Transformation of hexabromocyclododecane in contaminated soil in association with microbial diversity

Transformation of hexabromocyclododecane in contaminated soil in association with microbial diversity

Accepted Manuscript Title: Transformation of Hexabromocyclododecane in Contaminated Soil in Association with Microbial Diversity Author: Thao Thanh Le...

1MB Sizes 0 Downloads 1 Views

Accepted Manuscript Title: Transformation of Hexabromocyclododecane in Contaminated Soil in Association with Microbial Diversity Author: Thao Thanh Le Min-Hui Son In-Huyn Nam Hakwon Yoon Yu-Gyeong Kang Yoon-Seok Chang PII: DOI: Reference:

S0304-3894(16)31088-3 http://dx.doi.org/doi:10.1016/j.jhazmat.2016.11.058 HAZMAT 18212

To appear in:

Journal of Hazardous Materials

Received date: Revised date: Accepted date:

18-7-2016 12-11-2016 19-11-2016

Please cite this article as: Thao Thanh Le, Min-Hui Son, In-Huyn Nam, Hakwon Yoon, Yu-Gyeong Kang, Yoon-Seok Chang, Transformation of Hexabromocyclododecane in Contaminated Soil in Association with Microbial Diversity, Journal of Hazardous Materials http://dx.doi.org/10.1016/j.jhazmat.2016.11.058 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Transformation of Hexabromocyclododecane in Contaminated Soil in Association with Microbial Diversity Thao Thanh Lea#, Min-Hui Sona#, In-Huyn Namb, Hakwon Yoona, Yu-Gyeong Kanga, Yoon-Seok Changa* a

Division of Environmental Science and Engineering, POSTECH, Pohang 790-784, Republic of Korea

b

Korea Institute of Geoscience and Mineral Resources (KIGAM), Daejeon 305-350, Republic of Korea

#: Authors have the same contribution

* Corresponding author Prof. Dr. Yoon-Seok Chang School of Environmental Science and Engineering Pohang University of Science and Technology (POSTECH) Pohang 790-784, Republic of Korea Tel.: +82 54 279 2281; Fax: +82 54 279 8299 Graphical abstract

1

Highlights 

HBCD degradation was investigated under anaerobic and aerobic conditions



Soil components, especially humic acid, and glucose affect to HBCD remediation



Degradation of HBCD in rhizosphere soil was effective under aerobic conditions



Gram-negative microbes were stimulated during aerobic degradation of HBCD

Abstract This study evaluated the transformation of 1,2,5,6,9,10-hexabromocyclododecane (HBCD) in soil under various conditions. Under anaerobic conditions for 21 days, 34% of the total HBCD was reduced from rhizosphere soil containing humic acid, and 35% of the total HBCD was reduced from the non-rhizosphere soil; under aerobic conditions, 29% and 57~60% of the total HBCD were reduced from the same soil types after 40 days. Three HBCD isomers (α-, β-, and γ-HBCD) were separately analyzed for their isomeric effects on transformation. In the soils with added glucose as 2

a carbon and energy source, the fraction of γ-HBCD was reduced due to the blooming microbial activity. The population of Gram-positive bacteria decreased during the aerobic treatments of HBCD, whereas the population of several Gram-negative bacteria (e.g., Alpha proteobacterium, Sphingomonas sp.) increased. Humic acid and glucose increased the HBCD removal efficiency and microbial diversity in both rhizosphere and non-rhizosphere soils. Keywords: HBCD, soil, microbial activity, humic acid, bioremediation 1. Introduction Soil is a complex and dynamic system. It is known to act as a sink for chemical pollutants. Physical, chemical and biological processes in soil affect the fate and long-term existence of organic and inorganic pollutants. In contaminated soil, organic pollutants interact with soil components as well as with microorganisms. Depending on the chemicals’ properties and the microbes’ degradative capabilities, the fate of pollutants differs among soil types [1, 2]. Due to the ability of microbes to metabolize a wide range of pollutants, microbes are highly favored in pollutant remediation [3, 4]. The rhizosphere, a narrow zone of soil that surrounding plant roots, hosts an overwhelming number of microorganisms and is considered to be one of the most dynamic interfaces in the soil ecosystem [5]. Thus, analysis of changes in the composition of microbial community in the rhizosphere can also be used to measure the microbial response to pollutants and to identify the potential pollutant-degrading microbes. For these reasons, the rhizosphere is an ideal soil matrix in which the potential fate of contaminants and the ability of microorganisms to metabolize them can be evaluated [6, 7]. The compound, 1,2,5,6,9,10-hexabromocyclododecane (HBCD, C12H18Br6), is the most-used cycloaliphatic brominated flame retardant additive. HBCD is used in extruded or expanded

3

polystyrene foam materials in buildings [8, 9], automobile interior textiles [10], and electronic equipments [11]. Due to its wide uses and persistent properties, this compound occurs in many environmental matrices. As a result, it can accumulate in the food web [12, 13] and can lead to several toxic effects, such as neurobehavioral alterations [13], and the disruption of thyroid homoeostasis [14]. Technical HBCD (t-HBCD) is dominated by three diastereoisomers, α, β, and γ. Their relative amounts depend on the manufacturer; normally, the γ-isomer accounts for > 70% of the total, and the α- and β-isomers contribute ~10% each. The environmental behavior of HBCD isomers is influenced by their low aqueous solubility (65.6 µg L-1, sum of the individual solubilities of each diastereomer), high log Kow = 5.62, and low vapor pressure (6.310-5 Pa). As HBCD is passed through the food chain, the isomeric distribution changes from primarily γ in technical products and in soil/sediment matrices to primarily α-HBCD in the biota; this change may be the results of selective up-take and different metabolism [15, 16]. Many organisms such as fishes, marine mammals, birds, rats, and humans, which reside at high trophic levels, have revealed these patterns [17, 18]. Despite the proven persistency of HBCD, data increasingly indicate that certain stereoisomers are transformed in the biota. For example, mass spectrometric evidences for the presence of some metabolites of HBCD (e.g., hydroxylated and debrominated byproducts) in HBCD-exposed biota have been reported [17, 19, 20]. Due to the potential risks to humans and the ecosystem by HBCD, proper remediation methods are now in great demand. It has been reported that HBCD could be photo-degraded [21] or reductively debrominated using several nanoparticles [22]. However, persistent organic pollutants accumulated in soil, sediment, and water bodies are not easily treated by these methods. In addition, the humic substrates and moisture content in soil can affect to the removal efficiency of organic pollutants [23]. In contrast to physical or chemical remediation, the microbiological 4

strategy is more environmentally relevant and cost-effective. However, the bioremediation of HBCD in aqueous matrices or soil is just beginning [24-26]. To investigate the potential of HBCD bioremediation, we have evaluated the association between HBCD and microbial diversity in various types of soil. And the HBCD transformation under both anaerobic and aerobic conditions was analyzed along with its stereoisomers. It was shown that this pollutant might have considerable effects on the soil microbial diversity. Additionally, improved understanding of the association between this pollutant and soil systems could increase the possibility of finding potential pollutant-utilizing microbes and stimulating factors for the bioremediation of HBCD in contaminated soil. 2. Materials and Methods 2.1. Materials All chemicals and solvents used were of the highest grade commercially available. t-HBCD, humic acid and glucose were purchased from Sigma Aldrich. Ultrapure (DI) water (resistivity 18.2 MΩcm) was obtained from a water purification system (Millipore, France). Extraction kits were obtained from various suppliers: Mega-spin agarose gel DNA extraction kit, i-genomic soil DNA extraction mini kit from iNtRON, Korea; PCR master mix and Premix SYBR Ex Taq-Tli RNaseH plus from TaKaRa. The commercial composting soil was supported from Hungnong Seed Co., Korea. 2.2. Degradation of HBCD under anaerobic and aerobic conditions To prepare the rhizosphere soil contaminated by HBCD, tobacco plants were grown for 35 days in soil in which t-HBCD was thoroughly mixed at a concentration of [HBCD] = 60 mg kg-1. In this study, two different groups of soil were chosen. The first group is a commercial composting 5

soil used for growing greenhouse plants. The composting soil was collected after harvesting the fully grown tobacco plants. As the collected soil was located in the root zone, it was considered as rhizosphere soil. Humic acid at 0.5% of the total weight was added to the soil before growing the plants. In addition, the second group of soil was collected (50 centimeters in depth) from a sawmill factory in Gyeongju city. The soil parameters, including pH, organic matters (OM), total organic carbon (TOC), cation exchange capacity (CEC) and electrical conductivity (EC), are described in Table 1. The second soil group, called non-rhizosphere soil, was also artificially contaminated using t-HBCD at [HBCD] = 60 mg kg-1 of soil and was stored at room temperature for 35 days. The artificially contaminated HBCD soil was prepared as following: HBCD was dissolved in acetone for [HBCD] = 1000 ppm. Each 100g of soil was thoroughly mixed with 100mL of HBCD solution and then acetone solvent was completely vapored from the soil. After that, the stock soils were added to 1.55 kg of sterilized soil and mixed well by an automatic mixer. After various treatments, each sample was dried in a freeze drier and then homogenized by a grinding system. 10 mg of each soil powder was characterized by Diffuse Reflectance Infrared Fourier Transform Spectroscopy (FTIR-DRIFT, Nicolet iS50 FT-IR spectrometer) with scanning wavenumber range of 500 – 4000 cm-1. Each sample was scanned 50 times with a resolution of 10 cm−1. To stimulate the microbes involved in HBCD degradation, the prepared soils were added to a mineral salts medium (MSM) in a ratio of soil: MSM = 1:5, and glucose (2% of weight) was supplied as a source of carbon and energy. The MSM was prepared as described elsewhere [27]. Four rhizosphere samples were considered: unmodified rhizosphere, rhizosphere with added humic acid, rhizosphere with glucose, and rhizosphere with both humic acid and glucose added. All samples were incubated on a shaker at 30 °C and 160 rpm for 40 days and were sampled every

6

10 days during this period. The controls used were the HBCD contaminated soils with sodium azide treatment (NaN3). HBCD is less persistent under anaerobic conditions [24], so the anaerobic experiment was conducted for a shorter period (21 days) than the aerobic HBCD treatment (40 days). The samples contaminated previously by HBCD for 35 days, including unplanted composting soil treated with NaN3 (control), rhizosphere soil with and without humic acid, and non-rhizosphere soil, were incubated at room temperature under anaerobic conditions for 21 days or under aerobic conditions for 40 days. The anaerobic treatments were sampled at 3, 7, 10, 14 and 21 days; the aerobic treatments were sampled at 10, 20, 30 and 40 days. All samples were stored at -70 °C before residual HBCD was quantified and before microbial diversity was investigated. 2.3. Investigating the diversity of soil microbes 2.3.1. Extraction of total DNA in HBCD contaminated soil To quantify the microbial DNA concentration and diversity of community, total DNA was extracted from soil. Measurements were performed using an i-genomic soil DNA extraction minikit (iNtRON, Korea) following manufacturer’s instructions. DNA concentration was measured using the UV-vis method. All samples were stored at -20 °C for next experiments. 2.3.2. Quantification of microbial concentration using RT-PCR Extracted

DNA

was

amplified

using

universal

primers

357F

CTCCTACGGGAGGCAGCAG -3’) and 518-R (5’-ATTACCGCGGCTGCTGG -3’),

(5’that

amplify a part of the 16s RNA gene. To quantify copies of DNA, a non-competitive real-time PCR experiment was performed using Premix SYBR Ex Taq (Tli RNaseH plus - TaKaRa). Each reaction used 10 µL of Premix solution, 0.4 µl of each primer at concentration of 10 pM, 1 µL of 7

samples or DNA standard, and 8.2 µL of sterilized distilled water. The PCR conditions were: 95 °C for 30 s (1 cycle); 95 °C for 10 s; 55 °C for 30 s and 72 °C for 30 s (45 cycles). The fluorescent signal was measured after annealing and dissociation steps. All reactions were conducted in a Thermal Cycler Dice Real Time TP800 system (TaKaRa). The number of copies was measured using a standard curve method. 2.3.3. Evaluation of microbial diversity using denaturing gradient gel electrophoresis The denaturing gradient gel electrophoresis (DGGE) experiment was conducted as described elsewhere [28] with a minor modification. Basically, DNA extracted from soil samples was amplified twice using PCR. The ratio of components in the reaction mixture was similar to that used

in

RT-PCR.

The

1st

PCR

condition

was:

universal

primers

27F

(5’-

AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-TACGGYTACCTTGTTACGACTT-3’); thermal condition: 98 °C for 1 min (1 cycle); 98 °C for 10 s, 56 °C for 30 s, 72 °C for 90 s (35 cycles); 72 °C for 10 min (1 cycle). The PCR master mix (TaKaRa) was used in this experiment. The PCR products (length ~ 1400 bp) were separated using electrophoresis in agarose gel (1.5%) and purified using the Mega-spin agarose gel DNA extraction kit (iNtRON). The purified DNA samples were then amplified by primers including GC-clamp, F357-GC (5’-CGCCCGCCGCGCGGCGGGCGGGGCGGGGGCACGGGGCCTACGGGAGGCAGCAG -3’), and 518R (5’-ATTACCGCGGCTGCTGG-3’). The PCR mixture had 50 L volume and contained 25 µL of master mix, 1 µL of each primer, 2.5 µL of DNA templates and 20.5 µL of DI water. Thermal condition: 94 °C for 4 min (1 cycle); 94 °C for 30 s, 54 °C for 30 s, 72 °C for 30 s (35 cycles); 72 °C for 5 min (1 cycle). The PCR products (length ~ 200 bp) were separated and purified using agarose gel (1.5%) electrophoresis. The final samples were used in DGGE analysis.

8

DNA samples 25 µL were mixed with 6x loading dye (iNtRON) and loaded into 20-60 % polyacrylamide gel gradient. The electrophoresis was conducted at 60 °C and 130 V for 4 h in TAE buffer. The final products were visualized by EtBr staining for 15 min under UV light (wavelength 306 nm). The DNA bands were collected and sequenced. 2.4. Analytical methods 2.4.1. Pretreatment of soil samples Soil samples were totally dried in a freeze dryer. A small amount of sodium sulfate (Na2SO4) was added to samples to completely remove water, then 20 ml of Hexane and dichloromethane (DCM) (ratio of volume 1: 1), was added to dried soil. The samples were shaken and sonicated for 30 min, then the extracted solutions were collected. The extraction step was repeated twice; the extracts were combined, filtered and gently dried in an evaporator. The extracts were re-dissolved in hexane to ~ 2 mL then cleaned by filtration through a silica column before analysis using LCMS/MS. Due to the complexity of soil components, the samples were cleaned as described elsewhere [29] using a silica column containing Na2SO4, deactivated silica, acidic silica, deactivated alumina and granular copper, after HBCD extraction. The purified samples in hexane were concentrated in the evaporator and transferred to GC vials. The samples were air-dried and re-dissolved in 1 mL methanol. The samples were stored at 4 °C before analysis. 2.4.2. LC-MS/MS analysis After clean-up, the HBCD extracted from soil was diluted by a factor of 100, then identified using LC-MS/MS. The analysis was performed using a C18 column (Synergi Hydro-RP, 150 x 200 mm, 4 µm), with 70% methanol as the solvent and 20% DI water with a flow rate of 9

0.3 ml min-1. The column temperature was maintained at 30 °C. Mass spectrometry was performed in an API 2000 system (Applied Biosystem, Foster City, CA) in negative ion turbo spray ionization mode. The operating condition of system applies 4500 V to the spray needle, and declustering potential of 20 V. The total HBCD removal conversion ratio was determined as 𝑅𝑒𝑚𝑜𝑣𝑎𝑙 𝐻𝐵𝐶𝐷 (%) = (1 −

𝐶𝑟𝑒𝑚𝑎𝑖𝑛𝑖𝑛𝑔 𝐶0

) 𝑥 100 .

[Eq. A.1]

The fractions of HBCD isomers were identified as 𝐹𝑟𝑎𝑐𝑡𝑖𝑜𝑛 𝑜𝑓 𝑖𝑠𝑜𝑚𝑒𝑟 (%) =

𝐶𝑖 ∑ 𝐶𝑖

𝑥 100.

[Eq.A.2]

where Cremaining is [HBCD] remaining in the samples, C0 is [HBCD] before treatment, Ci is concentration of HBCD isomer i ∈ , ,  , and ∑ 𝐶𝑖 is total [HBCD] calculated by summing the concentrations of the three isomers. 2.5. Statically analysis The experimental data were calculated from triple independently replicated experiments. The data was statically analyzed by Origin software version 9.1. 3. Results and Discussion 3.1. Transformation of HBCD in soil matrix under anaerobic conditions Under anaerobic conditions, HBCD decreased mostly in the non-rhizosphere soil and in the rhizosphere soil containing humic acid (Fig. 1A). After 21 days, 34% of the total HBCD was reduced from the samples of rhizosphere soil containing humic acid, and 35% of the total HBCD was removed from the non-rhizosphere soil; only 9% of the total HBCD was reduced from the 10

control, the HBCD contaminated soil with NaN3 treatment (unplanted compost soil), and 18.5% of the total HBCD was reduced from the rhizosphere soil. The results represented the adsorption of HBCD on soil materials, especially organic matters. The higher HBCD removal efficiency from the rhizosphere soil with humic acid than without humic acid indicates that humic acid can increase the removal of HBCD. The lower efficiency of HBCD removal in the rhizosphere soil without humic acid than in the non-rhizosphere soil under anaerobic conditions is due to the characteristics of the microbes and the organic matter contents of each type of soil. Various degradation rates of HBCD in soil under anaerobic conditions have been reported in previous studies [17, 25, 26]; the remediation efficiency was strongly affected by microbial activities, concentrations and mass transfer in the system considered [25]. The distribution of dominant HBCD isomers did not significantly differ in soil samples after various anaerobic treatments (Fig. 1B). The fraction of γ-HBCD was 74-79%, but the total percentages of α- and β–HBCD increased slightly during the treatments. The proportion of αHBCD increased because this isomer is more persistent than β– and γ-HBCDs under anaerobic conditions [17, 25]. However, Peng et al. [26] have isolated some anaerobic bacteria that degraded HBCD with high efficiency in the order α > β > γ. These results indicated that the microbes from different sources (sediments, sewage sludge, and continuous anaerobic bioreactors) would have various abilities to degrade different HBCD isomers. 3.2. Aerobic degradation of HBCD Under aerobic conditions with glucose as a carbon source, HBCD degradation by various microbes could be enhanced (Fig. 2). After 40 days, < 60% and 42% of the total HBCD were reduced in the rhizosphere and non-rhizosphere soils, respectively (Fig. 2A). The controls of rhizosphere soil and non-rhizosphere soil have been prepared by NaN3 treatment to avoid the 11

microbial activities. Only 4% and 9% of HBCD were decreased in the controls of non-rhizosphere and unplanted compost soils, respectively. The large content of organic maters in the compost soil (Table 1) could increase the absorption of HBCD onto soil and resulted in larger decrease of HBCD in that control. In addition, the microbes from the rhizosphere soil were more active due to supporting extra oxygen and nutrients during plant growth, so HBCD was more efficiently removed from the rhizosphere soil than from the non-rhizosphere soil under aerobic conditions. However, high percentages of HBCD remained in both groups of soil in aerobic treatments. These results concur with previous reports of aerobic HBCD degradation [24, 25]; Davis et al. [24] showed a 75% decrease of HBCD in soil over 119 days under aerobic conditions, whereas 60% of the total HBCD was removed in the rhizosphere soil after 40 days with the addition of humic acid (0.5% wt) and glucose in the present study. These components could increase the microbial activity and the solubility of HBCD. To assess the behavior of three dominant HBCD diastereoisomers in a realistic matrix, their distribution in different treatments was determined. γ-HBCD was always the most common isomer in both rhizosphere and non-rhizosphere soils. However, the γ-HBCD fraction decreased from > 70% to 52-56% in the samples containing glucose (Fig. 2B). The lower stability of γ-HBCD than of the other isomers towards biota activities [17, 25] would result in the decrease of this isomer. Previous reports also observed the in vivo stereoisomeric transformation of β- and γHBCDs to α-HBCD in biotas [20, 29]. However, the stability of isomers is the most important factor that determines their distribution in natural matrices and the effects of microbial activities on HBCD. Information on the aerobic biotransformation of HBCD is limited. Only Pseudomonas sp. strain HB01 has been identified to effectively degrade γ-HBCD under aerobic conditions; 12

however, this strain did not degrade α-HBCD [30]. The persistence of HBCD and its HBCD stereoisomers in aerobic environments can reduce the bioavailability [17, 24]. α-HBCD contains two equatorial bromine atoms, whereas γ-HBCD has two axial bromine atoms [30]; this structural difference could affect the affinity of debrominating enzymes for HBCD isomers and thereby result in various susceptibilities of HBCD isomers to microbial degradation. In addition, few microbial strains, including Pseudomonas sp. HB01 [30] and Rhodococcus rubber CD4 [31], were found to aerobically degrade cyclododecane (a non-halogenated analog of HBCD). 3.3. Relations between soil components and microbial activity during HBCD degradation The activity of microbes is significantly affected by the aeration and soil characteristics. In this study, the HBCD removal efficiency in the rhizosphere group was effective under aerobic conditions, whereas the degradation of HBCD in the non-rhizosphere group was higher under anaerobic conditions. It is noted that during plant growth, oxygen and nutrients could be enriched in the root zone [6], so the adaption of microbes in the rhizosphere soil under anaerobic conditions might be slower than that in the non-rhizosphere soil. In addition, the non-rhizosphere soil was collected at a depth of 50 centimeters from the top surface of soil, which indicated that there might be more anaerobic microbes presenting in the non-rhizosphere soil than in the rhizosphere soil. Moreover, the composting soil had higher acidic, EC and CEC values than those of the nonrhizosphere soil (Table 1). In soil systems, the electrical conductivity (EC) which is accompanied by water soluble cations, including Sodium (Na+), Potassium (K+), Calcium (Ca2+) and Magnesium (Mg2+), and pH shows a strong relationship with the metabolism of indigenous microbiota [32]. This interaction is more considerable for selective biostimulation, requiring the addition of an exogenous carbon and energy source, such as glucose or organic pollutants. Besides, the total organic carbon content shows a strongly positive correlation with all enzymatic activities 13

(including dehydrogenase, arylsulphatase, phosphatase, β-glucosidase and urease) and a weakly positive relation with microbial biomass [33]. One of the most important soil parameters influencing the effectiveness of bioremediation is organic matter content. It plays a crucial role in the bioavailability of pollutants, and impairs the survival of inoculated strains and their ability to degrade contaminants [34, 35]. In this study, since the rhizosphere soil originated from a composting process, the organic matter content should be much higher than that of the non-rhizosphere soil. In addition to the different activity of microbes in the two soil groups, the higher organic carbon content might affect the HBCD removal efficiency under anaerobic conditions. Greer and Shelton [36] also observed that the rate of 2,4dichlorophenoxyacetic acid degradation was lower in the high organic-matter soil than in the low organic-matter soil, presumably as a result of lower rates of desorption and microbial growth. To increase the amount of functionalized organic matters that might have effects on the HBCD degradation, we added a certain amount of humic acid to the soil samples. According to the HBCD removal in soil (Fig. 1 and 2), the rhizosphere soil amended with humic acid always showed higher HBCD degradation efficiency than the soil without the presence of humic acid under both aerobic and anaerobic conditions. Haluška et al. [37], investigating the degradation of polychlorinated biphenyls (PCBs) in different soils, showed that both the total organic matter and the content of aromatic carbons in humic acid played important roles in the survival and activity of the inoculants. Moreover, humic acid has been reported as a suitable method to solubilize organic pollutants in soil with mixed contaminants [38]. For those reasons, adding humic acid to soil was expected to increase the activities of soils and microbes in the removal of HBCD contamination. To more clearly understand the role of soil components, especially humic acid, we conducted a Fourier Transform Infrared Spectroscopy (FTIR) analysis of the soil samples (Fig. 3). The sharp 14

band at 1,605 cm−1 is generally attributed to aromatic C=C vibration, symmetric stretching of COO− groups, and H-bonded C=O of conjugated ketones [39]. Due to the high organic matter content, the spectra of FTIR for the unplanted composting soil had some more peaks representing C=O stretch (1721 cm-1), O-H bend (1419 cm-1), C-O stretch (1296 cm-1) and N-O stretch (1573 and 1383 cm-1) in comparison to the non-rhizosphere soil. Particularly, the rhizosphere soil showed a different pattern of FTIR, clearly demonstrating the effects of plant roots’ secretion of organic components and the microbial activity on soil composition. Herein, the shifted peaks of N-O stretch and C-O stretch (1029 cm-1 and 1000 cm-1), the existence of a peak at 1088 cm-1 representing polysaccharide–like compounds [40], and the increase of O-H bend (911 cm-1) indicated that those functional groups were dominant during the plant growth and the stimulation of microbes in the HBCD removal. In summary, various functional groups of organic matters were maintained by adding humic acid, which participated in the stimulation of microbes during the HBCD degradation in soil. 3.4. Effect of HBCD contamination on microbial community in soil 3.4.1. Relationship between microbial concentration and HBCD removal Evaluating the effect of HBCD contamination on microbes in soil is an important part of HBCD’s risk assessment. Assessing the effect of HBCD on the various groups of soil microorganisms is difficult due to many possible factors, including the persistence of HBCD and its stereoisomers, and the complex natural matrices in which it is embedded. In this study, the first task in evaluating the microbial activity was to use a q-PCR to quantify the population of microbes (represented as numbers of copies of DNA µg-1) during the treatment. In the non-rhizosphere soil samples, the DNA concentration during 40 days of treatment were of 2 ~ 13 times higher than in the non-rhizosphere soil without treatments (Fig. 4A). The quantity of microbes in the non15

rhizosphere samples containing glucose increased dramatically after 10 days (1027 times higher than in the sample of non-rhizosphere soil at day 0), then dropped to only 39 times higher than the initial value. This result indicates that glucose caused microbial blooms, but that only certain microbes could be maintained in the HBCD-contaminated conditions after the glucose was totally consumed. The microbe population in the rhizosphere increased slightly (2 ~ 5 times) during the treatment period, indicating that the microbes in the HBCD-contaminated rhizosphere grew stably. The concentration of microbes (Fig. 4A) well correlated with the HBCD removal efficiency (Fig. 4B). The concentration of microbes considerably increased in the non-rhizosphere soil with added glucose as a carbon source after 10 and 20 days of treatments. In other aspects, the HBCD removal efficiency in this soil continuously increased from 13-42% in the same period. The HBCD degradation activity lagged the increase of microbial population, possibly because microbes required time to adapt. The microbe numbers significantly increased during 20 days in the non-rhizosphere soil with added glucose; however, the residual [HBCD] was constant after 20 days. This can be explained by HBCD acting as a non-preferred carbon source for microbes in the non-rhizosphere soil. However, the microbial population did not significantly increase in the rhizosphere soil, indicating that the microbes had already adapted to the HBCD contamination and they maintained their activity during the HBCD degradation. In fact, [HBCD] continuously decreased in the rhizosphere soil samples; of the total HBCD, 41% was reduced from the rhizosphere soil without adding humic acid, and 57% was reduced from the rhizosphere soil with added humic acid. The proportion of α-HBCD in soil samples increased as a consequence of the resistance of this isomer to degradation by soil microbes. 3.4.2. Diversity of microbial community in HBCD-contaminated soil

16

The diversity of soil microbes in response to the HBCD contamination was investigated using a DGGE (Fig. 5, Fig. S1, Fig. S2). Numerous bands representing the microbial diversity were observed on the day 0 of treatments, whereas several selective species grew during the enrichment conditions. The number of Gram-positive bacteria, including Bacteroidetes bacterium and Bacillus sp. (both phylum Bacteroidetes), decreased during the treatment period. The population of Bacillus sp. significantly decreased in the rhizosphere samples containing humic acid and in the nonrhizosphere soil. In contrast, the population of Gram-negative bacteria (e.g., Sphingomonadales, Sphingomonas sp. and Brassia rhizosphere) increased. Some previous reports have assessed the biodegradation of HBCD by pure cultures consisting of Achromobacter sp. [26], Pseudomonas sp. [30] or Sphingobiumindicum B90A [41, 42]. Interestingly, the adaption trend of microbial community in the rhizosphere soil samples was more obvious than in the non-rhizosphere soil in which microbes had not been previously activated by plant metabolites. This study of the interaction between microbes and HBCD in soil assessed both the risk of HBCD and its bioavailability to the microbial community. Few previous reports have examined the HBCD-degrading bacteria or enzymes. In this study, we found that Alpha proteobacterium and Sphingomonas sp. quickly adapted to the HBCD-contaminated soil. Those genera had been reported to degrade HBCD [41] and other persistent organic compounds such as brominated diphenyl ethers [43], triclosan [44, 45], and chlorinated dibenzo-p-dioxins [46]. However, the similar structure of HBCD to that of hexachlorocyclohexanes (HCHs), which are toxic and persistent under aerobic conditions, could cause difficulty in finding effective cultures for degradation of this compound. 4. Conclusion

17

In this study, the soil components, especially organic matters such as humic acid, were shown to affect the HBCD degradation due to their significant influences on the microbial activity and the bioavailability of HBCD including the adsorption of HBCD on organic matters. The effects of humic acid and glucose on the microbial activity resulted in systematic changes in the reduction of HBCD as well as the proportion of HBCD isomers. In addition, the degradation of HBCD in the rhizosphere soil was higher than that of the non-rhizosphere soil under aerobic conditions. It represented that the microbes in the rhizosphere soil generated from the growth of tobacco plant were significantly promoted, showing high potential to remove HBCD aerobically. In stimulation of microbes during the HBCD degradation, the population structure of microbial community shifted to an increase of Gram negative bacteria and a decrease of Gram positive species. In summary, by providing the essential factors for the degradation of HBCD in soil, this study could introduce a critical insight into successful “in situ” bioremediation of contaminated soils.

Acknowledgments This work was supported by “The GAIA Project” by Korea Ministry of Environment (RE201402059).

18

References [1] D. Neumann, A. Heuer, M. Hemkemeyer, R. Martens, C.C. Tebbe, Importance of soil organic matter for the diversity of microorganisms involved in the degradation of organic pollutants, ISME J., 8 (2014) 1289-1300. [2] P. Conte, A. Agretto, R. Spaccini, A. Piccolo, Soil remediation: Humic acids as natural surfactants in the washings of highly contaminated soils, Environ. Pollut., 135 (2005) 515-522. [3] L.V. Gonod, F. Martin-Laurent, C. Chenu, 2,4-D impact on bacterial communities, and the activity and genetic potential of 2,4-D degrading communities in soil, FEMS Microbiol. Ecol., 58 (2006) 529-537. [4] G. Li, W. Huang, D.N. Lerner, X. Zhang, Enrichment of degrading microbes and bioremediation of petrochemical contaminants in polluted soil, Water Res., 34 (2000) 3845-3853.

19

[5] L. Philippot, J.M. Raaijmakers, P. Lemanceau, W.H. Van Der Putten, Going back to the roots: The microbial ecology of the rhizosphere, Nat. Rev. Microbiol., 11 (2013) 789-799. [6] M.B. Leigh, J.S. Fletcher, X. Fu, F.J. Schmitz, Root turnover: An important source of microbial substrates in rhizosphere remediation of recalcitrant contaminants, Environ. Sci. Technol., 36 (2002) 1579-1583. [7] E. Yergeau, S. Sanschagrin, C. Maynard, M. St-Arnaud, C.W. Greer, Microbial expression profiles in the rhizosphere of willows depend on soil contamination, ISME J., 8 (2014) 344-358. [8] H. Zhang, Y.Y. Kuo, A.C. Gerecke, J. Wang, Co-release of hexabromocyclododecane (HBCD) and nano- and microparticles from thermal cutting of polystyrene foams, Environ. Sci. Technol., 46 (2012) 10990-10996. [9] S. Esslinger, R. Becker, R. Maul, I. Nehls, Hexabromocyclododecane enantiomers: Microsomal degradation and patterns of hydroxylated metabolites, Environ. Sci. Technol., 45 (2011) 3938-3944. [10] N. Kajiwara, H. Takigami, Emission behavior of hexabromocyclododecanes and polybrominated diphenyl ethers from flame-retardant-treated textiles, Environ. Sci.: Process. Impacts, 15 (2013) 1957-1963. [11]

M.A.E.

Abdallah,

S.

Harrad,

A.

Covaci,

Hexabromocyclododecanes

and

tetrabromobisphenol-A in indoor air and dust in Birmingham, UK: Implications for human exposure, Environ. Sci. Technol., 42 (2008) 6855-6861.

20

[12] K. Janák, U. Sellström, A.K. Johansson, G. Becher, C.A. de Wit, P. Lindberg, B. Helander, Enantiomer-specific accumulation of hexabromocyclododecanes in eggs of predatory birds, Chemosphere, 73 (2008) S193-S200. [13] Y. Li, Q. Zhou, Y. Wang, X. Xie, Fate of tetrabromobisphenol A and hexabromocyclododecane brominated flame retardants in soil and uptake by plants, Chemosphere, 82 (2011) 204-209. [14] L.T.M. van der Ven, A. Verhoef, T. van de Kuil, W. Slob, P.E.G. Leonards, T.J. Visser, T. Hamers, M. Herlin, H. Håkansson, H. Olausson, A.H. Piersma, J.G. Vos, A 28-day oral dose toxicity study enhanced to detect endocrine effects of hexabromocyclododecane in Wistar rats, Toxicol. Sci., 94 (2006) 281-292. [15] K. Janák, A. Covaci, S. Voorspoels, G. Becher, Hexabromocyclododecane in marine species from the Western Scheldt Estuary: Diastereoisomer- and enantiomer-specific accumulation, Environ. Sci. Technol., 39 (2005) 1987-1994. [16] A.M. Peck, R.S. Pugh, A. Moors, M.B. Ellisor, B.J. Porter, P.R. Becker, J.R. Kucklick, Hexabromocyclododecane in white-sided dolphins: Temporal trend and stereoisomer distribution in tissues, Environ. Sci. Technol., 42 (2008) 2650-2655. [17] A. Covaci, A.C. Gerecke, R.J. Law, S. Voorspoels, M. Kohler, N.V. Heeb, H. Leslie, C.R. Allchin, J. De Boer, Hexabromocyclododecanes (HBCDs) in the environment and humans: A review, Environ. Sci. Technol., 40 (2006) 3679-3688. [18] S.H. Brandsma, L.T.M. Van Der Ven, J. De Boer, P.E.G. Leonards, Identification of hydroxylated metabolites of hexabromocyclododecane in wildlife and 28-days exposed Wistar rats, Environ. Sci. Technol., 43 (2009) 6058-6063. 21

[19] J. Hiebl, W. Vetter, Detection of hexabromocyclododecane and its metabolite pentabromocyclododecene in chicken egg and fish from the official food control, J. Agric. Food Chem., 55 (2007) 3319-3324. [20] H. Hakk, D.T. Szabo, J. Huwe, J. Diliberto, L.S. Birnbaum, Novel and distinct metabolites identified following a single oral dose of α- Or γ-hexabromocyclododecane in mice, Environ. Sci. Technol., 46 (2012) 13494-13503. [21] D. Zhou, Y. Wu, X. Feng, Y. Chen, Z. Wang, T. Tao, D. Wei, Photodegradation of hexabromocyclododecane (HBCD) by Fe(III) complexes/H2O2 under simulated sunlight, Environ. Sci. Pollut. Res., 21 (2014) 6228-6233. [22] C.P. Tso, Y.H. Shih, The transformation of hexabromocyclododecane using zerovalent iron nanoparticle aggregates, J. Hazard. Mat., 277 (2014) 76-83. [23] M. Cheng, G. Zeng, D. Huang, C. Lai, P. Xu, C. Zhang, Y. Liu, Hydroxyl radicals based advanced oxidation processes (AOPs) for remediation of soils contaminated with organic compounds: A review, Chem. Eng. J., 284 (2016) 582-598. [24] J.W. Davis, S. Gonsior, G. Marty, J. Ariano, The transformation of hexabromocyclododecane in aerobic and anaerobic soils and aquatic sediments, Water Res., 39 (2005) 1075-1084. [25] J.W. Davis, S.J. Gonsior, D.A. Markham, U. Friederich, R.W. Hunziker, J.M. Ariano, Biodegradation and product identification of [14C] hexabromocyclododecane in wastewater sludge and freshwater aquatic sediment, Environ. Sci. Technol., 40 (2006) 5395-5401.

22

[26] X. Peng, X. Huang, F. Jing, Z. Zhang, D. Wei, X. Jia, Study of novel pure culture HBCD-1, effectively degrading Hexabromocyclododecane, isolated from an anaerobic reactor, Biores. Technol., 185 (2015) 218-224. [27] P. Fortnagel, H. Harms, R.M. Wittich, S. Krohn, H. Meyer, V. Sinnwell, H. Wilkes, W. Francke, Metabolism of dibenzofuran by Pseudomonas sp. strain HH69 and the mixed culture HH27, Applied and Environmental Microbiology, 56 (1990) 1148-1156. [28] S.J. Green, M.B. Leigh, J.D. Neufeld, Denaturing Gradient Gel Electrophoresis (DGGE) for Microbial Community Analysis, in: K.N. Timmis (Ed.) Handbook of Hydrocarbon and Lipid Microbiology, Springer Berlin Heidelberg, Berlin, Heidelberg, 2010, pp. 4137-4158. [29] M.H. Son, J. Kim, E.S. Shin, S.H. Seo, Y.S. Chang, Diastereoisomer- and species-specific distribution of hexabromocyclododecane (HBCD) in fish and marine invertebrates, J. Hazard. Mat., 300 (2015) 114-120. [30] T. Yamada, Y. Takahama, Y. Yamada, Isolation of Pseudomonas sp. strain HB01 which degrades the persistent brominated flame retardant γ-hexabromocyclododecane, Biosci., Biotechnol. Biochem., 73 (2009) 1674-1678. [31] J.D. Schumacher, R.M. Fakoussa, Degradation of alicyclic molecules by Rhodococcus ruber CD4, Appl. Microbiol. Biotechnol., 52 (1999) 85-90. [32] M.P. Silverman, E.F. Munoz, Microbial metabolism and dynamic changes in the electrical conductivity of soil solutions: a method for detecting extraterrestrial life, J. Appl. Microbiol., 28 (1974) 960-967.

23

[33] G. Bonanomi, R. D’Ascoli, V. Antignani, M. Capodilupo, L. Cozzolino, R. Marzaioli, G. Puopolo, F.A. Rutigliano, R. Scelza, R. Scotti, M.A. Rao, A. Zoina, Assessing soil quality under intensive cultivation and tree orchards in Southern Italy, Appl. Soil Ecol., 47 (2011) 184-194. [34] A. Mrozik, Z. Piotrowska-Seget, Bioaugmentation as a strategy for cleaning up of soils contaminated with aromatic compounds, Microbiol. Res., 165 (2010) 363-375. [35] M. Chen, P. Xu, G. Zeng, C. Yang, D. Huang, J. Zhang, Bioremediation of soils contaminated with polycyclic aromatic hydrocarbons, petroleum, pesticides, chlorophenols and heavy metals by composting: Applications, microbes and future research needs, Biotechnol. Adv., 33 (2015) 745755. [36] L.E. Greer, D.R. Shelton, Effect of inoculant strain and organic matter content on kinetics of 2,4- dichlorophenoxyacetic acid degradation in soil, Appl. Environ. Microbiol., 58 (1992) 14591465. [37] L. Haluška, G. Barančíková, Š. Baláž, K. Dercová, B. Vrana, M. Paz-Weisshaar, E. Furčiová, P. Bielek, Degradation of PCB in different soils by inoculated Alcaligenes xylosoxidans, Sci. Total Environ., 175 (1995) 275-285. [38] X. Mao, R. Jiang, W. Xiao, J. Yu, Use of surfactants for the remediation of contaminated soils: A review, J. Hazard. Mat., 285 (2015) 419-435. [39] Z. He, J. Mao, C.W. Honeycutt, T. Ohno, J.F. Hunt, B.J. Cade-Menun, Characterization of plant-derived water extractable organic matter by multiple spectroscopic techniques, Biol. Fertil. Soils, 45 (2009) 609-616.

24

[40] R.R.E. Artz, S.J. Chapman, A.H. Jean Robertson, J.M. Potts, F. Laggoun-Défarge, S. Gogo, L. Comont, J.-R. Disnar, A.-J. Francez, FTIR spectroscopy can be used as a screening tool for organic matter quality in regenerating cutover peatlands, Soil Biol. Biochem., 40 (2008) 515-527. [41] N.V. Heeb, D. Zindel, B. Geueke, H.P.E. Kohler, P. Lienemann, Biotransformation of hexabromocyclododecanes (HBCDs) with LinB - An HCH-converting bacterial enzyme, Environ. Sci. Technol., 46 (2012) 6566-6574. [42] N.V. Heeb, S.A. Wyss, B. Geueke, T. Fleischmann, H.P.E. Kohler, W. Bernd Schweizer, H. Moor, P. Lienemann, Stereochemistry of enzymatic transformations of (+)β- and (-)β-HBCD with LinA2 - A HCH-degrading bacterial enzyme of Sphingobium indicum B90A, Chemosphere, 122 (2015) 70-78. [43] Y.M. Kim, K. Murugesan, Y.Y. Chang, E.J. Kim, Y.S. Chang, Degradation of polybrominated diphenyl ethers by a sequential treatment with nanoscale zero valent iron and aerobic biodegradation, J. Chem. Technol. Biotechnol., 87 (2012) 216-224. [44] Y.M. Kim, K. Murugesan, S. Schmidt, V. Bokare, J.R. Jeon, E.J. Kim, Y.S. Chang, Triclosan susceptibility and co-metabolism - A comparison for three aerobic pollutant-degrading bacteria, Biores. Technol., 102 (2011) 2206-2212. [45] S.I. Mulla, H. Wang, Q. Sun, A. Hu, C.P. Yu, Characterization of triclosan metabolism in Sphingomonas sp. strain YL-JM2C, Sci. Reports, 6 (2016). [46] I.H. Nam, Y.M. Kim, S. Schmidt, Y.S. Chang, Biotransformation of 1,2,3-tri- and 1,2,3,4,7,8hexachlorodibenzo-p-dioxin by Sphingomonas wittichii strain RW1, Appl. Environ. Microbiol., 72 (2006) 112-116.

25

Figure legends Figure 1: Removal of HBCD in soil under anaerobic conditions: (A) Remaining concentration of HBCD in rhizosphere and non-rhizosphere soils after the indicated time intervals; (B) Distribution of HBCD isomers (α-, β-, γ- HBCD) after 21 days of incubation. The error bars are given by the standard error of mean values. Control was the HBCD contaminated soil (unplanted commercial composting soil) with NaN3 treatment. Figure 2: Concentrations of HBCD in soil samples under aerobic conditions after 40 days: (A) Residual HBCD in Rhizosphere and non-rhizosphere soils; (B) Fractions of α-, β-, γ- HBCD isomers in soil samples, expressed as a percentage of the total HBCDs. The error bars are given by the standard error of mean values. Controls were the HBCD contaminated soils (unplanted commercial composting soil and non-rhizosphere soil) with NaN3 treatment Figure 3: FTIR spectra of rhizosphere and non-rhizosphere soils before the stimulation of microbes in HBCD degradation. Figure 4: Relationships between HBCD contamination and soil microbes under aerobic conditions: (A) Concentration of microbes, calculated as the number 𝑁 = 10

𝐶𝑇 −33.18 −2.045

of copies of

DNA per µg in soil samples, where CT = threshold cycle; (B) Removal of total HBCD in soil during 40 days of treatment. The error bars are given by the standard error of mean values.

26

Figure 5: Denaturing gradient gel electrophoresis (DGGE gel) of 16S ribosomal RNA genes amplified by PCR from total DNA of microbial community extracted from rhizosphere and nonrhizosphere soils contaminated with HBCD with over 40 days of aerobic incubation. The DNA bands identified by sequencing are labeled in numbers.

27

Figure 1

A

B

28

Figure 2

A

B

29

Figure 3

30

Figure 4

A

B

31

Figure 5

32

Table legends Table 1: Chemical characterization of commercial compost (group 1) and non-rhizosphere (group 2) soils

Soil

pH

EC (dS/m)

OM (%)

TOC (%)

T-N (%)

CEC (cmol/kg)

Group 1

5.1

10.94

52.90

30.68

0.581

90.73

Group 2

7.0

0.75

2.15

1.25

0.120

14.98

OM: organic matters ; TOC: total organic carbon, CEC: cation exchange capacity; EC: electrical conductivity.

33