunofluorescent staining with quantitative analysis of mean fluorescent intensity (MFI) (E); expression of WT-1 protein and mRNA by immunohistochemistry and qRT-PCR (F); and VEGFA protein expression by immunohistochemistry with quantitation of mean intensity (G). *p < 0.05 vs. WT mice, #p < 0.05 vs. control db/db mice in corresponding groups (WT or NXT group, n = 10; Ctrl group, n = 8).

pathogenesis of DN by activating TGF-β1/Smad2/3 signaling pathway and expression of pro-inflammatory cytokines, adhesion molecules and growth factors [37]. Indeed, we observed that NXT treatment attenuated increased AGEs and AGER (Fig. 5A and B) in diabetic mouse

kidney. In addition, other AGEs-activated pathogenic factors, such as adhesion molecules (VCAM-1 and ICAM-1) (Fig. 5C), and pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α (Fig. 5D), were also decreased by NXT. Activation of TGF-β1 can also enhance ERK1/2 activity 6

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

Fig. 3. NXT reduces COL1A2 and COL4A1/3 expression while increasing MMP2/9 expression in diabetic mouse kidneys. A, B: kidney sections were used to determine expression of COL1A2 and MMP9 by immunofluorescent staining or expression of COL4A1/3 and MMP2 by immunohistochemistry staining with quantitation of MFI or mean intensity (MI); C: total RNA was extracted from a piece of kidney and determined MMP2 and MMP9 mRNA expression by qRT-PCR. *p < 0.05 vs. WT mice, #p < 0.05 vs. control db/db mice (WT or NXT group, n = 10; Ctrl group, n = 8).

(p-ERK1/2) [38]. Indeed, associated with the developed diabetes, both ERK1/2 and p-ERK1/2 in mouse kidney were increased with a greater effect on p-ERK1/2. However, NXT treatment not only inhibited ERK1/ 2 expression, but also reduced ERK1/2 activity, resulting in the increased ratio of p-ERK1/2 to ERK1/2 was restored to normal (Fig. 5E).

molecular mechanisms of hyperglycemia control by NXT, we determined the effects of NXT on pathways involved in glucose homeostasis in different tissues of diabetic mice. In the liver, GCK catalyzes the first step for both glycogen synthesis and glucose glycolysis, while PCK1 and G6Pase promote gluconeogenesis. As shown in the left top panel of Fig. 6A, NXT had little effect on PCK1 or G6pase expression but significantly increased GCK expression. Therefore, NXT enhances hepatic glucose catabolism but have no effect on its generation, an important mechanism reducing glucose levels. Interestingly, reduction of glucose levels did not induce lipogenesis. In contrast, NXT may reduce lipogenesis by reducing hepatic FASN and ACC expression (left middle panel, Fig. 6A), two important molecules for hepatic lipogenesis. Meanwhile, expression of AMPKα and its activity (p-AMPKα), the sensor controlling cellular energy

3.4. NXT improves hyperglycemia by regulating homeostasis of glucose metabolism Hyperglycemia is one of the most important risk factors and targets for DN development and treatment. Treatment of mice having the developed diabetes with NXT potently reduced blood glucose levels (Fig. 1), indicating that NXT can demonstrate multiple functions to regulate homeostasis of glucose metabolism. To unveil the underlying 7

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

Fig. 4. NXT inactivates TGF-β1/Smad2/3 signal pathway in db/db mouse kidneys. Expression of TGF-β1 and TGFβR2 (A), Smad2/3 (C) or p-Smad2/3 and CTGF (C, D) were detected by immunohistochemical or immunofluorescent staining with quantitation of MI or MFI; B, E: expression of kidney TGF-β1, TGFβR2 and CTGF mRNA were detected by qRT-PCR. *p < 0.05 vs. WT mice, #p < 0.05 vs. control db/db mice (WT or NXT group, n = 10; Ctrl group, n = 8).

8

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

Fig. 5. NXT reduces expression of AGEs and adhesion molecules, and inactivates ERK1/2 pathway in diabetic mouse kidneys. A, C: expression of AGEs and ICAM-1 were determined by immunofluorescent staining; C, E: expression of VCAM-1, ERK1/2 and p-ERK1/2 were determined by immunohistochemical staining with quantitation of MFI or MI; Expression of kidney AGER (B), IL-1β, IL-6 and TNF-α mRNA (D) was determined by qRT-PCR. *p < 0.05 vs. WT mice, #p < 0.05 vs. control db/db mice (WT and NXT group: n = 10; Ctrl group: n = 8).

9

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

metabolism, were increased by NXT in the liver (left bottom panel, Fig. 6A). Enhanced expression and activity of AMPKα by NXT were also observed in white adipose tissue (right bottom panel, Fig. 6C) and skeletal muscle (right top panel, Fig. 6D). Mechanistically, we observed that the impaired insulin signaling pathway by diabetes was ameliorated by NXT, since NXT increased expression of IRS1/2, AKT1/2 and pAKT in db/db mouse liver (right panel of Fig. 6A). In addition, NXT treatment activated expression of peroxisomal acyl-coenzyme A oxidase 1 (ACOX1) and carnitine palmitoyltransferase (CPT1), the enzymes catalyzing the initial and rate-limiting steps in fatty acid β-oxidation, in the liver (Fig. 6B). White adipose tissue is the main place for energy storage as lipids with the majority as triglycerides (TG). As shown in the left panel of Fig. 6C, NXT reduced expression of FASN or FABP4 (the molecule for

lipid uptake) in adipocytes. Meanwhile, expression of HSL, the molecule responsible for TG hydrolysis, was activated by NXT treatment. TNF-α can cause inflammation and metabolic dysregulations in adipocytes [39]. We found NXT substantially reduced TNF-α expression in white adipose tissue. Although NXT slightly activated PPARα expression, it substantially induced PPARγ expression (right top panel, Fig. 6C). Activation of PPARα/γ expression was also observed in skeletal muscle (right bottom panel, Fig. 6D), indicating NXT enhances insulin sensitivity in tissues of diabetic mice. Skeletal muscle is the tissue for energy expenditure by using glucose as the source of energy which is reserved as glycogen. GLUT4 is the molecule responsive for glucose uptake by skeletal muscle, and can be activated by AKT2. As shown in the left top panel of Fig. 6D, NXT substantially increased expression of AKT2 and GLUT4. Fig. 6. NXT corrects diabetes-induced abnormal metabolic pathways in mouse tissues. Total proteins were extracted from mouse tissues. Expression of PCK1, G6Pase, GCK, FASN, ACC, p-AMPKα, AMPKα, IRS1/2, AKT1/2 and p-AKT protein in the liver (A); FASN, HSL, FABP4, TNF-α, PPARα/γ, p-AMPKα and AMPKα protein in white adipose tissue (C); AKT2, GLUT4, p-GSK3β, GSK3β, p-GS, GS, pAMPKα, AMPKα and PPARα/γ protein in skeletal muscle (D) were determined by Western blot with quantitative analysis of band density. Expression of liver CPT1 and ACOX1 mRNA were determined by qRT-PCR (B). *p < 0.05 vs. control db/db mice in the corresponding groups (n = 3).

10

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

Once glucose is taken up by skeletal muscle cells, excess glucose can be converted into glycogen by action of GS but inhibited by p-GS. Formation of p-GS is catalyzed by GSK3β but inhibited by p-GSK3β correspondingly. We observed that NXT treatment reduced GSK3β while increasing p-GSK3β expression, consequently, NXT increased GS but reduced p-GS expression (left bottom panel, Fig. 6D). Taken together, Fig. 6 demonstrates that NXT treatment to mice having developed diabetes potently ameliorated hyperglycemia by multiple functions including enhanced uptake of glucose and glycogen synthesis in skeletal muscle, reduced lipogenesis or lipid storage and increased lipolysis in liver or adipose tissue, and enhanced glycogen synthesis and fatty acid oxidation in the liver. Activation of AMPKα in multiple tissues suggest enhanced energy metabolism and insulin sensitivity.

db/db mice as they are grown up, indicating the animals develop DN spontaneously. Therefore, they can be used as a DN model to investigate the therapeutic effect of a medicine. In this study, we started NXT treatment to db/db mice at ˜12 weeks old, the age with developed DN at the middle/advanced stage, since the highest levels of nitrogen, albumin and ratio of albumin to creatinine in urine were determined (Table 3). In addition to reduction of hyperglycemia, NXT dramatically ameliorated DN parameters in urine (Table 3), which was associated with reduced serum urea nitrogen and TNF-α levels (Table 2), indicating improvement of renal functions in diabetic mice. Correspondingly, at the end of treatment, we observed that NXT reduced glomerulosclerosis by maintaining the integrity of glomerular structure and decreasing collagen content in kidneys (Fig. 2). The protection of NXT against DN was related to activation of MMP2/9 (Fig. 3) and inactivation of TGF-β1 pathway and expression of adhesion molecules in the kidney (Figs. 4 and 5), which are further related to improvement of glucose, lipid and energy metabolism and insulin sensitivity in different tissues, particularly in the liver (Fig. 6), by NXT. Currently, metformin and liraglutide are wildly used as anti-obesity/diabetes agents in clinic. They are able to activate AMPKα, the energy-sensing kinase which stimulates catabolic processes. Numerous studies have demonstrated that activation of AMPKα can also enhance glycolytic flux, glucose transport, fatty acid oxidation, and induction of antioxidant enzyme expression. All of these actions make contributions to enhance glucose, lipid and energy metabolism [50]. Similarly, in this study, we observed that NXT substantially activated AMPKα in liver, adipose tissue and skeletal muscle (Fig. 6), suggesting the anti-DN effects of NXT should also be completed partially through activation of AMPKα-mediated glucose and energy metabolism. Inflammation is implicated in the initiation and progress of diabetes and contributes to DN [51–53]. Associated with onset or development of diabetes, production of several potent proinflammatory cytokines, such as TNF-α, IL-1β and IL-6, is clearly activated. Therefore, the effects of anti-inflammation on diabetes have been intensively investigated. Indeed, several clinical trials using either small molecules or monoclonal antibodies to reduce production of pro-inflammatory cytokines, such as TNF-α and IL-1β, have been completed. Although the outcomes of these studies show that inhibition of inflammation can improve insulin sensitivity, β-cell function and glucose control, the metabolic effects of these treatments are modest [54]. Therefore, the combined therapy using glucose control and anti-inflammation reagents could benefit patients more than the monotherapy. In our study, we observed that NXT treatment not only decreased fasting blood glucose and insulin levels, but also reduced expression of IL-1β, IL-6 and TNF-α in diabetic mouse kidney (Fig. 5D) and TNF-α in white adipose tissue (Fig. 6C) and serum (Table 2), suggesting multiple anti-diabetic functions of NXT. TGF-β1 promotes cell hypertrophy and ECM accumulation in the mesangium to reduce glomerular filtration rate [55,56]. It also enhances urinary albumin excretion by increasing glomerular permeability and decreasing reabsorption in the proximal tubules. In spite of the pathological role of TGF-β1 in DN, the globally low expression of TGF-β1 causes primary aldosteronism [57], which could be deleterious in diabetic patients. Thus, kidney specific reduction of TGF-β1 expression may reduce DN features while having no effect on other tissues. In both experimental DN models and patients, Smad2/3 is highly activated by TGFβ1, high glucose and AGEs [58]. Reciprocally, disruption of Smad2/3 protects DN by decreasing expression of CTGF and VEGF and progressive renal fibrosis. In our study, although we are not able to determine if inhibition of TGF-β1 by NXT is kidney specific, we observed minor effect of NXT on TGF-β1 expression in the liver (data not shown). More importantly, we clearly demonstrate the reduction of TGF-β1 and TGFβR2 expression by NXT in the kidney (Fig. 4A, B), and the consequence of inhibition TGF-β1 signaling, such as reduction of Smad2/3 and ERK1/2 phosphorylation, CTGF and other TGF-β1-targeted molecules (Figs. 4 and 5). Functionally, the fibrosis features of DN

4. Discussion In current study, we used db/db mice at the age of ˜12 weeks old as the developed diabetic model to determine if NXT treatment can demonstrate its therapeutic potential on DN. Due to the nature of db/db mice, the animals have onset of diabetes soon after weaning, and the diabetes further develops to middle/advanced stages when the animals are at ˜12 weeks old. Therefore, the typical DN features, such as high secreted albumin and ratio of albumin to creatinine in urine, can be observed at this age. However, when ˜12 weeks old db/db mice were started NXT treatment for 2 weeks, secreted albumin and ratio of albumin to creatinine were substantially reduced (Table 3). Other DN features, such as kidney atrophy or hypernephrotrophy, mesangial matrix expansion and glomerulosclerosis, were also significantly reduced by NXT treatment (Fig. 2–5). Considering other diabetic features, such as hyperglycemia, were also reduced (Fig. 1), even sooner than amelioration of DN features, we anticipate that the anti-DN properties of NXT should be attributed to, at least in part, the anti-diabetic activities of NXT. In fact, in addition to kidneys, we found NXT demonstrated its potent anti-diabetic functions in other tissues. As shown in Fig. 6, NXT enhanced insulin sensitivity, ameliorated glucose, lipid and energy metabolism in mouse liver, adipose tissue and skeletal muscle by regulating different insulin-related signaling pathways. Similar to other traditional Chinese medicines, NXT is also a mixture of several natural herbs. So far, more than 200 bioactive compounds in NXT have been identified. Among these molecules, amygdalin, paeoniflorin, salvianolic acid B and hydroxysafflor yellow A contained in NXT have been demonstrated biological functions on kidneys directly in both in vivo and in vitro studies. For instance, amygdalin inhibits renal fibrosis in chronic kidney disease by inhibiting renal interstitial fibroblasts proliferation and TGF‑β1 expression [40]. Paeoniflorin ameliorates renal injury by inhibiting inflammatory responses, renal cell apoptosis and autophagy [41–43]. Salvianolic acid B and hydroxysafflor yellow A can protect kidneys from injury by regulating cell apoptosis and inflammatory cytokines [44–46]. Therefore, the protection of NXT against DN might be completed through its direct functions on kidneys or indirect effects due to its anti-diabetic activities. NXT has been demonstrated multiple protective effects on cardiovascular diseases including atherosclerosis, coronary artery disease, acute coronary syndrome, coronary microembolization, myocardial infarction, ischemic stroke and ischemia-reperfusion injury [19,47,48]. The clinical observations also indicate the potent protection of NXT against hyperglycemia and dyslipidemia, suggesting its benefits for diabetic patients. In animal model, NXT treatment before onset of diabetes can prevent the development of diabetic retinopathy and nephropathy in db/db mice [21,26], further suggesting the anti-diabetic properties of NXT. DN is a major ESRD in many countries, and a major cause of morbidity and a key determinant of mortality in diabetic patients [12,49]. Hypertension, hyperglycemia and dyslipidemia are the main risk factors for DN. Increased urinary albumin excretion can be determined in 11

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al.

was substantially reduced by NXT (Fig. 2D). Considering the nature of NXT, a traditional medicine, we believe a few limitations, which are still needed to resolve by the further investigations. For instance, identification of the major herbal or animal medicine(s) in NXT would benefit to generate another prescribed Chinese medicine with better therapeutic effects for diabetes and DN treatment. Isolation and identification the major molecule(s) in NXT or its herbal medicine(s) are also important to understand the mechanisms by which NXT or its active component(s) reduces diabetes or DN.

[11] B. Rooney, H. O’Donovan, A. Gaffney, M. Browne, N. Faherty, S.P. Curran, D. Sadlier, C. Godson, D.P. Brazil, J. Crean, CTGF/CCN2 activates canonical Wnt signalling in mesangial cells through LRP6: implications for the pathogenesis of diabetic nephropathy, FEBS Lett. 585 (2011) 531–538. [12] D. Fineberg, K.A. Jandeleit-Dahm, M.E. Cooper, Diabetic nephropathy: diagnosis and treatment, Nat. Rev. Endocrinol. 9 (2013) 713–723. [13] American Diabetes Association, 10. Microvascular complications and foot care: standards of medical care in diabetes - 2018, Diabetes Care 41 (2018) S105–S118. [14] M. Mauer, B. Zinman, R. Gardiner, S. Suissa, A. Sinaiko, T. Strand, K. Drummond, S. Donnelly, P. Goodyer, M.C. Gubler, R. Klein, Renal and retinal effects of enalapril and losartan in type 1 diabetes, N. Engl. J. Med. 361 (2009) 40–51. [15] H.H. Parving, B.M. Brenner, J.J. McMurray, D. de Zeeuw, S.M. Haffner, S.D. Solomon, N. Chaturvedi, F. Persson, A.S. Desai, M. Nicolaides, A. Richard, Z. Xiang, P. Brunel, M.A. Pfeffer, A. Investigators, Cardiorenal end points in a trial of aliskiren for type 2 diabetes, N. Engl. J. Med. 367 (2012) 2204–2213. [16] L.F. Fried, N. Emanuele, J.H. Zhang, M. Brophy, T.A. Conner, W. Duckworth, D.J. Leehey, P.A. McCullough, T. O’Connor, P.M. Palevsky, R.F. Reilly, S.L. Seliger, S.R. Warren, S. Watnick, P. Peduzzi, P. Guarino, V.N.-D. Investigators, Combined angiotensin inhibition for the treatment of diabetic nephropathy, N. Engl. J. Med. 369 (2013) 1892–1903. [17] G. Bandak, Y. Sang, A. Gasparini, A.R. Chang, S.H. Ballew, M. Evans, J. Arnlov, L.H. Lund, L.A. Inker, J. Coresh, J.J. Carrero, M.E. Grams, Hyperkalemia after initiating renin-angiotensin system blockade: the stockholm creatinine measurements (scream) project, J. Am. Heart Assoc. 6 (2017). [18] A.S. Group, W.C. Cushman, G.W. Evans, R.P. Byington, D.C. Goff Jr., R.H. Grimm Jr., J.A. Cutler, D.G. Simons-Morton, J.N. Basile, M.A. Corson, J.L. Probstfield, L. Katz, K.A. Peterson, W.T. Friedewald, J.B. Buse, J.T. Bigger, H.C. Gerstein, F. Ismail-Beigi, Effects of intensive blood-pressure control in type 2 diabetes mellitus, N. Engl. J. Med. 362 (2010) 1575–1585. [19] J. Han, H. Tan, Y. Duan, Y. Chen, Y. Zhu, B. Zhao, Y. Wang, X. Yang, The cardioprotective properties and the involved mechanisms of NaoXinTong Capsule, Pharmacol. Res. 141 (2019) 409–417. [20] Y. Lv, Y. Pan, Y. Gao, J. Lu, Y. Li, J. Bai, J. Zhai, Effect of Danhong injection combined with Naoxintong tablets on prognosis and inflammatory factor expression in acute coronary syndrome patients undergoing percutaneous coronary intervention, Acta Cardiol. Sin. 31 (2015) 301–307. [21] S. Yang, M. Liu, Y. Chen, C. Ma, L. Liu, B. Zhao, Y. Wang, X. Li, Y. Zhu, X. Gao, D. Kong, Y. Duan, J. Han, X. Yang, NaoXinTong Capsules inhibit the development of diabetic nephropathy in db/db mice, Sci. Rep. 8 (2018) 9158. [22] J. Wan, H. Wan, R. Yang, H. Wan, J. Yang, Y. He, H. Zhou, Protective effect of Danhong Injection combined with Naoxintong Capsule on cerebral ischemia-reperfusion injury in rats, J. Ethnopharmacol. 211 (2018) 348–357. [23] H. Chen, G. Yu, H. Sun, X. Wu, H. Wang, Comparison of adjunctive Naoxintong versus clopidogrel in volunteers with the CYP2C19*2 gene mutation accompanied with Qi deficiency and blood stasis constitution, Evid. Based. Complement. Alternat. Med. 2011 (2011) 207034. [24] H. Chen, Y. Zhang, X. Wu, C. Li, H. Wang, In vitro assessment of cytochrome P450 2C19 potential of Naoxintong, Evid. Complement. Alternat. Med. 2012 (2012) 430262. [25] S. Han, Z. Hong, Y. Xie, Y. Zhao, X. Xu, Therapeutic effect of Chinese herbal medicines for post stroke recovery: a traditional and network meta-analysis, Medicine 96 (2017). [26] M. Liu, Q. Pan, Y. Chen, X. Yang, B. Zhao, L. Jia, Y. Zhu, J. Han, X. Li, Y. Duan, NaoXinTong inhibits the development of diabetic retinopathy in db/db mice, Evid. Based. Complement. Alternat. Med. 2015 (2015) 242517. [27] Q. Li, Y. Chen, D. Zhao, Z. Wei, S. Zhang, Y. Chen, Y. Wang, K. Qian, B. Zhao, Y. Zhu, X. Gao, P. Dong, X. Li, Y. Duan, J. Han, X. Yang, NaoXinTong Capsule inhibits carrageenan-induced thrombosis in mice, J. Cardiovasc. Pharmacol. 72 (2018) 49–59. [28] K. Sharma, P. McCue, S.R. Dunn, Diabetic kidney disease in the db/db mouse, Am. J. Physiol. Renal Physiol. 284 (2003) F1138–1144. [29] M. Liu, Q. Pan, Y. Chen, X. Yang, B. Zhao, L. Jia, Y. Zhu, B. Zhang, X. Gao, X. Li, J. Han, Y. Duan, Administration of Danhong Injection to diabetic db/db mice inhibits the development of diabetic retinopathy and nephropathy, Sci. Rep. 5 (2015) 11219. [30] S.M. Lee, G. Tutwiler, R. Bressler, C.H. Kircher, Metabolic control of prevention of nephropathy by 2-tetradecylglycidate in the diabetic mouse (db/db), Diabetes 31 (1982) 12–18. [31] S. Ikeda, H. Makino, T. Haramoto, K. Shikata, I. Kumagai, Z. Ota, Changes in glomerular extracellular matrices components in diabetic nephropathy, J. Diabet. Complications 5 (1991) 186–188. [32] J. Su, S. Li, Z. Chen, C. Zeng, H. Zhou, L. Li, Z. Liu, Evaluation of podocyte lesion in patients with diabetic nephropathy: wilms’ tumor-1 protein used as a podocyte marker, Diabetes Res. Clin. Pract. 87 (2010) 167–175. [33] V. Eremina, M. Sood, J. Haigh, A. Nagy, G. Lajoie, N. Ferrara, H.P. Gerber, Y. Kikkawa, J.H. Miner, S.E. Quaggin, Glomerular-specific alterations of VEGF-A expression lead to distinct congenital and acquired renal diseases, J. Clin. Invest. 111 (2003) 707–716. [34] R.M. Mason, N.A. Wahab, Extracellular matrix metabolism in diabetic nephropathy, J. Am. Soc. Nephrol. 14 (2003) 1358–1373. [35] X. Xu, L. Xiao, P. Xiao, S. Yang, G. Chen, F. Liu, Y.S. Kanwar, L. Sun, A glimpse of matrix metalloproteinases in diabetic nephropathy, Curr. Med. Chem. 21 (2014) 3244–3260. [36] S.V. McLennan, D.J. Kelly, A.J. Cox, Z. Cao, J.G. Lyons, D.K. Yue, R.E. Gilbert, Decreased matrix degradation in diabetic nephropathy: effects of ACE inhibition on the expression and activities of matrix metalloproteinases, Diabetologia 45 (2002)

5. Conclusions In this study, we used ˜12 weeks old db/db mice as the developed DN model to demonstrate therapeutic effects of NXT. In addition to amelioration of blood and urinary DN parameters, NXT clearly reduced various features of DN in kidneys. More importantly, we unveiled some mechanisms by which NXT reduced the developed diabetes and DN. Our study suggests the potential application of NXT for treatment of patients with diabetes and its complications, at least as an alternative or complementary approach. Author contributions SY, YC, YD, CM, LL, QL, JY, BZ, YW and KQ, XL, ML and YZ performed, analyzed and interpreted studies data; JH and XY designed, analyzed and interpreted experimental data, and contributed to writing the manuscript and study supervision. Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the International Science & Technology Cooperation Program of China2017YFE0110100 to J Han, Y Duan, X Yang and Y Chen; the National Natural Science Foundation of China (NSFC) Grants 81773727 and 81973316 to J Han, 81803517 to X Yang, 81722046 to Y Duan and 31770863 to Y Chen; and the Fundamental Research Funds for the Central Universities to X Yang, Y Duan, and Y Chen. References [1] A.M. Johnson, J.M. Olefsky, The origins and drivers of insulin resistance, Cell 152 (2013) 673–684. [2] G. Remuzzi, A. Schieppati, P. Ruggenenti, Clinical practice. Nephropathy in patients with type 2 diabetes, N. Engl. J. Med. 346 (2002) 1145–1151. [3] C.A. Jones, A.S. Krolewski, J. Rogus, J.L. Xue, A. Collins, J.H. Warram, Epidemic of end-stage renal disease in people with diabetes in the United States population: do we know the cause? Kidney Int. 67 (2005) 1684–1691. [4] M. Kato, R. Natarajan, MicroRNAs in diabetic nephropathy: functions, biomarkers, and therapeutic targets, Ann. N. Y. Acad. Sci. 1353 (2015) 72–88. [5] M. Kato, R. Natarajan, Diabetic nephropathy–emerging epigenetic mechanisms, Nat. Rev. Nephrol. 10 (2014) 517–530. [6] Z. Makita, S. Radoff, E.J. Rayfield, Z. Yang, E. Skolnik, V. Delaney, E.A. Friedman, A. Cerami, H. Vlassara, Advanced glycosylation end products in patients with diabetic nephropathy, N. Engl. J. Med. 325 (1991) 836–842. [7] T. Wendt, L. Bucciarelli, W. Qu, Y. Lu, S.F. Yan, D.M. Stern, A.M. Schmidt, Receptor for advanced glycation endproducts (RAGE) and vascular inflammation: insights into the pathogenesis of macrovascular complications in diabetes, Curr. Atheroscler. Rep. 4 (2002) 228–237. [8] S. Yamagishi, T. Matsui, Advanced glycation end products, oxidative stress and diabetic nephropathy, Oxid. Med. Cell. Longev. 3 (2010) 101–108. [9] S. Yamagishi, Y. Inagaki, T. Okamoto, S. Amano, K. Koga, M. Takeuchi, Z. Makita, Advanced glycation end product-induced apoptosis and overexpression of vascular endothelial growth factor and monocyte chemoattractant protein-1 in human-cultured mesangial cells, J. Biol. Chem. 277 (2002) 20309–20315. [10] M.C. Iglesias-de la Cruz, F.N. Ziyadeh, M. Isono, M. Kouahou, D.C. Han, R. Kalluri, P. Mundel, S. Chen, Effects of high glucose and TGF-beta1 on the expression of collagen IV and vascular endothelial growth factor in mouse podocytes, Kidney Int. 62 (2002) 901–913.

12

Biomedicine & Pharmacotherapy 118 (2019) 109389

S. Yang, et al. 268–275. [37] K. Fukami, S. Yamagishi, S. Ueda, S. Okuda, Role of AGEs in diabetic nephropathy, Curr. Pharm. Des. 14 (2008) 946–952. [38] J. Han, D.P. Hajjar, J.M. Tauras, J. Feng, A.M. Gotto Jr., A.C. Nicholson, Transforming growth factor-beta1 (TGF-beta1) and TGF-beta2 decrease expression of CD36, the type B scavenger receptor, through mitogen-activated protein kinase phosphorylation of peroxisome proliferator-activated receptor-gamma, J. Biol. Chem. 275 (2000) 1241–1246. [39] W.P. Cawthorn, J.K. Sethi, TNF-alpha and adipocyte biology, FEBS Lett. 582 (2008) 117–131. [40] J. Guo, W. Wu, M. Sheng, S. Yang, J. Tan, Amygdalin inhibits renal fibrosis in chronic kidney disease, Mol. Med. Rep. 7 (2013) 1453–1457. [41] J. Chen, D. Zhao, M. Zhu, M. Zhang, X. Hou, W. Ding, S. Sun, W. Bu, L. Feng, S. Ma, X. Jia, Paeoniflorin ameliorates AGEs-induced mesangial cell injury through inhibiting RAGE/mTOR/autophagy pathway, Biomed. Pharmacother. 89 (2017) 1362–1369. [42] Q. Liu, X. Lin, H. Li, J. Yuan, Y. Peng, L. Dong, S. Dai, Paeoniflorin ameliorates renal function in cyclophosphamide-induced mice via AMPK suppressed inflammation and apoptosis, Biomed. Pharmacother. 84 (2016) 1899–1905. [43] P. Wang, W. Wang, Q. Shi, L. Zhao, F. Mei, C. Li, T. Zuo, X. He, Paeoniflorin ameliorates acute necrotizing pancreatitis and pancreatitisinduced acute renal injury, Mol. Med. Rep. 14 (2016) 1123–1131. [44] J. Bai, J. Zhao, D. Cui, F. Wang, Y. Song, L. Cheng, K. Gao, J. Wang, L. Li, S. Li, Y. Jia, A. Wen, Protective effect of hydroxysafflor yellow A against acute kidney injury via the TLR4/NF-kappa B signaling pathway, Sci. Rep. 8 (2018) 9173. [45] N. Hu, J. Duan, H. Li, Y. Wang, F. Wang, J. Chu, J. Sun, M. Liu, C. Wang, C. Lu, A. Wen, Hydroxysafflor yellow A ameliorates renal fibrosis by suppressing TGFbeta1-induced epithelial-to-mesenchymal transition, PLoS One 11 (2016) e0153409. [46] J. Li, C. Zhang, W. He, H. Qiao, J. Chen, K. Wang, D. Oupicky, M. Sun, Coordination-driven assembly of catechol-modified chitosan for the kidney-specific delivery of salvianolic acid B to treat renal fibrosis, Biomater. Sci. 6 (2017) 179–188. [47] Y. Wang, X. Yan, S. Mi, Z. Li, Y. Wang, H. Zhu, X. Sun, B. Zhao, C. Zhao, Y. Zou,

[48] [49] [50] [51] [52] [53] [54] [55]

[56] [57]

[58]

13

K. Hu, X. Ding, A. Sun, J. Ge, Naoxintong attenuates Ischaemia/reperfusion Injury through inhibiting NLRP3 inflammasome activation, J. Cell. Mol. Med. 21 (2017) 4–12. H. Wang, L. Qiu, Y. Ma, L. Zhang, L. Chen, C. Li, X. Geng, X. You, X. Gao, Naoxintong inhibits myocardial infarction injury by VEGF/eNOS signaling-mediated neovascularization, J. Ethnopharmacol. 209 (2017) 13–23. A. Lim, Diabetic nephropathy - complications and treatment, Int. J. Nephrol. Renovasc. Dis. 7 (2014) 361–381. M.M. Mihaylova, R.J. Shaw, The AMPK signalling pathway coordinates cell growth, autophagy and metabolism, Nat. Cell Biol. 13 (2011) 1016–1023. J. Wada, H. Makino, Innate immunity in diabetes and diabetic nephropathy, Nat. Rev. Nephrol. 12 (2016) 13–26. M.Y. Donath, S.E. Shoelson, Type 2 diabetes as an inflammatory disease, Nat. Rev. Immunol. 11 (2011) 98–107. M.Y. Donath, E. Dalmas, N.S. Sauter, M. Boni-Schnetzler, Inflammation in obesity and diabetes: islet dysfunction and therapeutic opportunity, Cell Metab. 17 (2013) 860–872. N. Esser, N. Paquot, A.J. Scheen, Anti-inflammatory agents to treat or prevent type 2 diabetes, metabolic syndrome and cardiovascular disease, Expert Opin. Investig. Drugs 24 (2015) 283–307. C.K. Hathaway, A.M. Gasim, R. Grant, A.S. Chang, H.S. Kim, V.J. Madden, C.R. Bagnell Jr., J.C. Jennette, O. Smithies, M. Kakoki, Low TGFbeta1 expression prevents and high expression exacerbates diabetic nephropathy in mice, Proc. Natl. Acad. Sci. U. S. A. 112 (2015) 5815–5820. J.A. Douthwaite, T.S. Johnson, J.L. Haylor, P. Watson, A.M. El Nahas, Effects of transforming growth factor-beta1 on renal extracellular matrix components and their regulating proteins, J. Am. Soc. Nephrol. 10 (1999) 2109–2119. M. Kakoki, O.M. Pochynyuk, C.M. Hathaway, H. Tomita, J.R. Hagaman, H.S. Kim, O.L. Zaika, M. Mamenko, Y. Kayashima, K. Matsuki, S. Hiller, F. Li, L. Xu, R. Grant, A.M. Bertorello, O. Smithies, Primary aldosteronism and impaired natriuresis in mice underexpressing TGFbeta1, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 5600–5605. J. Massague, D. Wotton, Transcriptional control by the TGF-beta/Smad signaling system, EMBO J. 19 (2000) 1745–1754.