Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica of farm fly origin to susceptible Escherichia coli and Salmonella strains

Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica of farm fly origin to susceptible Escherichia coli and Salmonella strains

Journal Pre-proof Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica of farm fly origin to susceptible Escheri...

1MB Sizes 0 Downloads 11 Views

Journal Pre-proof Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica of farm fly origin to susceptible Escherichia coli and Salmonella strains Yumin Xu, Jinru Chen PII:

S0023-6438(20)30001-3

DOI:

https://doi.org/10.1016/j.lwt.2020.109013

Reference:

YFSTL 109013

To appear in:

LWT - Food Science and Technology

Received Date: 11 October 2019 Revised Date:

20 December 2019

Accepted Date: 2 January 2020

Please cite this article as: Xu, Y., Chen, J., Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica of farm fly origin to susceptible Escherichia coli and Salmonella strains, LWT - Food Science and Technology (2020), doi: https://doi.org/10.1016/j.lwt.2020.109013. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Ltd.

Credit author statement – LWT-D-19-04141 Jinru Chen: Conceptualization, Methodology, Writing – Reviewing and editing Yumin Xu: Data collection and analysis, Writing – original draft preparation

1

1

2

Transfer of class 1 integron-mediated antibiotic resistance genes from Salmonella enterica

3

of farm fly origin to susceptible Escherichia coli and Salmonella strains

4

Yumin Xu and Jinru Chen *

5

6

7

Department of Food Science and Technology, The University of Georgia, 1109 Experiment

8

Street, Griffin, Georgia 30223-1797, USA

9

10

11

*

12

Email address: [email protected]

13

14

15

16

17

18

19 20

Corresponding author.

2

21

ABSTRACT

22

Integrons in Salmonella are critical genetic elements with antibiotic resistance genes that could

23

be disseminated through horizontal gene transfer, imposing risks to public health. This study

24

was undertaken to determine the structure of integrons in Salmonella isolated from flies on cattle

25

farms and examine the transferability of the integrons through conjugation. Results showed that

26

2 out of 606 isolated Salmonella, 438 and 442, harbored class 1 integrons. Integron gene

27

cassette in Salmonella 438 carried a single gene of aadA7, and Salmonella 442, drfA12-orfF-

28

aadA2. The two integrons were transferrable through conjugation on microbiological media to a

29

Salmonella strain isolated from fly and to E. coli C600 at efficiencies ranging from 1.47 × 10-6 to

30

6.29 × 10-4. However, only Salmonella 442 was able to transfer its integron to the recipient cells

31

in/on 3 out of 8 farm samples, with conjugation efficiencies ranging from 4.26 × 10-10 to 1.36 ×

32

10-8. Antibiotic resistance genes not carried by integrons, e.g. genes encoding resistance to

33

tetracycline and chloramphenicol, were co-transferred with integron-mediated antibiotic

34

resistance genes. The data suggests that some Salmonella isolated from flies of cattle source

35

carry integrons which could disseminate antibiotic resistance genes through horizontal gene

36

transfer in the farm environment.

37 38

Keywords: antibiotic resistance, conjugation, fly, integron, Salmonella

3

39

1. Introduction

40 41

Salmonella enterica are etiological agents for a large number of foodborne outbreaks in

42

the United States (CDC, 2016a). Salmonella isolates that are responsible for the outbreaks have

43

sometimes been traced to the farm environment, including cattle farms (CDC, 2016b). Extensive

44

use of antibiotics in veterinary medicine and as growth promoter during animal production is

45

speculated as one of the contributing factors to the development of antibiotic resistant strains in

46

the farm environment (Hur, Kim, Park, Lee, & Lee, 2011). Antibiotic residue in cattle might

47

present a selective pressure during the invasion of Salmonella into hosts, because only isolates

48

that have acquired antibiotic resistance are able to survive and proliferate.

49

Horizontal gene transfer is a general approach of acquiring genes encoding antibiotic

50

resistance by bacteria, and conjugation is a common process of antibiotic resistance gene

51

exchange among living organisms (Schwarz, Cloeckaert, & Roberts, 2006). The efficiency of

52

bacterial conjugation depends on the characteristics of transmissible plasmids and the

53

compatibility of the plasmids in donor and recipient cells (Thomas & Nielsen, 2005). Other

54

factors, including environmental temperature and pH, as well as the ratio and density of donor

55

and recipient cells involved, may also affect the efficiency of gene transfer (Al-Masaudi, Russell,

56

& Day, 1991).

57

One of the DNA elements that carry antibiotic resistance genes is integron. The

58

integrons by themselves are not mobile, but they are transferrable via transposons or conjugative

59

plasmids. An integron has a 5’-conserved segment (5’-CS) (including integrase gene intI, attI

60

recombination site and promoters), 3’-CS (including qacE∆1 gene and sul1 gene), and variable

61

gene cassette array in the center of the integron, often encoding antibiotic resistance (Hall &

4

62

Collis, 1995). Integrons are categorized into three classes, and Salmonella are often found to

63

carry class 1 integrons (Antunes, Machado, & Peixe, 2006; Krauland, Marsh, Paterson, &

64

Harrison, 2009). Class 1 integrons are frequently associated with Tn21 and Tn21-related

65

transposons that are generally located on conjugative plasmids (Fluit & Schmitz, 2004).

66

Several studies have identified integrons in Salmonella isolated from cattle farms

67

(Ahmed, Ishida, & Shimamoto, 2009; Antunes et al., 2006; Tabe, Oloya, Doetkott, & Khaitsa,

68

2010), yet little is known about the integrons of Salmonella isolated from flies captured on cattle

69

farms. The purpose of this study is to characterize the integrons of Salmonella from flies

70

captured from cattle farms, including the composition of integron gene cassettes and the

71

transferability of integron-mediated antibiotic resistance genes on both microbiological media

72

and selected cattle farm samples.

73 74

2. Materials and methods

75 76

2.1. Bacterial strains and farm samples

77 78

A total of 606 Salmonella strains previously isolated from flies on 33 cattle farms in

79

Georgia USA were screened for integrons (Xu, Tao, Hinkle, Harrison, & Chen, 2018). Integron-

80

positive strains were used as donor strains in the conjugation experiments. Nalidixic-acid-

81

resistant Salmonella 439 isolated from a cattle-farm fly in the study described above and

82

Escherichia coli C600 from our laboratory culture collections were selected as recipient strains.

83

All strains were cultured on tryptic soy agar (TSA) (Becton, Dickinson and Co., Sparks, MD

84

USA) plates before a single colony was transferred into tryptic soy broth (TSB) (Becton,

85

Dickinson and Co.). All bacterial cultures were incubated at 37℃ for 18 h.

5

86

Milk powder for calves, feeds for calves and cows of high and low productivity, cattle

87

drinking water and tail hair, bedding sand, as well as bovine feces, collected from the dairy farm

88

on the University of Georgia Tifton Campus, were used as matrices for the conjugation

89

experiments. Solid samples in the amount of ca. 100 g and liquid samples in the volume of ca.

90

300 ml were collected. Powdered milk was reconstituted based on manufacturer’s instructions.

91

Reconstituted milk and other farm samples were autoclaved at 121℃ for 15 min. Solid samples

92

were held to dry after autoclaving in a biological safety cabinet (Class II type A/B 3, Nuaire,

93

Plymouth, MN) at room temperature until the water activity of the samples reached to the pre-

94

autoclaving values. A Pawkit Water Activity Meter (AquaLab, Pullman, WA USA) was used

95

for water activity measurement according to the manufacturer’s instructions. Sterility of the

96

samples was confirmed after autoclaving, and at the end of drying process.

97 98

2.2. Detection of integrase genes and gene cassettes

99 100

Integrons in the Salmonella isolates were detected using PCR and hep35 and hep36

101

primers (Table 1) targeting the conserved regions of integrase genes intI1, intI2, and intI3 (White

102

et al., 2000). Cassette regions of class 1 integrons were amplified with primers hep58 and hep59.

103

Primers hep54 and hep71 were used for the amplification of gene cassette in class 2 integrons

104

(White, McIver, Deng, & Rawlinson, 2001). For PCR amplifications, DNA templates were

105

prepared by pre-washing 1 ml of overnight cell cultures of Salmonella twice with sterile distilled

106

water. Washed cells were re-suspended in 100 µL of sterile water and heated in 100℃ water

107

bath for 10 min. After the heated samples were cooled on ice for 10 min, supernatants

108

containing crude DNA were obtained by centrifugation at 13,800 g for 10 min using a bench top

6

109

centrifuge (Brinkmann Instruments Inc., Westbury, NY USA). PCR amplifications were

110

conducted in a 25 µL-reaction mix including 5 µL of template, 0.5 µL of each primer (1 µg/µL),

111

0.5 U Taq DNA polymerase, 0.2 mM dNTP, 1.5 mM MgCl2, and 9.5 µL distilled water. All

112

reagents, except distilled water, were purchased from Thermo Fisher Scientific (Waltham, MA

113

USA). PCR was performed for 35 cycles, each of which was composed of 94℃ for 2 min, 55℃

114

for 1 min, and 72℃ for 1 min with a final extension was at 72℃ for 10 min.

115 116

2.3. DNA sequencing and analysis of integron gene cassettes

117 118

The amplicons of class 1 integron gene cassettes were purified using the Exonuclease Ӏ

119

and shrimp alkaline phosphate and submitted to Eurofins Genomics, a Eurofins MWG Operon

120

company (Louisville, KY USA) for sequencing using the cycle sequencing technology (dideoxy

121

chain termination/cycle sequencing) on a ABI 3730XL sequencing machine. The sequencing

122

results were compared against those in the NCBI database using BLASTTN at

123

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK

124

_LOC=blasthome (Wheeler, & Bhagwat, 2007).

125 126

2.4. Conjugation on TSA

127 128

Both recipient and donor cells were diluted to 1.2 - 2.0 X 108 CFU/mL with TSB, and an

129

equal volume (100 µL) of each diluted donor and recipient were mixed. Each donor and

130

recipient mixture was pipetted onto a TSA plate and incubated at 37℃ for 18 h. Samples with

131

donor and recipient culture only and incubated under the same condition served as controls.

7

132

Following incubation, each donor-recipient mixture was suspended in 1 mL of phosphate-

133

buffered saline (PBS) (Becton, Dickinson and Co.) and centrifuged at 12,000 g for 10 min. The

134

supernatant was discarded, and cell pellet was re-suspended into 1 mL PBS. Transconjugants

135

were selected by plating 0.1 ml of each conjugation mix on TSA supplemented with nalidixic

136

acid (200 µg/ml) with either streptomycin (50 µg/ml) or trimethoprim (50 µg/ml). All the

137

selective plates were incubated at 37℃ for 24 h. Each conjugation experiment were conducted

138

three times. Transfer efficiency was calculated as the number of transconjugants divided by the

139

staring number of recipients used in the experiment.

140 141

2.5. Transfer efficiency on farm samples

142 143

An equal volume (5 mL) of donor and recipient overnight cultures (4.70 – 8.0 X 108

144

CFU/ml) in TSB were mixed, and the resulting mixture was centrifuged at 12,000 g for 10 min.

145

Cell pellet obtained was re-suspended in 100 µL PBS. The donor and recipient mixture in PBS

146

(100 µL) was inoculated into 1 mL cattle drinking water or reconstituted powered milk in 15 mL

147

Falcon tubes (Becton, Dickinson and Co.). The same amount of donor and recipient cells were

148

also inoculated onto solid cattle farm samples (1 g), including 3 types of feeds, fecal materials,

149

bedding sand and tail hair, in sterile petri dishes sealed with parafilms (Thermo Fisher Scientific).

150

Farm samples inoculated with only donor or recipient cells served as controls. The samples were

151

incubated at 37℃ for 48 h. Following incubation, 3 mL of PBS was added to the solid farm

152

samples on petri dishes to collect the conjugant mixtures. Collected conjugation mixtures along

153

with the solid samples were transferred into Falcon centrifuge tubes. The solid samples and

154

powdered milk in Falcon tubes were centrifuged at 700 g for 10 min to precipitate undesired

8

155

solids in the samples. The supernatants of those samples, along with the conjugation mixture in

156

drinking water samples, were centrifuged at 12,000 g for 10 min. Harvested pellets were re-

157

suspended in 100 µL of PBS, which were inoculated onto TSA supplemented with appropriate

158

antibiotics. All the plates were incubated at 37℃ for 24 h. Transfer efficiency was calculated as

159

described above.

160 161

2.6. Analysis of transconjugants

162 163

The integrase gene and gene cassettes on the integrons of transconjugants were screened

164

by PCR using the conditions and primers described above. Antibiotic resistance profiles of the

165

transconjugants and their parent strains were compared using the disc diffusion assays based on

166

standard protocols provided by Clinical and Laboratory Standards Institute (CLSI) (CLSI, 2000).

167

Twelve antibiotic disks, including those of amoxicillin/clavulanic acid, ampicillin, cefoxitin,

168

ceftriaxone, chloramphenicol, ciprofloxacin, gentamicin, nalidixic acid, streptomycin,

169

sulfisoxazole, tetracycline, and trimethoprim (Oxoid, UK) were placed on 3 separate Muelller-

170

Hinton agar ӀӀ (Sigma-Aldrich, St. Louis, MO USA) plates, which were incubated at 37℃ for 18

171

h. The measurement of zones of inhibition around the discs were compared against the

172

recommendations of CLSI to classify the strains as resistant, intermediate resistant or sensitive

173

(CLSI, 2013).

174 175

3. Results

176 177

3.1. Presence of integron in Salmonella of cattle farm fly origin

9

178 179

Two out of the 606 Salmonella isolates (0.3%) tested positive for intl (Fig. 1A). Class 1

180

integrons were found in 2 Salmonella isolates, 438 and 442, from a single cattle farm.

181

Salmonella 438 carried a ca. 1.1-kb class 1 integron gene cassette, whereas Salmonella 442

182

carried a ca. 2.0-kb class 1 integron gene cassette (Fig. 1B). DNA sequencing results indicated

183

that the class 1 integron gene cassette in Salmonella 438 carried the gene for aminoglycoside

184

adenylyltransferase (aadA7) that shares 100% homology with 0% gap with GeneBank sequence

185

AF224733.1 and confers resistance to streptomycin. The gene cassette array in Salmonella 442

186

contained three genes, dihydrofolate reductase (dfrA12), open reading frame F (orfF), and

187

aminoglycoside adenylyltransferase (aadA2) that shares 100% homology with 0% gap with

188

GenBank sequence HQ840942.1 and confers resistance to trimethoprim and streptomycin to the

189

Salmonella isolate.

190 191

3.2. Conjugation on TSA

192 193

Transfer of the class 1 integrons from the 2 donor strains, Salmonella 438 and 442 to

194

Salmonella 439 was observed when TSA supplemented with nalidixic acid (200 µg/ml) and

195

streptomycin (50 µg/ml) was used as selective medium (Table 2). However, when TSA

196

supplemented with nalidixic acid (200 µg/ml) and trimethoprim (50 µg/ml) was used, no

197

transconjugants were recovered from the conjugation between 438 and the two recipients. The

198

efficiencies of transfer between Salmonella 438 and Salmonella 439 or E. coli C600 were similar

199

(4.25 × 10-5 and 1.24 × 10-5, respectively). The transfer efficiencies of antibiotic resistance genes

10

200

from Salmonella 442 to E. coli C600 or Salmonella 439 were 1.44 × 10-5 - 2.35 × 10-5, and 1.47

201

× 10-6 - 6.29 × 10-4, respectively.

202 203

3.3. Conjugation on farm samples

204 205

Neither Salmonella 438 nor 442 was able to transfer the class 1 integrons to their

206

recipient cells on feces, 3 types of feeds and reconstituted milk (Table 3; Detection limit < 2.50-

207

4.26 X10-10). However, transconjugants were recovered from the conjugation between

208

Salmonella 442 and E. coli C600 (6.38 × 10-9) in drinking water and between Salmonella 442

209

and each of the two recipients on tail hair (3.25 × 10-9 and 1.36 × 10-8, respectively) and bedding

210

sand (5.00 × 10-10 and 4.26 × 10-10, respectively) (Table 3). Unfortunately, similar results were

211

not observed with the transfer of class 1 integron of Salmonella 438 (Table 3). Moreover, the

212

efficiencies of antibiotic resistance gene transfer on the 3 farm samples were much lower (ca. 10-

213

10

to 10-8) than those on TSA (ca. 10-6 to 10-4).

214 215

3.4. Analysis of transconjugants

216 217

Integrase was detected in all the transconjugants recovered from the study. The size of

218

class 1 integron gene cassette in the transconjugants was similar to that in their corresponding

219

donor strains (Fig. 1C). The antibiotic resistance profiles revealed that in addition to the

220

antibiotic resistance encoded by integrons, some of the transconjugants were also resistant to

221

other antibiotics that were the characteristics of their donors but were not encoded by integrons

222

(Table 4). For the transconjugants derived from Salmonella 438 and 439 or E. coli C600, the

11

223

genes for tetracycline resistance were transferred along with the integron (Table 4). In

224

transconjugants derived from Salmonella 442 and 439 conjugation, genes encoding for the

225

resistance to tetracycline, chloramphenicol, and ciprofloxacin were co-transferred with the class

226

1 integron-mediated antibiotic resistance genes (Table 4). For transconjugants derived from the

227

conjugation between Salmonella 442 and E. coli C600, genes encoding for the resistance to

228

amoxicillin/clavulanic acid, ampicillin, cefoxitin, chloramphenicol, ciprofloxacin, and

229

tetracycline were transferred together with the class 1 integron-mediated antibiotic resistance

230

genes (Table 4).

231 232

4. Discussion

233 234

4.1. Integrons and gene cassettes on integrons

235 236

The present study found that 0.3% of the Salmonella originated from cattle farm flies were

237

positive for the class I integrons. Up till now, limited information is available on the incidence

238

of class I intergrons in Salmonella isolated from farm flies. The only two remotely related

239

previous studies that we could find were conducted in the Czech Republic on E. coli rather than

240

Salmonella. Rybarikova, Dolejska, Materna, Literak, & Cizek (2010) isolated 147 E. coli from

241

240 flies on a dairy farm, among which 18 (12%) tested positive for integrons. Literak et al.

242

(2009) found that 11 out of the 216 E. coli (5.1%) isolated from 236 flies on a swine farm carried

243

integrons.

244 245

Only class 1 integrons were found in this study, and this finding concurs with results of several previous studies (Ahmed et al., 2009; Antunes et al., 2006; Tabe et al., 2010). It is

12

246

known that the integrase of class 2 integrons is dysfunctional due to an internal stop codon,

247

limiting their ability to acquire and rearrange new gene cassettes, which exerts constraints on the

248

spectrum and evolution of class 2 integrons (Gillings, 2014).

249

Both gene cassettes identified in this study contained aadA, which is in agreement with

250

the results of a previous study that revealed the predominance of aadA among class 1 integrons

251

(Nagachinta & Chen (2008). While acknowledging that the extensive use of streptomycin- and

252

spectomycin-related veterinary medicine might have contributed to the observed phenomenon,

253

Machado & Peixe (2006) believe that the structural association of aadA with other genes, such as

254

sul1, the selective pressure of which were more frequently present in the environment, probably

255

promoted the conservation of aadA. The aadA encodes the aminoglycoside adenylyltransferase

256

family that protects bacterial cells from spectinomycin and streptomycin through enzymatic

257

modification of the antibiotics (Partridge, Tsafnat, Coiera, & Iredell, 2009). Integrons carrying

258

aadA7 gene cassette are mostly seen in clinical Salmonella isolates (Cloeckaert, Praud, Doublet,

259

Demartin, & Weill, 2006; Doublet et al., 2008). Molla et al. (2007) found this gene cassette in

260

Salmonella originated from slaughtered cattle in Ethiopia.

261

The drfA12-orfF-aadA2, a common gene array of class 1 integron from Salmonella of

262

cattle origin (García-Fierro, Montero, Bances, González-Hevia, & Rodicio, 2016; Willford,

263

Manley, Rebelein, & Goodridge, 2007), was detected in this study. This gene array has been

264

observed in Salmonella from other sources, including human (Fernández et al., 2007) and swine

265

(Huang, Chang, & Chang, 2004). Partridge, Tsafnat, Coiera, & Iredell (2009) suggested that the

266

broad distribution of this array might be related to successful mobile elements, such as

267

transposons, associated with this cassette array.

268

13

269

4.2. Transfer of antibiotic resistance genes

270 271

Both class 1 integrons identified in this study were transferrable on TSA by conjugation

272

(Table 2). Siqueira et al. (2016) successfully transferred aadA7 from an E. coli isolate to E. coli

273

TOP10 with a transfer efficiency of 8.5 × 10-6, while Yu et al. (2016) demonstrated that the

274

efficiency of drfA12-orfF-aadA2 transfer from an E. coli donor to E. coli J53 was 6.1 × 10-6,

275

similar to the results of the present study. It has been reported that AadA7 and drfA12-orfF-

276

aadA2 are located on transferrable plasmids (Heikkila, Skurnik, Sundstrom, & Huovinen, 1993;

277

Vo, van Duijkeren, Gaastra, & Fluit, 2010).

278

Transfer of one of the integrons across bacterial genus on some of the farm samples was

279

successful in the present study although with low frequencies (Table 3), suggesting that

280

horizontal transfer of antibiotic resistance genes within and across bacterial species in the farm

281

environment is possible. Mathew et al. (2009) verified the transfer of integrons between

282

Salmonella and E. coli on farms by typing integron and plasmid profiles of 571 E. coli and 98

283

Salmonella isolated from multiple farms in Thailand. Homologous integrons on a common

284

plasmid was found in both E. coli and Salmonella isolated from a single swine farm (Mathew et

285

al., 2009). It was observed in the present study that the efficiencies of transfer taking place on

286

the farm samples were much lower than those on TSA (Tables 2 & 3), an observation which has

287

also been made by Nagachinta & Chen (2008; 2009). TSA is a nutrient-rich medium able to

288

support the growth of both donor and recipient cells, while farm samples, such as bedding sand

289

and feeds, were complex matrices that limit cell movement, as well as the accessibility of

290

nutrients and water, which are critical for bacterial conjugation (Nagachinta & Chen, 2008).

291

Additionally, the nutrients of TSA benefit the formation of F pili, a pivotal structure for

14

292

conjugation (Nagachinta & Chen, 2008), and possibly promote the propagation of

293

transconjugants.

294

Conjugation was unsuccessful on feeds for cows and calves or in reconstituted milk for

295

calves (Table 3). Possible presence of antimicrobials in these materials might have prohibited

296

the growth of recipients and/or donors. For instance, lincosamides, a class of antibiotics often

297

added to cow’s feeds for treating mastitis (USDA, 2008) and tetracycline, commonly used to

298

treat diarrhea in calves (USDA, 2008), might have been present in the feed and powdered milk

299

samples. These antibiotics are stable at high temperature (Hsieh et al., 2011), residues of which

300

might have adversely affected the viability of donor and/or recipient cells in this study.

301

Furthermore, the low pH of feeds made from corn silage (pH ca. 3.5) could also affect the fate of

302

bacterial cells and transfer efficiency (Nagachinta & Chen, 2008).

303

The efficiency of successful integron transfer varied by different farm samples used in

304

the study (Table 3). Higher efficiencies were associated with solid (bedding sands and tail hair)

305

than liquid (drinking water) samples. Lampkowska et al. (2008) suggested that, compared to

306

liquids, the solid materials offer limited space for cell movement, which increases the interaction

307

among bacterial cells (Lampkowska et al., 2008).

308 309

4.3. Analysis of transconjugants

310 311

Results of PCR analysis on transconjugants suggest that all the transconjugants acquired

312

the entire gene cassettes from their donors (Fig. 1C). Martinez-Freijo, Fluit, Schmitz, Verhoef,

313

& Jones (1999) also observed that the aadA gene cassette and drfA-aadA gene array were often

314

transferred as part of the complete integron rather than as individual genes. Partridge et al. (2009)

15

315

confirmed the stableness of drfA12-orfF-aadA2 through horizontal transfer when they noticed

316

drfA12 almost always dispersed as part of drfA12-orfF-aadA2 array.

317

Comparison of the antibiotic resistance profiles of the donors and transconjugants

318

revealed that antibiotic resistance genes not encoded by integrons were also transferred from

319

donors to recipient cells during conjugation (Table 4). This is likely due to the co-transfer of

320

antibiotic resistance genes carried by integrons and by mobile DNA elements such as

321

transmissible plasmid during conjugation. Szmolka et al. (2015) observed the co-transfer of

322

tet(A) and catA1 located on IncI1 plasmid, encoding resistance to tetracycline and

323

chloramphenicol, respectively, along with an aadA gene cassette located on the same plasmid.

324

Unlike Salmonella 442, Salmonella 438 failed to co-transfer β-lactam

325

(amoxicillin/clavulanic acid, ampicillin, and cefoxitin) resistance genes (bla) along with the

326

integron-mediated antibiotic resistance genes into recipient cells (Table 4). The bla gene could

327

possibly be on the chromosome or on another plasmid that are not transmissible or cannot

328

replicate in the recipient. Siqueira et al. (2016) observed that in multi-plasmid isolates, bla genes

329

are sometimes located on a small plasmid which is often not transferrable, even though some

330

small plasmids can be mobilized by conjugative plasmids. It is not clear whether this is what

331

happened in the case of Salmonella 438 used in the present study.

332 333

334

5. Conclusion This study shows that Salmonella isolates from flies of cattle source could carry integrons

335

encoding genes for antibiotic resistance. Antibiotic resistance genes on the ntegrons can be co-

336

transferred with other antibiotic resistance genes within and across bacterial genus through

337

conjugation on some of the farm samples used in the study. Possible dissemination of antibiotic

16

338

resistance genes through horizontal gene transfer in farm environment could possibly contribute

339

to the emergence of antibiotic resistant bacterial strains, resulting in failure of antibiotics in

340

treatment of infectious diseases.

341 342

Acknowledgment

343 344 345

The authors sincerely thank Dr. Sha Tao for his assistance in collecting the farm samples used in conjugation experiments.

346 347

Funding

348 349

This work was funded in part by the Beef Checkoff.

350 351

References

352 353 354 355

Ahmed, A. M., Ishida, Y., & Shimamoto, T. (2009). Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. Journal of Applied Microbiology, 106(2), 402–409. https://doi.org/10.1111/j.1365-2672.2008.04009.x

356 357 358

Al-Masaudi, S. B., Russell, A. D., & Day, M. J. (1991). Factors affecting conjugative transfer of plasmid pWG613, determining gentamicin resistance, in Staphylococcus aureus. J. Med. Microbiol, 34, 103–107. Retrieved from www.microbiologyresearch.org

359 360 361

Antunes, P., Machado, J., & Peixe, L. (2006). Characterization of antimicrobial resistance and class 1 and 2 integrons in Salmonella enterica isolates from different sources in Portugal. Journal of Antimicrobial Chemotherapy, 58(2), 297–304. https://doi.org/10.1093/jac/dkl242

362 363

CDC. (2016a). Foodborne outbreak tracking and reporting: foodborne outbreak online database (FOOD Tool). Retrieved June 5, 2019, from https://wwwn.cdc.gov/norsdashboard/

364 365

CDC. (2016b). Multistate outbreak of multidrug-resistant Salmonella Heidelberg infections linked to contact with dairy bull calves. https://doi.org/10.2460/javma.243.9.1270

366 367 368

Cloeckaert, A., Praud, K., Doublet, B., Demartin, M., & Weill, F.-X. (2006). Variant Salmonella genomic island 1-L antibiotic resistance gene cluster in Salmonella enterica serovar Newport. Antimicrobial Agents and Chemotherapy, 50(11), 3944–3946.

17

369

https://doi.org/10.1128/AAC.00697-06

370 371

CLSI. (2000). Performance standards for antimicrobial disk susceptibility tests: approved standard. Wayne, PA: NCCLS.

372 373

CLSI. (2013). Performance standards for antimicrobial susceptibility testing: twenty third informational supplement. Wayne, PA: NCCLS.

374 375 376 377

Doublet, B., Praud, K., Bertrand, S., Collard, J.-M., Weill, F.-X., & Cloeckaert, A. (2008). Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky. Antimicrobial Agents and Chemotherapy, 52(10), 3745–3754. https://doi.org/10.1128/AAC.00525-08

378 379 380 381 382

Fernández, A. G., Cloeckaert, A., Bertini, A., Praud, K., Doublet, B., Weill, F.-X., & Carattoli, A. (2007). Comparative analysis of IncHI2 plasmids carrying blaCTX-M-2 or blaCTX-M-9 from Escherichia coli and Salmonella enterica strains isolated from poultry and humans. Antimicrobial Agents and Chemotherapy, 51(11), 4177. https://doi.org/10.1128/AAC.00603-07

383 384 385

Fluit, A. C., & Schmitz, F.-J. (2004). Resistance integrons and super-integrons. Clinical Microbiology and Infection, 10(4), 272–288. https://doi.org/10.1111/j.1198743X.2004.00858.x

386 387 388 389

García-Fierro, R., Montero, I., Bances, M., González-Hevia, M. Á., & Rodicio, M. R. (2016). Antimicrobial drug resistance and molecular typing of Salmonella enterica serovar Rissen from different sources. Microbial Drug Resistance, 22(3), 211–217. https://doi.org/10.1089/mdr.2015.0161

390 391

Gillings, M. R. (2014). Integrons: past, present, and future. Microbiology and Molecular Biology Reviews, 78(2), 257–277. https://doi.org/10.1128/MMBR.00056-13

392 393 394

Hall, R. M., & Collis, C. M. (1995). Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Molecular Microbiology, 15(4), 593–600. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7783631

395 396 397 398 399

Heikkila, E., Skurnik, M., Sundstrom, L., & Huovinen P. (1993). A novel dihydrofolate reductase cassette inserted in an integron borne on a Tn21-like element. Antimicrobial Agents and Chemotherapy, 37(6), 1297–1304. Retrieved from https://researchportal.helsinki.fi/en/publications/a-novel-dihydrofolate-reductase-cassetteinserted-in-an-integron-

400 401 402 403 404 405

Hsieh, M. K., Shyu, C. L., Liao, J. W., Franje, C. A., Huang, Y. J., Chang, S. K., … Chou, C. C. (2011). Correlation analysis of heat stability of veterinary antibiotics by structural degradation, changes in antimicrobial activity and genotoxicity. Veterinární Medicína, 56(6), 274–285. Retrieved from http://proxyremote.galib.uga.edu/login?url=http://search.ebscohost.com/login.aspx?direct=true&db=lah &AN=20113247944&site=eds-live

406 407 408

Huang, T., Chang, Y.-F., & Chang, C.-F. (2004). Detection of mutations in the gyrA gene and class I integron from quinolone-resistant Salmonella enterica serovar Choleraesuis isolates in Taiwan. Veterinary Microbiology, 100(3–4), 247–254.

18

409

https://doi.org/10.1016/j.vetmic.2004.03.003

410 411 412

Hur, J., Kim, J. H., Park, J. H., Lee, Y.-J., & Lee, J. H. (2011). Molecular and virulence characteristics of multi-drug resistant Salmonella Enteritidis strains isolated from poultry. The Veterinary Journal, 189(3), 306–311. https://doi.org/10.1016/j.tvjl.2010.07.017

413 414 415

Krauland, M. G., Marsh, J. W., Paterson, D. L., & Harrison, L. H. (2009). Integron-mediated multidrug resistance in a global collection of nontyphoidal Salmonella enterica isolates. Emerging Infectious Diseases, 15(3), 388–396. https://doi.org/10.3201/eid1503.081131

416 417 418 419

Lampkowska, J., Feld, L., Monaghan, A., Toomey, N., Schjorring, S., Jacobsen, B., … Bardowski, J. (2008). A standardized conjugation protocol to asses antibiotic resistance transfer between lactococcal species. International Journal of Food Microbiology, 127(1–2), 172–175. https://doi.org/10.1016/j.ijfoodmicro.2008.06.017

420 421 422 423

Literak, I., Dolejska, M., Rybarikova, J., Cizek, A., Strejckova, P., Vyskocilova, M., … Klimes, J. (2009). Highly variable patterns of antimicrobial resistance in commensal Escherichia coli isolates from pigs, sympatric rodents, and flies. Microbial Drug Resistance, 15(3), 229– 237. https://doi.org/10.1089/mdr.2009.0913

424 425 426 427

Martinez-Freijo, P., Fluit, A. C., Schmitz, F. J., Verhoef, J., & Jones, M. E. (1999). Many class I integrons comprise distinct stable structures occurring in different species of Enterobacteriaceae isolated from widespread geographic regions in Europe. Antimicrobial Agents and Chemotherapy, 43(3), 686–689. https://doi.org/10.1128/AAC.43.3.686

428 429 430

Mathew, A. G., Liamthong, S., Lin, J., & Hong, Y. (2009). Evidence of class 1 integron transfer between Escherichia coli and Salmonella spp. on livestock farms. Foodborne Pathogens and Disease, 6(8), 959–964. https://doi.org/10.1089/fpd.2009.0263

431 432 433 434

Molla, B., Miko, A., Pries, K., Hildebrandt, G., Kleer, J., Schroeter, A., & Helmuth, R. (2007). Class 1 integrons and resistance gene cassettes among multidrug resistant Salmonella serovars isolated from slaughter animals and foods of animal origin in Ethiopia. Acta Tropica, 103(2), 142–149. https://doi.org/10.1016/j.actatropica.2007.05.018

435 436 437 438

Nagachinta, S., & Chen, J. (2008). Transfer of class 1 integron-mediated antibiotic resistance genes from shiga toxin-producing Escherichia coli to a susceptible E. coli K-12 strain in storm water and bovine feces. Applied and Environmental Microbiology, 74(16), 5063– 5067. https://doi.org/10.1128/AEM.00517-08

439 440 441

Nagachinta, S., & Chen, J. (2009). Integron-mediated antibiotic resistance in Shiga toxinproducing Escherichia coli. Journal of Food Protection, 72(1), 21–27. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/19205459

442 443 444

Partridge, S. R., Tsafnat, G., Coiera, E., & Iredell, J. R. (2009). Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiology Reviews, 33(4), 757–784. https://doi.org/10.1111/j.1574-6976.2009.00175.x

445 446 447 448

Rybaříková, J., Dolejská, M., Materna, D., Literák, I., & Čížek, A. (2010). Phenotypic and genotypic characteristics of antimicrobial resistant Escherichia coli isolated from symbovine flies, cattle and sympatric insectivorous house martins from a farm in the Czech Republic (2006–2007). Research in Veterinary Science, 89(2), 179–183.

19

449

https://doi.org/10.1016/j.rvsc.2010.02.016

450 451 452 453

Schwarz, S., Cloeckaert, A., & Roberts, M. C. (2006). Chapter 6: mechanisms and spread of bacterial resistance to antimicrobial agents. In F. M. Aarestrup (Ed.), Antimicrobial resistance in bacteria of animal origin (pp. 73–98). Washington D.C.: ASM Press. https://doi.org/10.3201/eid1207.060503

454 455 456 457

Siqueira, A. K., Michael, G. B., Domingos, D. F., Ferraz, M. M. G., Ribeiro, M. G., Schwarz, S., & Leite, D. S. (2016). Diversity of class 1 and 2 integrons detected in Escherichia coli isolates from diseased and apparently healthy dogs. Veterinary Microbiology, 194, 79–83. https://doi.org/10.1016/j.vetmic.2016.05.005

458 459 460 461

Szmolka, A., Lestár, B., Pászti, J., Fekete, P., & Nagy, B. (2015). Conjugative IncF and IncI1 plasmids with tet (A) and class 1 integron conferring multidrug resistance in F18 + porcine enterotoxigenic E. coli. Acta Veterinaria Hungarica, 63(4), 425–443. https://doi.org/10.1556/004.2015.040

462 463 464 465

Tabe, E. S., Oloya, J., Doetkott, D. K., & Khaitsa, M. L. (2010). Characterization of multidrugresistant Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen and Typhimurium isolated from feedlot cattle (Vol. 30). Retrieved from https://pdfs.semanticscholar.org/c7c5/6f3796c7f1743ed427564a565e6e9932f6a9.pdf

466 467 468

Thomas, C. M., & Nielsen, K. M. (2005). Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nature Reviews Microbiology, 3(9), 711–721. https://doi.org/10.1038/nrmicro1234

469 470 471 472

USDA. (2008). Dairy 2007 part III: reference of dairy cattle health and management practices in the United States. Retrieved March 4, 2019, from https://www.aphis.usda.gov/animal_health/nahms/dairy/downloads/dairy07/Dairy07_dr_Par tIII_rev.pdf/

473 474 475

Vo, A. T. T., van Duijkeren, E., Gaastra, W., & Fluit, A. C. (2010). Antimicrobial resistance, class 1 integrons, and genomic island 1 in Salmonella isolates from Vietnam. PLoS ONE, 5(2), e9440. https://doi.org/10.1371/journal.pone.0009440

476 477 478

Wheeler, D., & Bhagwat, M. (2007). Chapter 9: BLAST quickstart. In N. H. Bergman (Ed.). Comparative Genomics. Totowa, N.J., Humana Press. Retrieved December 5, 2019, from https://www.ncbi.nlm.nih.gov/books/NBK1734/#top

479 480 481

White, P. A., McIver, C. J., Deng, Y.-M., & Rawlinson, W. D. (2000). Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiology Letters, 182(2), 265–269. https://doi.org/10.1111/j.1574-6968.2000.tb08906.x

482 483

White, P. A., McIver, C. J., and Rawlinson, W. D. (2001). Integrons and gene cassettes in the enterobacteriaceae. Antimicrob Agents Chemother, 45(9), 2658-61.

484 485 486

Willford, J., Manley, W., Rebelein, T., & Goodridge, L. D. (2007). Pulsed field, ribotype and integron analysis of multidrug resistant isolates of Salmonella enterica serovar Newport. Food Research International, 40(8), 975–981. https://doi.org/10.1016/j.foodres.2007.05.012

487

Xu, Y., Tao, S., Hinkle, N., Harrison, M., & Chen, J. (2018). Salmonella, including antibiotic-

20

488 489

resistant Salmonella, from flies captured from cattle farms in Georgia, U.S.A. Science of The Total Environment, 616–617, 90–96. https://doi.org/10.1016/j.scitotenv.2017.10.324

490 491 492 493

Yu, T., Zhang, J., Jiang, X., Wu, J., Dai, Z., Wu, Z., … Wang, X. (2016). Characterization and horizontal transfer of class 1 integrons in Escherichia coli isolates from cooked meat products. The Journal of Infection in Developing Countries, 10(01), 68–73. https://doi.org/10.3855/jidc.6858

494 495

1

1 2 3

Table 1 Oligonucleotide primers used in PCR amplification of integrase gene and resistance gene cassette Size of Primera

Sequencesb

Target genes amplicons

Hep35

TGCGGGTYAARGATBTKGATTT

integrase genes intI1, intI2, and intI3 (conserved region

Hep36

491 bp

CARCACATGCGTRTARAT of integron)

Hep58

TCATGGCTTGTTATGACTGT

Variable region of class 1

Hep59

GTAGGGCTTATTATGCACGC

integron

Hep51

GATGCCATCGCAAGTACGAG

varied

Variable region of class 2 varied

CGGGATCCCGGACGGCATGCAC integron

Hep74 GATTTGTA 4 5 6 7

8

a

Primer Hep35, 36, 58, and 59 were adopted from White et al., (2000); while primers Hep 51 and 74 were from White, McIver & Rawlinson, (2001). b B indicates C, G, or T; K indicates G or T; R indicates A or G; Y indicates C or T.

2

9 10 11

Table 2 Conjugation efficiencies of integron-mediated antibiotic resistance genes on tryptic soy agar plates Selective mediaa

Conjugation efficiencyb

Salmonella 438 Salmonella 439

TSA+ NA+ S

4.25 × 10-5

Salmonella 438

TSA+ NA+ S

1.24 × 10-5

Salmonella 442 Salmonella 439

TSA+ NA+ S

1.47 × 10-6

Salmonella 442 Salmonella 439

TSA+ NA+ W

6.29 × 10-4

Salmonella 442

E. coli C600

TSA+ NA+ S

1.44 × 10-5

Salmonella 442

E. coli C600

TSA+ NA+ W

2.35 × 10-5

Donors

12 13 14 15

a

Recipients

E. coli C600

TSA+ NA+ S, TSA supplemented with 200 µg/ml nalidixic acid and 50 µg/ml streptomycin; TSA+ NA+ W, TSA supplemented with 200 µg/ml nalidixic acid and 50 µg/ml trimethoprim b Transfer efficiency was expressed as the ratio of number of transconjugants to the starting number of recipient cells.

3

16 17

Table 3 Conjugation efficiencies of integron-mediated antibiotic resistance genes on farm samples Farm samples Donors Recipients Conjugation efficiencya

Tail hair

Bedding sand

Drinking water 18 19 20 21 22

a

Salmonella 439

3.25 × 10-9

E. coli C600

1.36 × 10-8

Salmonella 439

5.00 × 10-10

E. coli C600

4.26 × 10-10

E. coli C600

6.38 × 10-9

Salmonella 442

Salmonella 442

Salmonella 442

Detect limit of transfer efficiency when Salmonella 439 was used as a recipient was 2.50 × 1010 and when E. coli C600 was used as a recipient was 4.26 × 10-10. Transconjugants were selected on tryptic soy agar supplemented with 200 µg/ml of nalidixic acid and 50 µg/ml of streptomycin. Transfer efficiency was expressed as the ratio of number of transconjugants to the starting number of recipient cells.

4

23 24

25 26 27 28 29 30 31 32 33

Table 4 Antibiotic-resistant profiles of the donors, the recipients and the transconjugants Antibioticsd Selective a a b Donors Recipients Matrixes mediac Au A Fox Cx C Cip G NA S Su T W 438

R

R R

S

S

442

R

R R

S

439

R

R R

C600

S

S

I

S

S

R R

R S

R R

S

I

R R

R R

S

S

I

S

R

S

S

S

S

S

S

S

I

S

R

S

S

S

S

438

439

TSA

NA + S

R

R R

S

S

I

S

R

R R

R S

438

C600

TSA

NA + S

S

I

S

S

S

I

S

R

R R

R S

442

439

TSA

NA + S

R

R R

S

R R

S

R

R R

R R

442

439

BD

NA + S

R

R R

S

R R

S

R

R R

R R

442

439

TH

NA + S

R

R R

S

R R

S

R

R R

R R

442

C600

TSA

NA + W

R

R R

S

R R

S

R

R R

R R

442

C600

TSA

NA + S

R

R R

S

R R

S

R

R R

R R

442

C600

DW

NA + S

R

R R

S

R R

S

R

R R

R R

442

C600

BS

NA + S

R

R R

S

R R

S

R

R R

R R

442

C600

TH

NA + S

R

R R

S

R R

S

R

R R

R R

a

438, Salmonella 438; 442, Salmonella 442; C600, E. coli C600. Matrix for conjugation. TSA, tryptic soy agar; BD, bedding sand; TH, Tail hair, DW, drinking water. c NA + S, TSA supplemented with nalidixic acid (200 µg/mL) and streptomycin (50 µg/mL); NA + W, TSA supplemented with nalidixic acid (200 µg/mL) and trimethoprim (50 µg/mL). d Au, amoxicillin/clavulanic acid; A, ampicillin; Fox, cefoxitin; Cx, ceftriaxone; C, chloramphenicol;Cip, ciprofloxacin; G, Gentamicin; NA, Nalidixic acid; S, streptomycin; Su, sulfisoxazole; T, tetracycline; W, trimethoprim. b

1 1

Figure Legends

2 3

Fig. 1. PCR amplicons of Salmonella from flies as well as representative transconjugants using

4

primers targeting integrase and class 1 integron gene cassettes.

5

(A) Integrase gene from Salmonella 438 (lane 1), 442 (lane 2), 439 (lane 3), E. coli C600 (lane

6

4), and positive control (lane 5); (B) Class 1 integron gene cassette from Salmonella 439 (lane 1)

7

and 442 (lane 2); (C) Class 1 integron of transconjugants from the mating between Salmonella

8

442 and 439 on TSA (lane 1), on bedding sand (lane 2), on tail hair (lane 3); Salmonella 442 and

9

E. coli C600 on TSA with 200 µg/ml nalidixic acid and 50 µg/ml streptomycin (lane 4) or 200

10

µg/ml nalidixic acid and 50 µg/ml trimethoprim (lane 5), in drinking water (lane 6), on bedding

11

sand (lane 7), and on tail hair (lane 8).

2 12

Fig. 1. Xu et al.

13

A

14

1kb

1

2

3

4

5

500 bp 15 16 17

B 1kb 1 2

2000 bp 1000 bp

18 19 20 21 22 2000 bp 23 24

C 1kb 1 2 3 4 5

6 7 8

HIGHLGHTS •

Two integrons were detected from 2/606 Salmonella: aadA7 and drfA12-orfF-aadA2.



Both integrons were transferrable to Salmonella and E.coli recipients on TSA.



Intergron carrying drfA12-orfF-aadA2 was transferrable on 3 out of 8 farm samples.



The conjugation efficiencies on TSA were higher than those on farm samples.



Resistance genes not carried by integrons were co-transferred during conjugation.

Conflict of Interest and Authorship Conformation Form Please check the following as appropriate:

o X All authors have participated in (a) conception and design, or analysis and interpretation of the data; (b) drafting the article or revising it critically for important intellectual content; and (c) approval of the final version. o X This manuscript has not been submitted to, nor is under review at, another journal or other publishing venue. o X The authors have no affiliation with any organization with a direct or indirect financial interest in the subject matter discussed in the manuscript o

The following authors have affiliations with organizations with direct or indirect financial interest in the subject matter discussed in the manuscript:

Author’s name

Affiliation