Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori

Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori

YGCEN 11951 No. of Pages 8, Model 5G 6 October 2014 General and Comparative Endocrinology xxx (2014) xxx–xxx 1 Contents lists available at ScienceD...

2MB Sizes 0 Downloads 0 Views

Recommend Documents

A novel Lozenge gene in silkworm, Bombyx mori regulates the melanization response of hemolymph
•Three Runt-related (RUNX) transcription factors were identified and characterized in in Bombyx mori.•BmLz was highly ex

In vitro diapause substance in the silkworm, Bombyx mori
By means of in vitro studies, in which isolated suboesophageal ganglions of the Bombyx silkworm were cultured, it was sh

Identification of Plasmalogen in the gut of silkworm (Bombyx mori)
Herbivorous insect species are constantly challenged with endogenous and exogenous oxidative stress. Consequently, they

Novel female-specific trans-spliced and alternative splice forms of dsx in the silkworm Bombyx mori
The Bombyx mori doublesex gene (Bmdsx) plays an important role in somatic sexual development. Its pre-mRNA splices in a

The occurrence and synthesis of female- and egg-specific proteins in the silkworm, Bombyx mori
The occurrence of a specific protein, famale-specific protein, was demonstrated in the haemolymph of female pupae and eg

Pigmentary analysis of eggs of the silkworm Bombyx mori
•There was much more 3-hydroxy-kynurenine in diapause eggs than in non-diapause eggs.•High 3-hydroxy-kynurenine is essen

Properties of flacherie virus of the silkworm, Bombyx mori
The flacherie virus of the silkworm, Bombyx mori, was isolated from infected larvae reared under aseptic conditions. Two

Studies on “Sappe” disease of the silkworm, Bombyx mori
The effect of age of the larvae on the manifestation of the “Sappe” disease of the silkworm by oral inoculation of diffe

Solution structure of paralytic peptide of silkworm, Bombyx mori
Paralytic peptide of Bombyx mori (BmPP) is one of the multifunctional ENF-peptides; the name of “ENF” is the consensus N

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 General and Comparative Endocrinology xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen 5 6

Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori

3 4

8

Guanwang Shen, Ying Lin, Congwen Yang, Runmiao Xing, Haiyan Zhang, Enxiang Chen, Chaoshan Han, Hongling Liu, Weiwei Zhang, Qingyou Xia ⇑

9

State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, China

7

10 11 1 2 3 6 14 15 16 17 18 19 20 21 22 23 24 25

Q1

a r t i c l e

i n f o

Article history: Received 2 April 2014 Revised 1 September 2014 Accepted 20 September 2014 Available online xxxx Keywords: Silkworm E2 Sex-hormone function Vitellogenin Female typical characteristic

a b s t r a c t The vertebrate estrogens include 17-b-estradiol (E2), which has an analog in silkworm ovaries. In this study, the Bombyx mori vitellogenin gene (BmVg) was used as a biomarker to analyze the function of the E2 in silkworm. In most oviparous animals, Vg has female-specific expression. However, BmVg expression was also detected in B. mori males. Stage specific fluctuation of BmVg expression was similar in males and females, but expression levels in males were lower than in females. E2 treatment by injection or feeding of male larvae in the final instar stage induced and stimulated male BmVg transcription and protein synthesis. When silkworm ovary primordia were transplanted into males, BmVg was induced in male fat bodies. Transplanted ovaries primordia were also able to develop into ovaries and produce mature eggs. When females were treated with E2 promoted BmVg/BmVn protein accumulation in hemolymph, ovaries and eggs. However, BmVg transcription was decreased in female fat bodies. An E2 analog was identified in the hemolymph of day 3 wandering silkworms using high-performance liquid chromatography. Estradiol titers from fifth late-instar larvae to pupal stage were determined by enzyme-linked immunosorbent assay. The results suggested that silkworms synthesized a vertebrate E2 analog. This study found that E2 promoted the synthesis of BmVg, a female typical protein in silkworms. Ó 2014 Published by Elsevier Inc.

27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

44 45

1. Introduction

The sex hormone 17-b-estradiol (E2) is a vertebrate estrogen 47 that stimulates and maintains female sexual characteristics by pro48 moting the development and maturation of reproduction-related 49 tissues and organs in vertebrates. In 1979, Sandor and Mehdi pro50 posed that the vertebrate-type steroid hormone system is ancient 51 and might be shared by several or even all phyla of the animal 52 kingdom (Sandor and Mehdi, 1979). Using highly specific and sen53 sitive analytical techniques such as Gas Chromatograph–Mass 54 Spectrometer (GC–MS), Radio Immunoassay (RIA) analogs of 55 higher vertebrate steroid hormones such as progesterone, testos56 terone and E2 have been identified and confirmed their existence 57 Q3 in insect tissues or extracts (Bradbrook et al., 1990; Denlinger 58 et al., 1986; Mechoulam et al., 1984; Novak et al., 1990; Novak 59 and Lambert, 1989; Paesen and Deloof, 1988). 60 Although analogs of vertebrate Sex hormones have been found 61 in insects, little data address the functions of these hormones in 46

⇑ Corresponding author at: State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing 400716, China. Fax: +86 23 68251128. E-mail address: [email protected] (Q. Xia).

insects (Rothschild and Ford, 1964a,b). In 1985, investigators identified E2 analogs in silkworm ovaries using GC–MS (Ohnishi et al., 1985) and demonstrated that silkworm ovaries metabolize E2 in vitro (Fujimoto et al., 1986; Ogiso et al., 1986). Other investigators found that vertebrate E2 promotes nucleic acid synthesis in Bombyx mori silk glands (Keshan and Ray, 1998), and promotes the synthesis of malate dehydrogenase in female fat bodies of fifth instar silkworm larvae (Roy et al., 2007). Moreover, estrogenbinding protein is found in posterior silk glands, suggesting that the physiological effects of vertebrate estrogen in silk glands are receptor mediated (Keshan and Ray, 2001). The Vg genes of vertebrate oviparous animals respond to E2, this is to say that one important target of E2 is Vg (Arukwe and Goksoyr, 2003; Kang et al., 2002; Matozzo and Marin, 2008; Tyler et al., 1996; Zhao and Hu, 2012). Vg is used as a biomarker to detect environmental E2 (Kime et al., 1999). In most invertebrates except for insects, Vg genes respond strongly to vertebrate E2 (Garcia-Alonso et al., 2006; Novillo et al., 2005; Tada et al., 2008; Tominaga et al., 2003). B. mori vitellogenin (BmVg) is mainly synthesized in fat bodies of the female pupa, then secreted into hemolymph and absorbed into eggs as a nutrient for late embryonic development. BmVg is the precursor of the vitellin (BmVn)

http://dx.doi.org/10.1016/j.ygcen.2014.09.016 0016-6480/Ó 2014 Published by Elsevier Inc.

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 2 84 85 86 87 88 89 90 91 92 93 94 95

G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx

which is a major egg-yolk protein, and it represents a female typical characteristic (Xiang et al., 2005). A vertebrate E2 analog exists in silkworms and has physiological functions (Keshan and Ray, 2000), but the physiological effects of E2 in silkworms and the reasons for the effects are controversial. E2 regulates many physiological processes in vertebrates; however its main function is the sex hormone that regulates gender-related physiological processes. No studies have directly addressed if Q4 vertebrate E2 has sex hormone effects in insects. This study determined if silkworms produced an analog of vertebrate E2 and using BmVg as a biomarker for investigating if vertebrate E2 can stimulate and maintain female ‘typical traits’ in silkworms.

96

2. Materials and methods

97

2.1. Reagents

98 100

E2 and 20-hydroxyecdysone (20E) were from Sigma Chemical Company, USA. Hormones were dissolved in DMSO at a stock concentration of 1 mg/mL and stored at 20 °C.

101

2.2. Insects

102

107

The B. mori dazao strain was obtained from the silkworm gene bank at Southwest University, China. All larvae were reared on fresh mulberry tree leaves (Morus sp.) and pupae were maintained at room temperature until eclosion. On the first and second day of the fifth instar stage, larvae were separated into males and females based on the differential presence of reproductive buds.

108

2.3. Ovary transplants and hormone treatment

109

125

Silkworms at the third day of the fifth instar larval stage were sterilized by 70% (v/v) ethanol and kept on ice for 5 min as an anesthetic. Two ovaries without fat bodies were removed from females and put into males. After surgery, wounds were sealed with nail varnish. Larvae were kept at 16 °C and not fed until the nail varnish dried. Subsequently, both experimental and control silkworms were maintained at room temperature. After eclosion, moths were dissected and eggs collected for protein extraction. The target protein, BmVn, was detected by Western blot and immunofluorescence histochemistry. Different doses of hormone (as nmol/g body weight), based on the needed amount, were dissolved in 600 lL or 2 mL sterile water and introduced through stomata applied by injection of 10 lL with a capillary needle into silkworms or spraying on mulberry leaves and feeding silkworms at different developmental stages. Controls were treated with 10 lL 0.3% DMSO. Each experimental group contained 60 larvae.

126

2.4. Sample collection

127

135

Silkworms were dissected and hemolymph, fat bodies and ovaries were collected in sterile PE tubes and stored at 80 °C. To prevent melanization of hemolymph, 2 mmol/L phenylthiourea solution was added. Hemolymph samples were centrifuged at 5000g for 10 min at 4 °C and the supernatant was diluted 20-fold with PBS (NaCl 137 mmol/L, KCl 2.7 mmol/L, Na2HPO4 10 mmol/L, KH2PO4 1.8 mmol/L, pH 7.4) and stored at 80 °C. Fat bodies, ovaries, and hemolymph samples from 15 silkworms were pooled to represent different dates and treatments.

136

2.5. Semi-quantitative RT-PCR and quantitative RT-PCR

137

Total RNA was extracted using a TRIzol reagent kit (Invitrogen, Carlsbad, CA) with DNase treatment reagent, and M-MLV reverse

99

103 104 105 106

110 111 112 113 114 115 116 117 118 119 120 121 122 123 124

128 129 130 131 132 133 134

138

transcriptase (Invitrogen, Carlsbad, CA) was used to generate first-strand cDNA. All kits were used according to the manufacturer’s instructions. Semi-quantitative RT-PCR for BmVg (NM_001043844.1) used primers forward, 50 CCACCCTCAATAA Q5 CTTCTAC30 , and reverse, 50 AGGTATGTATCCTTGTGCC30 . PCR was 94 °C for 5 min; 20 cycles for female samples and 32 cycles for male samples of 94 °C for 30 s, 53 °C for 30 s and 72 °C for 1 min; 72 °C for 10 min. Products were confirmed by electrophoresis using 1% (w/v) agarose gels. BmActin3 was used as a control. Primers were forward, 50 AACACCCCGTCCTGCTCACTG30 and reverse, 50 GGGCGAGACGTGTGATTTCCT30 . PCR was 94 °C for 5 min; 20 cycles of 94 °C for 30 s, 53 °C for 30 s and 72 °C for 1 min; 72 °C for 10 min. Quantitative reverse transcription PCR (qRT-PCR) used SYBR Premix Ex TaqTM (TaKaRa Biotech, Japan) and an ABI StepOne v2.1 Sequence Detection System (Applied Biosystems) to determine BmVg mRNA to evaluate the effects of hormone or ovaries on silkworms. The mRNA levels of BmVg were calculated with the 2DDC t method (Livak and Schmittgen, 2001). BmVg (NM_001043844.1) qRT PCR primers were forward, 50 AGTCACGACGAATACCAAGAAGAT30 and reverse, 50 TACGATAGT CCTGTGTGAAAACG30 . The silkworm translation initiation factor 4A (BmTIF4A) was used as an endogenous control. Primers were forward BmTIF4A (NM_001043911.1), 50 TTCGTACTGGCTCTTCT CGT30 and reverse BmTIF4A 50 CAAAGTTGATAGCAATTCCCT30 . Three independent replicates were done.

139

2.6. SDS–PAGE and Western blotting

164

Total protein samples were quantified using a BCA reagent kit (Invitrogen, Carlsbad, CA) and 40 lg protein per sample was subjected to SDS–PAGE (8% w/v polyacrylamide) according to the method of Laemmli (1970). For Western blotting, proteins were electrophoretically transferred to polyvinylidene difluoride membranes (Roche, Indianapolis, IN). Anti-BmVg (stored in our lab (Lin et al., 2013)) was diluted 1:10,000 in 1% (wt/vol) BSA in TBST (10 mmol/L Tris–HCl, pH 7.5, 150 mmol/L NaCl, 0.05% Tween 20). Second antibody was horseradish peroxidase-conjugated goat anti-rabbit IgG diluted 1:20,000 (Beyotime, China) in blocking buffer. Bound horseradish peroxidase-conjugated antibodies were detected by an ECL enhanced chemiluminescence system (Thermo, USA) and photographed using a Clinx ChemiScope 3400 Mini (Science Instrument, China).

165

2.7. Immunofluorescence histochemistry

179

Unfertilized eggs were fixed in 4% (vol/vol) formaldehyde at 4 °C overnight. Tissues were embedded in paraffin and 5 lm sections were treated with primary antibody anti-BmVg and secondary antibody Alexa Fluor 488 goat anti-rabbit IgG (H + L) (Invitrogen, Carlsbad and CA). Primary and second antibodies were used at 1:200 for 1 h. Sections were examined under a fluorescence microscope (DMI4000B; Leica).

180

2.8. Identification of an E2 analog in silkworm hemolymph by high-performance liquid chromatography

187

A 9-fold volume of acetonitrile was added to each hemolymph sample before incubation at 25 °C for 12 h under gentle horizontal agitation. After centrifugation at 10,000g 4 °C for 30 min, supernatant was evaporated in vacuo, dissolved with 10 mL 5% methanol and loaded on C18 SPE columns pretreated with 3 mL methanol followed by 3 mL milli-Q water at a flow rate of 1 mL/min. Columns were dried under vacuum and 500 lL methanol was used to elute samples. To identify the E2 analog, C18 (250 mm  4.6 mm inner diameter, 5 lm particle) columns were used. Column temperature was

189

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163

166 167 168 169 170 171 172 173 174 175 176 177 178

181 182 183 184 185 186

188

190 191 192 193 194 195 196 197 198

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx 199 200 201 202 203

40 °C and the mobile phase was acetonitrile and Milli-Q water (45:55, v/v). Injection volume was 10 lL and flow rate was 1 mL/min. Detection wavelength was 230 nm. The detection of E2 was as described in the manufacturer’s instructions for an E2 ELISA kit (IBL, Germany).

204

3. Results

205

3.1. BmVg synthesis induced by E2 and ovaries in male silkworms

206

Similar to most oviparous animals, BmVg was highly expressed in female silkworms, but was also detected in males at about 130-fold lower levels as compared to females (see Figs. 1A and 2A). BmVg expression in males started at 48 h and peaked 72 h after wandering (Fig. 1A). At 60 h of wandering, male silkworms were injected with different doses of E2 (0.5/5/50 nmol/g body weight). After 12 h, analysis by qRT-PCR and RT-PCR found that 0.5 and 5 nmol/g body weight E2 resulted in elevated BmVg level in fat bodies. Maximum E2-induced expression of Vg was seen at 5 nmol/g body weight compared to control. After 24 h, analysis of BmVg in hemolymph by Western blots suggested that males injected with 0.5 or 5 nmol/g body weight E2 resulted in elevated BmVg protein synthesis (Fig. 1B). To confirm that E2 induced BmVg expression, 5 nmol/g body weight E2 or 20E was injected into silkworm larvae at 36 h of wandering when endogenous BmVg expression was low. After

207 208 209 210 211 212 213 214 215 216 217 218 219 220 221

3

12 h, qRT-PCR and RT-PCR analysis showed that BmVg was induced by E2 or ovaries, which up-regulated BmVg expression in male fat bodies (Fig. 1C). Treatment with 20E had no significant effect on BmVg transcription at the same timepoint (Fig. 1C). At 72 h of wandering, when endogenous BmVg had maximum expression, qRT-PCR and RT-PCR detected BmVg transcripts in fat bodies and Western blots detected BmVg in hemolymph from males into which ovarian primordia were introduced at fifth instar day 3. The results showed that BmVg significantly increased compared to controls (Fig. 1D). Ovarian primordia from fifth instar female silkworms that developed in males produced eggs, although the eggs developed in males were whiter than controls. SDS–PAGE showed that the main egg proteins were similar to the proteins in eggs from females. In addition, the content of BmVg in eggs produced by ovarian primordia in males was increased significantly compared to ovarian primordial in females (Fig. 1E). This result showed that E2 stimulated fat bodies to synthesize BmVg and that ovaries in males absorbed and accumulated BmVg from hemolymph. These results showed that E2 promoted BmVg synthesis and indicated that Transplantation of ovaries in male has a similar effect on Vg expression than the injection of E2.

222

3.2. Effects of E2 and ovaries on BmVg synthesis in female silkworms

243

RT-PCR and qRT-PCR showed that BmVg expression was high in female fat bodies from wandering 60 h and peaked at wandering

244

Fig. 1. Synthesis of male BmVg by E2 and ovaries induced. (A) BmVg transcripts in male silkworm fat bodies from 0 h after wandering to the second day of pupa by qRT-PCR/ RT-PCR. (B) Fifth instar larvae were treated at 60 h after wandering with 0.5, 5, 50 nmol/g body weight of E2 and qRT-PCR/RT-PCR was used to analyze BmVg transcripts in fat bodies at 12 h after hormone treatment. Western blots detected BmVg in hemolymph 24 h after hormone treatment. (C) BmVg transcripts by qRT-PCR/RT-PCR of fat bodies in normal males at 12 h after hormone treatment (E2/20E at 5 nmol/g-body weight injected into body cavities at 36 h after wandering) and fat bodies in male with transplanted ovaries at day 3 of fifth instar stage. (D) Male silkworms were transplanted ovaries in day 3 of fifth instar larvae. BmVg transcripts detected by qRT-PCR/RT-PCR of fat body of wandering 72 h larvae and Western blots of BmVg in hemolymph at the first day of pupa. (E) Analysis of total proteins in ovaries and eggs by SDS–PAGE and Western blots. C: control, TO: transplanted ovary, DM: development in males, DF: development in females, P1/P2: the first/s day of pupa. All values are mean ± SD of three biological replicates. ⁄ Significance, 0.05; ⁄⁄significance, 0.01 level (t-test) compared with control group; NS, no significant difference at 0.05 level.

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242

245

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 4

G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx

Fig. 2. Effects of E2 on BmVg synthesis in female silkworms. (A) Detection of BmVg transcripts in female fat bodies by qRT-PCR/RT-PCR from 0 h after wandering to the second day of pupa. (B) 0.5 nmol/g body weight E2 treatment at wandering 60 h and the first day of pupa with qRT-PCR detection of BmVg transcripts at 12 h after E2 treatment. (C) Female silkworm ovaries were removed at day 2–3 fifth instar stage. BmVg transcripts detected by qRT-PCR of fat bodies at 72 h after wandering and the second day of pupa. (D) Western blots for BmVg in hemolymph and ovaries from day 3 pupae and BmVn in unfertilized eggs. (E) Purified BmVg treatment at 36 h after wandering or the first day of pupa with qRT-PCR detection of BmVg transcripts at 12 h after treatment and Western blots for BmVn in unfertilized eggs. (F) Immunohistochemistry for BmVn protein in unfertilized eggs. C: control, RO: silkworms with removed ovaries. All values are mean ± SD of three biological replicates. ⁄Significant differences at 0.05 level, ⁄⁄significance at 0.01 level (t-test) compared with control group; NS, no significant difference at the 0.05 level.

246 247 248 249 250 251 252 253

72 h, decreasing to a low level at the first day of pupa (Fig. 2A). E2 was injected into female silkworm hemolymph at 5 nmol/g body weight at 60 h wandering and the first day of pupa. Silkworms were sacrificed at 12 h after injection. In contrast to males, 5 nmol/g body weight E2 downregulated BmVg expression (Fig. 2B). In fifth instar female larvae, after ecdysis 1 or 2 days, ovaries were removed qRT-PCR showed that BmVg was significantly increased in fat bodies at wandering 72 h and the second day of

pupa compared with normal female silkworms (Fig. 2C). Western blots showed BmVg protein accumulation in hemolymph in day 3 pupae without ovaries. E2 treatment promoted an increase in BmVg in day 3 pupae hemolymph and ovaries and BmVn in eggs (Fig. 2D). We investigated if BmVg protein accumulation in hemolymph was the reason that BmVg had upregulated expression in the fat bodies of silkworms without ovaries. Silkworms were treated with

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

254 255 256 257 258 259 260 261

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx 262 263 264 265 266 267 268 269 270

271 272 273 274 275 276 277 278 279 280 281 282 283 284 285

286 287 288 289 290 291 292

purified BmVg protein at 2 lg/g body weight at wandering 36 h, when BmVg expression was low, and at the first day of pupa when BmVg was reduced. After treatment for 12 h, qRT-PCR showed that BmVg expression in silkworm fat bodies was similar controls. Western blots showed that only treatment with BmVg at the first day of pupa increased BmVn in eggs (Fig. 2E). Immunohistochemistry revealed that treatment with purified BmVg at the first day of pupa in female silkworms caused a significant rise in BmVn protein staining in unfertilized moth eggs (Fig. 2F). 3.3. Effects of E2 on male fifth instar larvae maturation compared with 20E Different doses of E2 and 20E (2, 5, 10 nmol/g/day body weight with 60 silkworms per test) on mulberry leaves were fed to male silkworm fifth instar larvae at days 3–6. Statistical analysis after 12 h of the fourth hormone feeding showed that both E2 and 20E promoted male silkworm wandering. High concentrations of 20E (5 or 10 nmol/g/day body weight) had greater effects, advancing wandering by 24 h (Fig. 3A). qRT-PCR of BmVg transcripts at 36 h and 72 h of the fourth feeding found that E2 and 20E dosedependently induced BmVg transcription. E2 induced BmVg transcription in male silkworm fat bodies earlier (at 36 h) than 20E (at 72 h) (Fig. 3B and C). These results indicated that the speed of action to increasing BmVg levels of E2 in silkworms was different to 20E. 3.4. Effects of E2 on female fifth instar larvae maturation and BmVn accumulation in eggs compared with 20E Similar to experiments with males, different doses of E2 and 20E (2, 5, 10 nmol/g/day body weight with 60 silkworm per test) were given on mulberry leaves from day 3 to day 6 fifth instar female larvae. Compared with controls, E2 and 20E advanced silkworm wandering by 12 h (Fig. 4A). QRT-PCR showed that both E2 and

5

20E caused BmVg transcription to decrease after 36 h at the fourth feeding (Fig. 4B). However, after 72 h, 20E induced BmVg transcription while E2 inhibited BmVg transcription (Fig. 4C). Western blots showed that both E2 and 20E caused BmVn to accumulate in unfertilized eggs. E2 and 20E treatment caused a significant rise in BmVn in eggs, but E2 had a greater effect than 20E (Fig. 4D). Analysis of 1000 eggs found that low concentrations of E2 increased the unfertilized egg weight, but 20E did not (Fig. 4E). These results suggested that E2 promoted the absorbtion of BmVn by ovaries and affected egg formation.

293

3.5. Identification and titration of an E2 analog in silkworm hemolymph

303

An E2 analog was identified in hemolymph using a highperformance liquid chromatography–ultraviolet (HPLC–UV) method (Fig. 5A and B). The titer of the E2 analog was determined from the wandering to the pupal stage by ELISA. The results showed that the E2 analog increased in female silkworm hemolymph from 98.73 ± 2.20 pg/mL at silkworm wandering 0 h to 119.36 ± 5.27 pg/mL at 36 h, then decreased to 98.49 ± 5.24 pg/ mL at 72 h. At the second day of pupa, the titer increased again to 118.68 ± 8.60 pg/mL (Fig. 5C). Titers of the E2 analog in male hemolymph were 112.76 ± 2.02 pg/mL at 48 h, decreasing to 92.44 ± 6.24 pg/mL at 72 h and rising to 113.31 ± 3.78 pg/mL at the first day of pupa. At other times, the E2 titer was constant (Fig. 5D). These results revealed that an E2 analog existed in both female and male silkworms that might have been synthesized by the silkworms.

305

4. Discussion

320

BmVg is a female typical protein, but small amounts (at about 130-fold lower levels as compared to females. Figs. 1 and 2) were detected in males. The similarity of the transcriptional profile of

321

Fig. 3. Analysis of male silkworms effects by feeding E2 or 20E. (A) Percentage statistical analysis (n = 60) of the wandering rate of male silkworms fed E2 or 20E four times at 2 nmol/g, 5 nmol/g or 10 nmol/g. Wandering rate was calculated from 12 h to 72 h after fourth feeding. BmVg transcripts by qRT-PCR in male fat bodies treated with E2 or 20E at 36 h (B) and 72 h (C) after the fourth feeding. All values are mean ± SD of three biological replicates. ⁄Significance, 0.05; ⁄⁄significance, 0.01 level (t-test) compared with control group.

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

294 295 296 297 298 299 300 301 302

304

306 307 308 309 310 311 312 313 314 315 316 317 318 319

322 323

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 6

G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx

Fig. 4. Analysis of female silkworms effects by feeding E2 or 20E. (A) Statistical analysis (n = 60) of the wandering rate of female silkworms fed E2 or 20E for 4 days at 2 nmol/ g, 5 nmol/g or 10 nmol/g. Data were calculated from 12 h to 72 h after the fourth feeding. BmVg transcripts by qRT-PCR in female fat bodies treated with E2 or 20E at 36 h (B) and 72 h (C) after fourth feeding. (D) Western blot for BmVn in unfertilized eggs from moths fed E2 or 20E four times at 2 nmol/g, 5 nmol/g or 10 nmol/g at day 3, 4, 5, and 6 of the fifth instar stage. (E) Weight of eggs (n = 1000) after hormone treatment. All values are mean ± SD of three biological replicates. ⁄Significance, 0.05; ⁄⁄significance, 0.01 level (t-test) compared with control group; NS, no significant difference at 0.05 level.

324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344

BmVg in males and females indicated that male silkworms might have innate feminine qualities. Due the expression amounts of BmVg in male and female silkworms are greatly different we used more PCR cycle numbers for the male than female in order to increase the PCR products (see Section 2.5) in which DNA bands Q6 can be observed under UV light successfully. Recovered and purified PCR products which analyzed by sequencing confirmed that they are just the portion of BmVg. The reason why Yano et al. did not detect BmVg expression in males may be due to the limited sensitivity of their methods (Yano et al., 1994). This phenomenon is possibly the result of Double Sex in male silkworms, a gene that controls BmVg (Suzuki et al., 2003) but does not inhibit BmVg expression completely. In addition, 20E in silkworms also induced BmVg expression (Xu et al., 2014), 20E occurs in the metamorphosis stage for pupation and in the same time BmVg began to express. To evaluate the functions of vertebrate E2 functions in silkworms, we determined the timing of BmVg expression in silkworm fat bodies and selected a suitable period for hormonal treatment using BmVg as a biomarker of silkworm female typical protein. This study demonstrated that vertebrate E2 induced BmVg synthesis in a dose-dependent manner in males. The results suggested that the

vertebrate sex hormone E2 had a sex hormone function that could induce and maintain female typical protein-BmVg levels in male silkworms. In females, E2 also increased BmVg protein in female silkworms, consistent with a previous report (Das and Ray, 2014). However, the fact that BmVg transcripts were reduced in female silkworms is difficult to explain at this stage. The regulation of BmVg synthesis after E2 treatment in females might be different from males or the female BmVg response to E2 might use a different pathway or other tissue(s). These possibilities have not yet been explored. A previous study showed that Drosophila Vg synthesis is regulated by 20E (Bownes et al., 1983). Our study used 20E as a control, although both E2 and 20E treatments increased BmVn in female moth eggs. However, when BmVg was expressed at a low level (At the silkworm wandering 36 h, the endogenous BmVg substantially did not begin to express) in E2-treated or 20E-treated male silkworms, only E2 induced BmVg transcription. After feeding males with E2 and 20E, the BmVg response to 20E was later than the response to E2. These results suggested that E2 and 20E regulated BmVg expression in fat bodies in different ways. Ovaries transplanted into male silkworms developed normally and produced eggs, consistent with the results of Yamashita and

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx

7

Fig. 5. Identification of the E2 analog in silkworm hemolymph. (A) Detection of E2 standard by HPLC. (B) Target compounds from silkworm hemolymph at 72 h after wandering by HPLC. ELISA for E2 titer in (C) female and (D) male silkworm hemolymph from 0 h after wandering to the second day of pupa. All values are mean ± SD of three biological replicates. ⁄Significance, 0.05 level (t-test) compared with control group.

366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405

Irie (1980). However, Yamashita et al. failed to detect BmVg in eggs that developed in male silkworms because of the limited sensitivity of their methods. Our study confirmed that ovary primordia from fifth instar female silkworms developed and produced eggs in males and showed that eggs developed in males contain BmVn. However, ovaries in males produced fewer eggs than ovaries in females. Similar studies have been done in other insect species, such as the induction of Vg expression by transplanted oocytes in male Diploptera punctata and Pieris brassicae (Karlinsky and Lamy, 1976; Mundall et al., 1979). Another study showed that the synthesis of Vg is controlled by ovaries in Aedes aegypti (Hagedorn and Fallon, 1973), address Putative origin of E2/20E in different silk moth tissues, especially focusing on the ovaries. Removal of female silkworm ovaries resulted in increased BmVg expression in fat bodies and BmVg protein in hemolymph. To investigate whether BmVg accumulation in hemolymph promoted BmVg expression, BmVg was injected into silkworm hemolymph at wandering stage 36 h and the first day of pupa. The results did not show significant differences in BmVg transcription in female fat bodies between treatment and control groups. However, treatment with purified BmVg at the first day of pupa increased the BmVn protein concentration in unfertilized moth eggs. These results suggested that BmVg appeared prematurely in silkworm hemolymph and was unable to be absorbed and resolved. This result might be related to ovary development and ovarian selectivity in absorbing BmVg at certain time points. A number of insects have vertebrate estrogen analogs, but hypotheses about the sources of these analogs in insects are divergent (Amin and Bassiouny, 1979; Dube and Lemonde, 1970; Lehoux and Sandor, 1970; Svoboda et al., 1978; Swevers et al., 1990, 1991). Keshan et al. determined E2 titer in fifth instar larvae of silkworm found it also have fluctuation in hemolymph (Keshan and Ray, 2000), but in this stage of silkworm which eat big amount mulberry leaves cannot exclude the food sources of E2 and cannot confirm if the silkworm can synthesize E2 by itself. In this study, E2 analog titers were measured after silkworm stopped eating mulberry leaves. The E2 analog did not decrease but increased in hemolymph, indicating that silkworms synthesized E2 analog in vivo. Vertebrate sex hormones are mainly synthesized in ovaries. Our experiments found that ovaries transplanted into male silkworms

promoted the expression of BmVg in fat bodies and the ovaries produced eggs. These results suggested that silkworm E2, similar to vertebrates, was synthesized in gonads such as ovaries. Female silkworm pupal powder extracts have significant estrogenic effects in mice (Yang et al., 2010). Silkworm pupae contain large amounts of 20E, but estrogenic effects from 20E have not been observed in higher animals (Dinan and Lafont, 2006). These data suggested that the estrogenic effects of silkworm pupal powder extracts in mice were more similar to E2 effects than 20E effects. Whether E2 ana- Q7 logs in silkworms are E2 or only structurally similar to vertebrate E2 is not known. Both estrogen and 20E are steroids, but their differences and connections to silkworm physiological functions are unknown. More experiments and validation in other insects are needed. We have limited our discussion to vertebrate estrogen sex hormone functions in silkworms.

406

5. Conclusions

421

1. Male silkworms had a feminine characteristic that expressed small amounts of female typical protein-BmVg that was induced by estrogen and ovaries. 2. A vertebrate E2 analog was synthesized in silkworms and it has the similar functions for inducing BmVg and advancing silkworm wandering.

423 422

407 408 409 410 411 412 413 414 415 416 417 418 419 420

424 425 426 427 428 429

Acknowledgments

430

431 This study was supported by the National Basic Research Program of China (No. 2012CB114600), the Hi-Tech Research and Q8 432 433 Development Program of China (No. 2011AA100306) and the Q9 434 National Natural Science Foundation of China (No. 31101768).

Appendix A. Supplementary data

435

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ygcen.2014. 09.016.

436

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

437 438

YGCEN 11951

No. of Pages 8, Model 5G

6 October 2014 8

G. Shen et al. / General and Comparative Endocrinology xxx (2014) xxx–xxx

439

References

440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501

Amin, E.S., Bassiouny, A.R., 1979. Estrone in Olea europaea kernel. Phytochemistry 18 (344-344). Arukwe, A., Goksoyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2, 4. Bownes, M., Blair, M., Kozma, R., Dempster, M., 1983. 20-Hydroxyecdysone stimulates tissue-specific yolk-protein gene-transcription in both male and female drosophila. J. Embryol. Exp. Morphol. 78, 249–268. Bradbrook, D.A., Clement, C.Y., Cook, B., Dinan, L., 1990. The occurrence of vertebrate-type steroids in insects and a comparison with ecdysteroid levels. Comp. Biochem. Physiol. B 95, 365–374. Das, Shantanu., Ray, A.K., 2014. Possible alteration of female specific protein by estradiol-17b in silkworm, Bombyx mori L. Proc. Zool. Soc. 67, 38–42. Denlinger, D.L., Brueggemeier, R.W., Mechoulam, R., Katlic, N., Yocum, L.B., Yocum, G.D., 1986. Estrogens and androgens in insects. J. Cell. Biochem. (61–61). Dinan, L., Lafont, R., 2006. Effects and applications of arthropod steroid hormones (ecdysteroids) in mammals. J. Endocrinol. 191, 1–8. Dube, J., Lemonde, A., 1970. The origin of progesterone in the confused flour beetle (Tribolium confusum). Experientia 26, 543–544. Fujimoto, Y., Ikekawa, N., Ogiso, M., Ohnishi, E., 1986. Characterization of 17-betaestradiol 3-(beta-D-glucopyranoside) and 17-(alpha-D-glucopyranoside) as the metabolites of 17-beta-estradiol in the cultured ovaries of the silkworm, Bombyx mori. Experientia 42, 567–568. Garcia-Alonso, J., Hoeger, U., Rebscher, N., 2006. Regulation of vitellogenesis in Nereis virens (Annelida: Polychaeta): effect of estradiol-17 beta on eleocytes. Comp. Biochem. Physiol. A 143, 55–61. Hagedorn, H.H., Fallon, A.M., 1973. Ovarian control of vitellogenin synthesis by the fat body in Aedes aegypti. Nature 244, 103–105. Kang, I.J., Yokota, H., Oshima, Y., Tsuruda, Y., Yamaguchi, T., Maeda, M., Imada, N., Tadokoro, H., Honjo, T., 2002. Effect of 17beta-estradiol on the reproduction of Japanese medaka (Oryzias latipes). Chemosphere 47, 71–80. Karlinsky, A., Lamy, M., 1976. Juvenile hormone and vitellogenesis in male of Pieris brassicae L. Ann. Endocrinol. (Paris) 37, 529–530. Keshan, B., Ray, A.K., 1998. Action of estradiol-17 beta on the synthetic activity of the silk gland in Bombyx mori L. J. Insect Physiol. 44, 491–498. Keshan, B., Ray, A.K., 2000. Estradiol-17beta in Bombyx mori: possible significance and its effect on silk production. J. Insect Physiol. 46, 1061–1068. Keshan, B., Ray, A.K., 2001. The presence of estradiol-17 beta and its specific binding sites in posterior silk gland of Bombyx mori. Gen. Comp. Endocrinol. 123, 23–30. Kime, D.E., Nash, J.P., Scott, A.P., 1999. Vitellogenesis as a biomarker of reproductive disruption by xenobiotics. Aquaculture 177, 345–352. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lehoux, J.G., Sandor, T., 1970. Occurrence of steroids and steroid metabolizing enzyme systems in invertebrates – a review. Steroids 16, 141–171. Lin, Y., Meng, Y., Wang, Y.X., Luo, J., Katsuma, S., Yang, C.W., Banno, Y., Kusakabe, T., Shimada, T., Xia, Q.Y., 2013. Vitellogenin receptor mutation leads to the oogenesis mutant phenotype ‘‘scanty vitellin’’ of the silkworm, Bombyx mori. J. Biol. Chem. 288, 13345–13355. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(Delta Delta C) method. Methods 25, 402–408. Matozzo, V., Marin, M.G., 2008. Can 17-beta estradiol induce vitellogenin-like proteins in the clam Tapes philippinarum? Environ. Toxicol. Pharmacol. 26, 38– 44. Mechoulam, R., Brueggemeier, R.W., Denlinger, D.L., 1984. Estrogens in insects. Experientia 40, 942–944. Mundall, E.C., Tobe, S.S., Stay, B., 1979. Induction of vitellogenin and growth of implanted oocytes in male cockroaches. Nature 282, 97–98. Novak, F.J., Lambert, J.G., 1989. Pregnenolone, testosterone, and estradiol in the migratory locust Locusta migratoria; a gas chromatographical-mass spectrometrical study. Gen. Comp. Endocrinol. 76, 73–82.

Novak, F., Declerck, D., Paesen, G., Swevers, L., Paemen, L., Deloof, A., 1990. Radioimmunological quantification of C-21, C-19 and C-18 Steroids in the Gonads of Locusta migratoria migratorioides R and F. Comp. Biochem. Physiol. B 97, 727–733. Novillo, A., Won, S.J., Li, C., Callard, I.P., 2005. Changes in nuclear receptor and vitellogenin gene expression in response to steroids and heavy metal in Caenorhabditis elegans. Integr. Comp. Biol. 45, 61–71. Ogiso, M., Fujimoto, Y., Ikekawa, N., Ohnishi, E., 1986. Glucosidation of estradiol-17 beta in the cultured ovaries of the silkworm, Bombyx mori. Gen. Comp. Endocrinol. 61, 393–401. Ohnishi, E., Ogiso, M., Wakabayashi, K., Fujimoto, Y., Ikekawa, N., 1985. Identification of estradiol in the ovaries of the silkworm, Bombyx mori. Gen. Comp. Endocrinol. 60, 35–38. Paesen, G., Deloof, A., 1988. The presence of a progesterone binding-protein in spermatheca of the Migratory Locust, Locusta migratoria migratorioides R and F. Int. J. Invert. Rep. Dev. 14, 267–277. Rothschild, M., Ford, B., 1964a. Breeding of Rabbit flea (Spilopsyllus cuniculi) dale)) controlled by reproductive hormones of host. Nature 201, 103–104. Rothschild, M., Ford, B., 1964b. Maturation + egg-laying of rabbit flea (Spilopsyllus Cuniculi dale) induced by external application of hydrocortisone. Nature 203, 210–211. Roy, S., De, J., Kundu, S., Biswas, A., Pramanik, M., Ray, A.K., 2007. Estradiol-17beta: tracing its metabolic significance in female fatbody of fifth instar larvae of silkworm, Bombyx mori L (race: Nistari). Life Sci. 80, 446–453. Sandor, T., Mehdi, A.Z., 1979. Steroids and evolution. In: Barrington, E.J.W. (Ed.), Hormones and Evolution. Academic Press, New York, pp. 1–72. Suzuki, M.G., Funaguma, S., Kanda, T., Tamura, T., Shimada, T., 2003. Analysis of the biological functions of a doublesex homologue in Bombyx mori. Dev. Genes. Evol. 213, 345–354. Svoboda, J.A., Thompson, M.J., Robbins, W.E., Kaplanis, J.N., 1978. Insect steroid metabolism. Lipids 13, 742–753. Swevers, L., Lambert, J.G.D., Deloof, A., 1990. Hydroxysteroid dehydrogenaseactivity in tissues of 2 insect species. Comp. Biochem. Physiol. B 97, 735–739. Swevers, L., Lambert, J.G.D., Deloof, A., 1991. Synthesis and metabolism of vertebrate-type steroids by tissues of insects – a critical-evaluation. Experientia 47, 687–698. Tada, N., Nakao, A., Hoshi, H., Saka, M., Kamata, Y., 2008. Vitellogenin, a biomarker for environmental estrogenic pollution, of Reeves’ pond turtles: analysis of similarity for its amino acid sequence and cognate mRNA expression after exposure to estrogen. J. Vet. Med. Sci. 70, 227–234. Tominaga, N., Ura, K., Kawakami, M., Kawaguchi, T., Kohra, S., Mitsui, Y., Iguchi, T., Arizono, K., 2003. Caenorhabditis elegans responses to specific steroid hormones. J. Health Sci. 49, 28–33. Tyler, C.R., vanderEerden, B., Jobling, S., Panter, G., Sumpter, J.P., 1996. Measurement of vitellogenin, a biomarker for exposure to oestrogenic chemicals, in a wide variety of cyprinid fish. J. Comp. Physiol. B 166, 418–426. Xiang, Z.H., Huang, J.T., Xia, J.G., Lu, C., 2005. Biology of Sericulture. China Forestry Press, Beijing, pp. 225–228. Xu, J., Wang, Y.Q., Li, Z.Q., Ling, L., Zeng, B.S., You, L., Chen, Y.Z., Aslam, A.F., Huang, Y.P., Tan, A.J., 2014. Functional characterization of the vitellogenin promoter in the silkworm, Bombyx mori. Insect Mol. Biol.. Yamashita, O., Irie, K., 1980. Larval hatching from vitellogenin-deficient eggs developed in male hosts of the silkworm. Nature 283, 385–386. Yang, H.J., Lee, J.W., Lee, S.H., Ryu, J.S., Kwak, D.H., Nam, K.S., Park, Y.I., Lee, Y.C., Jung, K.Y., Choo, Y.K., 2010. Estrogenic activity produced by aqueous extracts of silkworm (Bombyx mori) pupae in ovariectomized rats. Am. J. Chin. Med. 38, 89– 97. Yano, K., Sakurai, M.T., Izumi, S., Tomino, S., 1994. Vitellogenin gene of the silkworm, Bombyx mori: structure and sex-dependent expression. FEBS Lett. 356, 207–211. Zhao, Y.B., Hu, J.Y., 2012. Development of a molecular biomarker for detecting intersex after exposure of male medaka fish to synthetic estrogen. Environ. Toxicol. Chem. 31, 1765–1773.

Please cite this article in press as: Shen, G., et al. Vertebrate estrogen regulates the development of female characteristics in silkworm, Bombyx mori. Gen. Comp. Endocrinol. (2014), http://dx.doi.org/10.1016/j.ygcen.2014.09.016

502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565