Wound healing

Wound healing

PLASTIC SURGERY METHODS: 6 samples of keloid fibroblasts were cocultured in defined serum free media with keloid keratinocytes for 5 days. Keloid fibr...

151KB Sizes 1 Downloads 74 Views

PLASTIC SURGERY METHODS: 6 samples of keloid fibroblasts were cocultured in defined serum free media with keloid keratinocytes for 5 days. Keloid fibroblast cell lysate was subjected to western analysis.

WOUND HEALING Activation of the hypoxia inducible factor-1 pathway improves diabetic wound healing

RESULTS: Compared to single cell keloid fibroblast culture, phospho-MAPK and downstream phospho-Elk-1 showed upregulation in the coculture groups, as did phospho-PI3K and phosphoAkt-1. Western blot of conditioned media from coculture groups demonstrated increased collagen I, II and III, laminin 1 and 5, as well as fibronectin levels. Addition of MAPK-p44/42-specific inhibitor UO126 or PI3K-specific inhibitor LY294002 completely nullified collagen I, II and III production, and significantly decreased laminin 1 and 5 and fibronectin secretion. Fibronectin in the presence of either inhibitor demonstrated changes in the molecular weight as reflected by faster migration on gel.

Kayan Z Paydar MD, Scott Hansen MD, David Chang MD, Nancy Boudreau PhD, David Young MD University of California at San Francisco, Surgical Research Laboratory, San Francisco, CA INTRODUCTION: The transcription factor hypoxia inducible factor-1 (Hif-1) induces hemeoxygenase-1 (HO-1), inducible nitric oxide synthase-2 (NOS-2), and vascular endothelial growth factor (VEGF), which are essential for wound healing. We propose that Hif-1 induction of HO-1, NOS-2, and VEGF is altered in diabetic (db/db) wounds and is associated with delayed healing.

CONCLUSIONS: Synchronous activation of both MAPK and PI3K pathways appears to be essential for collagen I, II and III, laminin 1 and 5, and fibronectin production. These pathways additionally appear to affect the side chain attachments of fibronectin by altering its molecular weight and migration characteristics. Modulation of these pathways may suggest a direction for keloid therapy.

METHODS: Diabetic (C57BL/KsJ-db/db) mice received a fullthickness wound (2.5 cm). Cobalt chloride (CoCl2, 200 mM), an activator of Hif-1, was applied on the day of wounding and on post-operative day one. Wounds were measured weekly. Tissues were processed for RNA and protein analysis at various times. In parallel, dermal fibroblasts were cultured from db/db mice and their nondiabetic littermates (wt). mRNA levels for HO-1, NOS-2, and VEGF were measured.

Mechanical signal transduction in normal versus keloid fibroblasts

RESULTS: By RT-PCR, mRNA levels for HO-1, VEGF, and NOS-2 were lower in db/db wounds and fibroblasts derived from db/db animals compared to wt. Addition of CoCl2 increased expression of Hif-1 in db/db wounds, as well as expression of target genes, HO-1, NOS-2, and VEGF. Application of CoCl2 accelerated closure of diabetic wounds from an average of 62 days to 34 days (p⬍0.05).

Zhen Wang MD, Toan-Thang Phan MD, PhD, Ivor Lim MBBChir, George Yang MD, PhD, Michael Longaker MD, FACS Stanford University, Stanford, CA INTRODUCTION: Keloids are more likely to form in wounds subjected to increased skin tension. We are interested in studying the differential transcriptional response in normal (NHF) versus keloid (KHF) fibroblasts, and identifying the mechanisms for this differential response.

CONCLUSIONS: Expression of HO-1, NOS-2, and VEGF are decreased in diabetic wounds and in cultured dermal fibroblasts derived from diabetic mice. Addition of CoCl2 increased expression of Hif-1 in diabetic wounds as well as expression of Hif-1 target genes to accelerate wound healing. Therefore, alterations of Hif-1 pathway may be partially responsible for delayed wound healing seen in diabetes.

METHODS: NHFs and KHFs were seeded onto membranes and “stretched” in devices calibrated to deliver known levels of equibiaxial strain. RNA and protein were harvested and assayed with quantitative real-time PCR (qPCR) and immunoblotting, respectively. We inhibited ERK and PI3 kinase pathways with U0126 and wortmannin, respectively. Focal adhesion kinase (FAK) was detected by immunofluorescence. RESULTS: After 10% equibiaxial strain, higher levels of TGFbeta1 and TGF-beta2 mRNA could be detected by 3 hrs persisting out to 24 hrs in KHFs versus NHFs. There was no significant difference in TGF-beta3 expression. Immunoblot analysis confirmed increased amounts of TGF-beta1 and 2 protein in KHFs versus NHFs. KHFs were shown to produce more collagen I mRNA in response to the same amounts of strain. We show increased activated, phosphorylated-ERK within 30 min after strain in KHFs versus NHFs. Treatment of fibroblasts with the ERK inhibitor U0126, but not wortmannin, leads to inhibition of the differential transcriptional response of TGF-beta. Using immunofluorescence, we found more FAK was localized to focal adhesion complexes by equibiaxial strain in KHFs vs. NHFs after 30 min of strain.

Keloid ECM-collagen production depends on synchronous activation of MAP-kinase and PI3kinase pathways Thang T Phan MD, PhD, Ivor J Lim MD, Seng Teik Lee MD, Hung Huynh PhD, Michael Longaker MD, FACS Stanford University, Stanford, CA INTRODUCTION: Keloid fibroproliferation appears to be influenced by epithelial-mesenchymal interactions between keloid keratinocytes and keloid fibroblasts. Keloid and normal fibroblasts exhibit accelerated proliferation and collagen I and III production in coculture with keloid keratinocytes. Pro-mitogenic MAP-Kinase and anti-apoptotic PI3-Kinase pathway activation is likely responsible for this excessive keloid fibroblast proliferation. We hypothesized that these two pathways might also be involved in extracellular matrixcollagen production in keloid fibroblasts.

© 2003 by the American College of Surgeons Published by Elsevier Inc.

CONCLUSIONS: Our data suggest that KHFs and NHFs have differential transcriptional responses to physical stress due to differential activation of mechanical signal transduction.

ISSN 1072-7515/03/$21.00

S52

Vol. 197, No. 3S, September 2003

Signal transduction in keloid versus normal human fibroblasts following serum stimulation Wei Xia MD, Toan-Thang Phan MD, PhD, Ivor Lim MBBChir, George Yang MD, PhD Michael Longaker MD, FACS Stanford University, Stanford, CA INTRODUCTION: We used serum stimulation as an in vitro model to mimic a component of the wound microenvironment to examine differential gene expression in keloid (KHFs) versus normal human fibroblasts (NHFs). METHODS: Fibroblasts were quiesced in DMEM 0.5% FCS for 48 hrs prior to serum stimulation with DMEM 10% FCS. mRNA levels were determined using quantitative real time PCR (qPCR). TGFbeta activity was determined using the MLEC luciferase assay. Protein phosphorylation was detected by immunoblotting with specific antibodies to phosphorylated p38, ERK and JNK. PI3 kinase, MEK1 and MEK2, p38 MAPK, and JNK were inhibited with wortmannin, PD98059, SB203580, and SP600125, respectively. RESULTS: Transcription of TGF-beta2 and CTGF is rapid and peaks between 1 and 6 hours after serum stimulation in KHFs versus NHFs. The MLEC luciferase assay confirmed increased TGF-beta activity in the conditioned medium. Using specific inhibitors of signaling pathways implicated in the response to growth stimuli, only the p38 MAPK inhibitor SB203580 could block up-regulation of TGF-beta2 following serum stimulation in KHFs. Phosphorylation levels of ERK and JNK showed no difference between KHFs and NHFs while p38 was phosphorylated within 15 min and persisted in KHFs. CONCLUSIONS: KHFs have a differential transcriptional response to serum stimulation than NHFs that appears to be mediated in part by the p38 kinase pathway. This suggests the mechanism of keloid pathogenesis may be due in part to an inherent difference in how the fibroblasts respond to wounding.

Epithelial-mesenchymal interactions in keloid pathogenesis George P Yang MD, PhD, Wei Xia MD, Toan-Thang Phan MD, PhD, Ivor Lim MBBChir, Michael Longaker MD, FACS Stanford University, Stanford, CA INTRODUCTION: We previously demonstrated that co-culture of either keloid human fibroblasts (KHFs) or normal human fibroblasts (NHFs) with keloid human keratinocytes (KHKs) resulted in an elevated proliferation rate versus normal human keratinocytes (NHKs). KHFs respond more vigorously than NHFs. We looked at the contribution of TGF-beta isoforms to this phenomenon. METHODS: Using a two-chamber system, we harvested RNA from NHKs, KHKs, NHFs and KHFs after 3 days of co-culture and examined mRNA expression of TGF-beta isoforms and collagen I with quantitative PCR. TGF-beta activity was blocked using a panTGF-beta blocking antibody. RESULTS: TGF-beta1 levels in NHFs decreased in the presence of KHKs, but was stimulated in KHFs. No difference was seen in coculture with NHKs. NHKs down-regulated TGF-beta2 in NHFs

Plastic Surgery

S53

but not KHFs. KHKs stimulated TGF-beta2 in KHFs but not NHFs. TGF-beta3 in fibroblasts decreased when co-cultured with keratinocytes. Conversely, KHKs in co-culture expressed more TGFbeta1 and 3 than NHKs. Finally, KHFs produced more collagen I in co-culture with KHKs than NHKs. The proliferation rate of fibroblasts in co-culture is suppressed with a pan-TGF-beta blocking antibody compared to control IgG. CONCLUSIONS: TGF-beta accounted for part of the increased growth rate of KHKs/KHFs co-culture. NHKs have an inhibitory effect on TGF-beta and collagen production of fibroblasts, however KHKs lose this effect. KHFs show an abnormal response to the epidermal signaling. Our data suggests keloid pathogenesis may be due in part to an aberrant paracrine regulation between keratinocytes and fibroblasts.

Wet wound healing enhances re-epithelialization in streptozotocin induced diabetic rat Patrik E Velander MD, AFRCSI, Jan Vranckx MD, Feng Yao PhD Elof Eriksson MD, FACS Harvard Medical School, Brigham and Women’s Hospital, Boston, MA INTRODUCTION: Healing of chronic wounds represents a difficult challenge with currently available treatments. Our laboratory has previously demonstrated improved wound healing in a wet wound environment in normal pigs. Since diabetes is a strong etiological factor and streptozotocin induced diabetes in the rat is a wellestablished model, we have constructed a chamber that fits on rats and allows for a wet wound environment. METHODS: Both healthy and streptozotocin induced diabetic rats were used in this study. Custom made titanium chambers were inserted onto both flanks and a 1x1 cm full thickness wound was incised inside the chamber. One chamber was filled with a normal saline solution and sealed, whereas the contralateral wound was kept dry. Wound contractions were measured. Both wound fluid and blood glucose levels were monitored on a daily basis. Wound biopsies were taken on the final day for re-epithelialization measurements RESULTS: Both wound fluid and blood glucose were high (⬎300 mg/dl) in the diabetic rat throughout the experiment. Wound contraction and re-epithelialisation were delayed in the diabetic rat. Wound contraction in the wet wound was 19% less than in the dry wound . At day 10, the wet wound had re-epithelialized 42% more compared to the dry wound.

DAY 10

Re-epithelialization Wound contraction

Diabetic Diabetic Non-diabetic Non-diabetic rat wet rat dry rat wet rat dry wound wound wound wound (%) (%) (%) (%)

96 65

54 84

100 89

90 96

CONCLUSIONS: Wound healing is delayed in streptozotocin induced diabetic rats. The titanium chamber wet wound environment enhances healing by decreasing wound contraction and improving re-epithelialisation. The use of this chamber

S54

Plastic Surgery

J Am Coll Surg

offers promising prospects since it allows manipulation and monitoring of the wound environment at different stages of healing.

Excessive nitric oxide impairs wound collagen deposition: reversal by inhibition of nitric oxide synthase Julie E Park MD, Morton J Abrams MD, Vanita Ahuja MD, Adrian Barbul MD Sinai Hospital of Baltimore and Johns Hopkins Medical Institutions, Baltimore, MD INTRODUCTION: Wound nitric oxide (NO) synthesis is important in wound healing. Certain conditions of impaired healing demonstrate low wound NO synthesis. Other conditions, such as inflammation or infection, can generate high levels of nitric oxide. We hypothesized that high NO levels compromise wound healing. METHODS: 20 male Sprague-Dawley rats had a polyvinyl alcohol sponge subcutaneously implanted dorsally. The sponges were treated with either 50 microliters of normal saline (NS) (n⫽10) or 50 microliters of sterile turpentine (n⫽10). In a second experiment, a mini-osmotic pump was connected to the sponge and similarly implanted in another 20 rats. All sponges were treated with turpentine and continuously perfused with either L –N6-(1-Iminoethyl)-lysine (L-NIL), an inhibitor of inducible nitric oxide synthase, or NS. Animals were sacrificed on postoperative day 10. Sponges were assayed for NOx (micromolar) (nitrate and nitrite, stable end products of NO) and for hydroxyproline content (OHP microgram/100 mg sponge), an index of reparative collagen deposition. RESULTS: Turpentine induced a robust inflammatory response, resulting in sterile abscess formation. Turpentine-treated sponges contained 2.5 times more NOx and had significantly less collagen than control sponges. Inhibition of NO synthase by treatment with L-NIL reversed this process as demonstrated by 40% less NOx content and 33% more collagen accumulation in turpentine-treated sponges.

NOx OHP

NS

Turpentine

NS ⴙ L-NIL

Turpentine ⴙ L-NIL

15.6 ⫾ 3.5 729.7 ⫾ 81.5

40.5 ⫾ 4.3* 449.4 ⫾ 76.3†

57 ⫾ 4.8 375.2 ⫾ 33.6

31.5 ⫾ 6* 515.2 ⫾ 56.8†

Mean ⫾ SEM. *p ⬍ 0.005. †p ⫽ 0.05 by unpaired Student’s t-test.

CONCLUSIONS: High wound NO synthesis, as observed in severe inflammation, decreases collagen deposition. Inhibition of iNOS activity partially restores wound collagen deposition. This suggests a mechanism by which inflammation/infection impairs wound healing.

Mesh incisional herniorrhaphy optimizes the biomechanical wound healing profile compared to suture repair Derek A DuBay MD, Xue Wang MD, PhD, Belinda Adamson MSc, Michael Franz MD University of Michigan, Ann Arbor, MI INTRODUCTION: 11% of abdominal wall closures fail to heal. Clinically, this manifests as nearly 200,000 ventral hernia repairs annually. Recurrent incisional hernia formation decreases from 43% with suture repair to 24% with mesh prosthesis repair. The mechanism of the improved outcome is unknown. We hypothesize that mesh prosthesis hernia repair results in a more favorable biomechanical wound healing profile. METHODS: A rodent model of giant incisional hernia formation was used. Midline incisional hernias were created and allowed to mature for 28 days prior to suture repair (n⫽10) or polypropylene mesh repair (n⫽10). Rodents were sacrificed one month following repair and fascial strips were cut perpendicular to the wound for biomechanical testing. Biopsies were taken of the wound healing interface for biochemical analysis. RESULTS: Recurrent incisional hernias developed in 2/10 of the mesh repair and 5/10 of the suture repair. Mesh repair wounds elongated more (12.6 mm ⫾ 0.7 vs. 7.56 mm ⫾ 0.7, p⬍0.01), were less stiff (0.73 N/mm ⫾ 0.17 vs. 1.8 N/mm ⫾ 0.12, p⬍0.01) and had lower elasticity (1.01 MPa ⫾ 0.26 vs. 1.56 MPa ⫾ 0.24, p⬍0.05). Toughness was equal between wounds, although suture repair wounds had increased recovery of breaking strength (5.72 N ⫾ 0.9 vs. 12.68 N ⫾ 3.2, P⬍0.01). There were no significant differences in collagen protein production between wounds. CONCLUSIONS: Mesh incisional herniorrhaphy has a lower recurrent incisional hernia rate due to a more favorable postoperative biomechanical profile in the early postoperative wound compared to suture repair.

Synthetic TgF-␤ antagonist promotes wound healing and reduces scarring Frank Johnson MD, Yao-Horng Wang MS, Thai-Yen Ling PhD, Shiow-Shuh Chuang MD, Shuan Shian Huang PhD, Jung San Huang PhD Saint Louis University, St Louis, MO INTRODUCTION: We synthesized a dodecapeptide containing the active site of human transforming growth factor-␤1 (TGF-␤1). It is a TGF-␤ antagonist in vitro. Application to cutaneous wounds might promote epithelialization and decrease scarring by decreasing local TGF-␤ activity. METHODS: We applied synthetic TGF-␤ antagonist (1.5 mM in gel carrier), with gel-only and no-treatment controls, to 6 burn wounds in each of 4 pigs. Wounds were measured and photographed for 41 days, then excised. Wound dimensions and percent epithelialization were calculated from photographs. Scar volume was estimated as surface area (photographs) x depth (microscopy). Statistical analysis employed student’s t-test. Additional experiments utilized

Vol. 197, No. 3S, September 2003

Plastic Surgery

other wounds in rabbits and pigs. Recombinant TGF-␤1 and platelet-derived growth factor (PDGF) were applied to identical wounds in other pigs and rabbits in parallel experiments as additional controls. RESULTS: In treated pig burn wounds, epithelialization was complete on d. 26 ⫾ 2 (mean ⫾ SD); control wounds were 70 ⫾ 10% re-epithelialized by day 26 (p ⬍ 0.001). Contraction rate, collagen and fibronectin content, and scar volume were all significantly less in treated wounds. TGF-␤1 and PDGF each retarded wound epithelialization. CONCLUSIONS: Treatment of standard pig skin burn, pig skin excision, and rabbit skin excision wounds with synthetic TGF-␤ antagonist promoted epithelialization, reduced scarring, and slowed wound contraction. This agent may be useful in human wounds, particularly burns.

Detachment-induced apoptosis in the fibroblastpopulated collagen matrix is modulated by p53 Mark A Carlson MD, Robert E Lewis PhD, Michael T Longaker MD, Jon S Thompson MD University of Nebraska Medical Center, Omaha, NE INTRODUCTION: Detachment of the fibroblast-populated collagen matrix (FPCM) from its substratum induces apoptosis. Inhibition of p53 in monolayer fibroblasts prevents anoikis. We hypothesized that knockdown (RNAi) of p53 in the FPCM would diminish detachment-induced apoptosis. METHODS: Human foreskin fibroblasts were incubated in attached collagen (bovine type I) matrices for 24 hr prior to transfection with a 21-mer RNA duplex against p53 (GACUCCAGUGGUAAUCUACUU); matrices were detached 72 hr after transfection, and then cytospin preps were processed with p53 immunohistochemistry and the TUNEL assay 24 hr after detachment. Data was analyzed with ANOVA and the unpaired t-test. RESULTS: The results of the p53 immunohistochemistry (IHC) and TUNEL are given in the Table.

p53 IHC (% positive)

S55

A novel model for precise, accurate measurements of wound healing in mice Joseph Michaels V MD, Robert Galiano MD, Russell Ashinoff MD, Daniel Ceradini MD, Michael Dobryansky MD, Kirit Bhatt MD, Curt Cetrulo MD, Jennifer Capla BA, Jamie Levine MD, Geoffrey Gurtner MD New York University School of Medicine, New York, NY INTRODUCTION: There currently are no rodent models that parallel human wound healing. Humans heal wounds through epithelialization and granulation, whereas rodents predominantly heal by contraction. We introduce a novel model of wound healing in mice that minimizes wound contraction, and allows for granulation and epithelialization. METHODS: Two full-thickness wounds were created on the dorsum of C57/BL6 (n⫽23) and diabetic C57/BL-db/db mice (n⫽15). Silicone splints with a diameter two times that of the wound was centered around the wound, fixed with adhesive glue and nylon sutures, and covered with an occlusive dressing. Tissue was harvested on days 1, 3, 7, 10, 14, 21, 24 and compared to controls with no splint or dressing. Specimens were analyzed for area of granulation tissue and epithelial gap using image analysis software. RESULTS: Reepithelialization was prolonged in the splinted C57/ BL6 and C57/BL-db/db mice (10.7 d⫾0.58 vs. 7.33 d⫾0.58, P⬍0.05 and 22.3 d⫾1.86 vs. 16.1 d⫾1.79, P⬍0.05, respectively). Total area of granulation tissue was more abundant until day 7 in the C57/BL6 splinted mice (410%, P⬍0.05) and until day 10 in the C57/BL-db/db splinted mice (326%, P⬍0.05), after which point there was no difference. CONCLUSIONS: Our findings show that splinting wounds in mice minimizes contraction and allows healing to occur by epithelialization and new granulation tissue. We have demonstrated its applicability in a model of normal and impaired wound healing. This model simulates human wound healing, is easily reproducible, and is cost effective. It is an appealing model to evaluate new pharmacologic or gene therapy-mediated treatments on wound healing.

TUNEL (% positive)

Transfection

attached

detached

attached

detached

Nontransfection Vehicle only RNA duplex

3.2 ⫾ 1.9 7.9 ⫾ 5.0 8.4 ⫾ 2.0**

27.3 ⫾ 4.4* 26.0 ⫾ 7.5* 15.0 ⫾ 1.5*,**

0.5 ⫾ 0.7 1.7 ⫾ 1.3 5.0 ⫾ 2.6**

10.7 ⫾ 3.6* 12.4 ⫾ 2.1* 4.7 ⫾ 1.9**

Mean ⫾ SD. *P ⬍ 0.05 compared with attached. †P ⬍ 0.05 compared with nontransfected. IHC, immunohistochemistry.

CONCLUSIONS: FPCM detachment induces p53 expression and apoptosis; p53 can be partially knocked down in the FPCM with RNAi. Although vehicle toxicity cannot be ruled out, detachmentinduced apoptosis is decreased by p53 RNAi. Detachment-induced apoptosis in the FPCM is mediated at least partially by p53.

Role of salivary VEGF in palatal wound repair Sundeep G Keswani MD, Anna Katz BS, Foong-Yen Lim MD, Philip Zoltick MD, Antoneta Radu, Timothy Crombleholme MD, Norton Taichman MD The Children’s Hospital of Philadelphia, Philadelphia, PA INTRODUCTION: Large amounts of vascular endothelial growth factor (VEGF) and other growth factors are secreted by murine submandibular salivary glands (SMG). VEGF-induced angiogenesis is critical for timely cutaneous wound healing however, it has not been studied in the palate. We hypothesize that SMG resection will deplete salivary VEGF levels and impair palatal mucosal neovascularization and wound healing.

S56

Plastic Surgery

J Am Coll Surg

METHODS: Stimulated saliva was collected from C57/BL6 mice pre and post (day 0, and 12, n⫽11) SMG resection (day 5, n⫽6) or sham operation (n⫽5). At Day 18, 1.5 mm mucosal wounds were created in the hard palate of all mice. Wounds were harvested at 3 days post wounding and analyzed for epithelial gap closure and capillary density. Salivary VEGF protein levels were quantified by ELISA. Data were expressed as mean⫾SEM; P values were assessed by ANOVA and correlation by Pearson coefficient.

that HSP’s play a pivotal role in keloid formation. Unveiling the HSP–keloid interaction may allow us to manipulate the inflammatory and proliferative phases of wound healing with the potential to control keloid formation.

RESULTS: Baseline salivary VEGF levels were 445 pg/mg⫾49 and were significantly reduced after SMG resection (136 pg/mg⫾15.9, p⬍.001), but not after sham operation (472 pg/mg⫾40). When compared to controls, SMG resection significantly impaired wound closure (194m⫾43 vs. 716m⫾50, p⬍.0001) and significantly decreased vessel density in wounds in desalivated mice (26.1 ⫾1.3 vs. 17.3 vessels⫾.6, p⬍.00001). Salivary levels of VEGF were positively correlated with capillary density (r⫽.80, p⬍.01) and wound closure (r⫽.70, p⬍.05).

INTRODUCTION: The current model of wound healing is that local wound-resident cells repopulate and mediate remodeling after the inflammatory phase. Wound-resident fibroblasts produce collagen and provide contractile forces necessary for wound closure. Origin of the wound-resident fibroblasts, however, is presumed to be of local dermal origin. We hypothesized that bone marrow (BM) derived cells during the inflammatory phase, along with local cells, are a source of fibroblasts that play a role in remodeling a cutaneous wound.

CONCLUSIONS: In the healing of palatal wounds, salivary VEGF is an essential growth factor and protein levels correlate with not only vascular density but also reepithelialization. These results indicate that the murine model of palatal wound healing can be employed to delineate functional roles of salivary VEGF in palatal wound healing.

METHODS: Chimeras were developed using immunodepleted C57BL-mice transplanted with different BM cell populations (whole, hematopoetic (HSC) and mesenchymal stem cell (MSC)) derived from Green Fluorescent Protein (EGFP) transgenic mice. Wounds were created in these chimeras, and at specific endpoints, were analyzed by flow cytometry and histology.

Heat shock proteins modulate keloid formation

RESULTS: Flow cytometry showed the percentage of GFP⫾ (BM derived) cells at day 0, 7, 14 (time of wound closure), 21, and 28 to be 11.5%, 49%, 28%, 31%, and 30.5% respectively. These results

Serhat Totan MD, Eser Yuksel MD, Anthony Echo BS, Ergin Er MD, Amer Amer PhD, Melvin Spira MD, DDS, Saleh M. Shenaq MD Baylor College of Medicine, Houston, TX

The role of bone marrow in wound healing Vishal Kapoor MD, Lynne Wilson, Carrie Fathke, F Frank Isik MD University of Washington, Seattle, WA

INTRODUCTION: Heat Shock Proteins (HSP) modulate the intensity of the inflammatory and synthetic signal in response to stress in wound healing. Induction of HSP’s at the site of cutaneous wounds improves healing acting as a chaperone. However, this response may yield to extensive inflammatory effect which triggers an uncontrolled synthetic process, as seen in burns. The multifactorial keloid etiology involves the genetic predisposition, physical factors and aggression in response. This study aims to demonstrate the dynamic interaction between HSP’s expression and keloid formation. METHODS: 32 keloid and adjacent normal tissue samples have been removed from 24 patients who were between 16 and 45 years of ages. Western Blot, ELISA, and Immunohistochemical studies have been performed to demonstrate HSP 27, 47, 60, 70 and 90 expressions in keloid and normal tissues. RESULTS: Our results demonstrated the significant overexpression of HSP’s (HSP 27, 47, 70) in keloid compared to normal tissue. Statistical analysis by using the t-test revealed significant difference between these two groups (p⬍0.05). CONCLUSIONS: Differentially increased HSP levels indicate the proliferative (HSP 70 through p38) and matrix synthetic (HSP 47) components in keloid tissue. From this point of view, it is probable

were confirmed by manual counts of histological images. A subset of these BM derived cells was negative for CD45, a marker of hematopoetic lineage (Table 1). Preliminary results indicate ⬃20% of the GFP⫾ fibroblasts in day 40 wounds are derived from HSC and not MSC populations. CONCLUSIONS: Our study demonstrates a significant proportion of long term wound fibroblasts originate from the BM. These cells lose typical markers for BM cells (CD45) and appear to differentiate into a cutaneous cell phenotype. Further studies are characterizing these cells’ contribution to remodeling by studying contraction and collagen production in vitro.

Vol. 197, No. 3S, September 2003

Plastic Surgery

Development of an architecturally-intact human skin-based angiogenesis model James M Lewis MD, Lee H Grafton MD, P Johnstone Maxwell IV MD, Louis F Martin MD, Lee T Nesbitt MD, Yi-Zarn Wang MD, Eugene A Woltering MD Louisiana State University Health Sciences Center, New Orleans, LA

INTRODUCTION: A variety in vivo and in vitro models have been developed to evaluate angiogenesis; however, none of these models utilize architecturally-intact human skin as a source of the angiogenic response. We hypothesized that the cut edges of vessels contained within full-thickness human skin fragments would develop an angiogenic response over time if cultured in a fibrin-thrombin matrix.

METHODS: Skin was obtained (n⫽4 specimens) anonymously from discarded surgical specimens. Disks (n⫽12 to 40/specimen) were created with a 2 mm skin punch, embedded in a 0.3% fibrinthrombin clot, and overlaid with a growth-supportive medium containing 20% FBS. Disks were observed under an inverted light microscope for 21–35 days. The percent of wells initiating an angiogenic response (% initiation) was calculated. The subsequent growth of the vessels [angiogenic index (0–16 range)] was rated using a semiquantative visual rating scale developed and validated in our laboratory.

RESULTS: All specimens initiated an angiogenic response in 80% or more of the wells plated. The mean (⫾ SEM) angiogenic index (0–16 scale) of all specimens was 13.43 ⫾ 1.45, indicating near maximal neovessel growth in these wells.

Specimen number

Days in culture

n

Initiation (%)

Angiogenic index ⴞ SEM

Day initiated

1 2 3 4

21 26 35 28

12 30 40 40

100 100 100 80

14.58 ⫾ 0.609 15.17 ⫾ 0.322 15.05 ⫾ 0.322 9.08 ⫾ 1.022

8 11 22 11

S57

CRANIOFACIAL/BONE/TISSUE/ ENGINEERING/NERVE/FLAPS/ ANGIOGENESIS SURGERY Microvascular based tissue engineering using a novel perfusion bioreactor Daniel J Ceradini MD, Curtis Cetrulo MD, Joseph Michaels MD, Michael Dobryansky MD, Russell Ashinoff MD, Kirit Bhatt MD, Robert Galiano MD, Jamie Levine MD, Geoffrey Gurtner MD New York University School of Medicine, New York, NY INTRODUCTION: Current tissue engineering strategies are limited by the lack of a vascular network capable of nourishing larger composite tissues generated in vitro. We postulated that explanted microvascular beds (free flaps) could be sustained ex vivo using a novel perfusion bioreactor, seeded as a “physiologic scaffold” with mesenchymal stem cells (MSCs), and reimplanted into a recipient as a vascularized engineered construct. METHODS: We constructed a bioreactor that recreates pulsatile perfusion in explanted free flaps. Thigh adductor free flaps harvested from Fisher rats were perfused via the afferent artery over 6–24 hrs with DMEM/10%FCS at physiologic temperature. Viability was determined post-perfusion using histology, nitro-blue tetrazolium (NBT), functional endothelial assays, and ultimately reimplantation. MSCs were infused into the microcirculation to determine if cultivated microvascular beds can be “seeded” using this system. RESULTS: Viability was maintained for up to 20 hrs in the bioreactor, as predicted by area of NBT staining (14 hrs: 71⫾8.3%, 16 hrs: 63⫾10.7%, 20 hrs: 23⫾7.3%, control: 3⫾2%, p⬍0.005), correlating with histologic features of viability. Endothelial function was preserved for 16 hrs, significantly decreasing thereafter. Flaps were successfully reimplanted after 16 hrs of perfusion with preservation of vascular viability 72 hrs postoperatively. MSCs added to the perfusate during cultivation adhered to and egressed from the flap microcirculation into the surrounding parenchymal tissue. CONCLUSIONS: We demonstrate here extended ex vivo survival of explanted free flaps with preservation of endothelial function well beyond described warm ischemia limits. MSCs successfully seeded into the flap microvasculature suggests this method may be useful in generating transportable vascularized tissue for purposes of transplantation.

Murine cranial suture fusion and patency: microarray analysis and functional validation CONCLUSIONS: Malignant and benign tumors require angiogenesis for growth and metastasis dissemination. Inhibition of angiogenesis may be useful in these conditions. Enhancement of angiogenesis may be desirable in wound healing. This human skin angiogenesis model may more accurately represent the responses of human skin to the effects of angiogenesis modulators than other non-human in vivo models or in vitro monolayer human tissue-based angiogenesis models.

Kenton D Fong MD, Randall Nacamuli MD, Michael Song MD, Kelly Lenton PhD, Tony Fang MD, Benjamin Frank MD, Stephen Warren MD, Francis Blankenberg MD, Michael Longaker MD Stanford University, Stanford, CA INTRODUCTION: Although the murine posterior frontal (PF) suture fuses in a programmed fashion, the molecular and cellular biology regulating this process are poorly understood. Here we use mi-

S58

Plastic Surgery

croarray analysis and functional follow-up studies to further investigate the process of PF suture fusion. METHODS: PF and SAG sutures were harvested from rats on postnatal days 5, 10, 15, 25, and 30. Gene expression profiles were compared using Affymetrix RU34A microarrays and validated using quantitative real-time PCR (QRT-PCR). Functional studies investigating cell signaling were performed using our unique dura materosteoblast co-culture system and recombinant protein stimulation. In situ imaging of apoptosis was performed using Alexafour and Technetium-99m labeled Annexin V. RESULTS: Our microarray data demonstrated marked downregulation of the osteogenic antagonist BMP-3 during PF suture fusion. Co-culture of osteoblasts with PF dura mater resulted in down-regulation of BMP-3. Stimulation of osteoblasts with FGF-2, BMP-2, and TGF-beta demonstrated a selective, sustained inhibition of BMP-3 (⬎48 hours) by FGF-2. Our array data also suggested an increase in apoptosis in both the PF and SAG sutures during postnatal development. Furthermore, detailed analysis of this data demonstrated suture-specific increases in two distinct apoptotic pathways, the mitochondrial-mediated pathway (PF) and death receptor-mediated pathway (SAG). In vivo and ex vivo Annexin V imaging data (n⫽18) confirmed the increase in apoptotic activity in both fusing and patent sutures (*p⬍0.05). CONCLUSIONS: Our data suggest that multiple processes, including antagonism of osteogenesis and apoptosis, have critical roles in determining cranial suture fate.

Distraction osteogenesis in the iradiated mandible: efficacy in post oncologic reconstruction. Christi M Cavaliere MD, Alexander Ayzengart BS, Steven R Buchman MD University of Michigan, Ann Arbor, MI INTRODUCTION: The utilization of Distraction osteogenesis (DO) for tissue replacement after oncologic resection or as a reconstructive option for deformations secondary to irradiated bone could have immense potential therapeutic ramifications. The role of DO in reconstruction of mandibular defects following therapeutic radiation remains unknown. This study was performed to investigate mandibular DO in the setting of fractionated external beam irradiation. METHODS: Sprague-Dawley rats (N⫽10) underwent preoperative mandibular irradiation doses of 30 Gray (fractionated 3 Gy/d x 10 d). Following two weeks recovery, a mandibular distractor was placed and DO performed 0.3 mm bid, up to 5.1 mm. Controls underwent DO without irradiation. RESULTS: Following consolidation, morphologic assessment of the irradiated mandibles displayed successful lengthening; however, there were obvious holes within the gap tissue and the bone was thin and brittle relative to controls. Radiographic evaluation and densitometry measures revealed marked differences in the distracted irra-

J Am Coll Surg

diated mandibles, demonstrating osteopenia and poor bone healing. Histologic examination further delineated quantitative and qualitative differences in bone formation in irradiated animals compared to controls. CONCLUSIONS: New bone formation can occur through distraction of irradiated tissue. However, radiographic and microscopic investigations indicate bone healing is severely compromised and the complication risk substantial. Anecdotal case reports are emerging to champion DO in oncologic reconstruction following radiation therapy. This valuable animal model outlines the means by which radiation disrupts DO, and may help to formulate strategies to optimize DO before it is widely applied in oncologic reconstruction.

rhBMP-4 gene therapy and autografting promote equivalent tooth eruption Joyce C Chen MD, Shelley Winn PhD, Xi Gong MD, Wayne Ozaki MD, DDS Oregon Health & Sciences University, Lake Oswego, OR INTRODUCTION: Previously, equivalent bone regeneration in adult canine maxillary alveolar clefts was demonstrated between autograft and rhBMP-2. However, tooth eruption was not addressed, a process which often goes awry in cleft palate patients. In addition, supra-physiologic dosing was required. Using a juvenile canine model, we hypothesized that rhBMP-4 gene therapy treated alveolar clefts would promote bone healing and canine tooth eruption equal to their autografted counterparts. METHODS: Twenty-six maxillary alveolar clefts were surgically created in thirteen immature male Foxhound dogs of mean age 80.1 days (71–93 days). Ten of the alveolar clefts were treated with DNA plasmid encoding recombinant human BMP-4 and a biodegradable polymer carrier, eight clefts with autografting, and eight clefts were left unrepaired. At twelve weeks post-surgery when the canine teeth began showing evidence of eruption, the dogs were euthanized and recipient beds with contiguous bone were recovered, processed, and assessed. Tooth eruption was measured as a percentage of the total crown length. Data were subjected to one-way ANOVA testing. Statistical significance was established at p⬍0.05. RESULTS: The percentage tooth eruption means in the rhBMP-4, autografting, and defect only groups were 67.4 (⫾15.8), 58.3 (⫾18.8), and 45.0 (⫾13.3), respectively. A significant effect (p⬍0.05) was observed between the rhBMP-4 gene therapy treated and defect only groups. CONCLUSIONS: rhBMP-4 gene therapy is equivalent to autografting in promoting tooth eruption in this new juvenile canine alveolar cleft model, which mimics more closely the pediatric patient population with cleft palate.

Vol. 197, No. 3S, September 2003

Processed lipoaspirate cells demonstrate unique phenotypical characteristics and differentiation capabilities when compared to pericytes Marc B Kaye, Pat A Zuk PhD, Marc H Hedrick MD, Prosper Benhaim Benhaim University of California, Los Angeles, Los Angeles, CA INTRODUCTION: Adipose-derived mesenchymal stem cells have been shown to display multilineage differentiation potential. Others have suggested that vascular pericytes were capable of similar differentiation potential. To test whether processed lipoaspirate (PLA) cells are an unique and distinct population of cells relative to pericytes, a phenotypic analysis was preformed comparing undifferentiated and differentiated PLA cells and pericytes. METHODS: PLA cells, obtained from cosmetic liposuction procedures, and pericytes were maintained in control medium (DMEM, 10% FBS, 1% antibiotic/antimycotic). Adipogenic differentiation was induced by culture in adipogenic medium (DMEM, 10% FBS, 0.5 mM isobutyl-methylxanthine, 1 ␮M dexamethasone, 10 ␮M insulin, 200 UM indomethacin, 1% antibiotic/antimycotic) for 2 weeks. Immunofluorescence was utilized to identify CD markers of the PLA cells and pericytes in the undifferentiated and differentiated state. To assess for adipogenic differentiation, Oil Red O stain was employed as an indicator of intracellular lipid accumulation. RESULTS: The CD marker analysis results of undifferentiated cells are presented in Table 1. The pericyte marker 3G5 demonstrated pericytes to be 3G5-positive and PLA cells 3G5-negative. Next, both PLA cells and pericytes were subjected to adipogenic differentiation medium for 2 weeks and then tested for selected CD markers and for intracellular lipid accumulation. The results of the immunofluorescence analysis are shown in Table 2. Oil Red O stain of the PLA cells showed positive staining for lipid vacuolization whereas pericytes remained unstained.

Table 1 Undifferentiated PLA cells

Positive Negative

Pericytes

Positive

Negative Table 2 Differentiated PLA cells Pericytes

Positive Negative Positive Negative

CD29, CD44, CD49d, CD54, CD61, CD71, CD166 CD3, CD4, CD19, CD31, CD34, CD45, CD56, CD58, CD62e, CD104, CD106, 3G5 CD3, CD4, CD34, CD44, CD54, CD56, CD71, CD104, CD106, CD166, 3G5 CD19, CD29, CD31, CD45, CD49d, CD58, CD61, CD62e

CD29, CD44 CD61, CD104, 3G5 CD44, 3G5 CD29, CD61, CD104

Plastic Surgery

S59

CONCLUSIONS: These results demonstrate that adipose-derived PLA cells are an unique population of cells with distinct phenotypic characteristics and differentiation capabilities when compared to pericytes.

Cellular fusion of hydroxyapatite layers Kevin A Brenner MD, Jay Calvert MD, Mark Mooney PhD, Kacey Marra PhD, Lee Weiss PhD University of California, Irvine, Orange, CA INTRODUCTION: Vascularized bone grafts are created using hydroxyapatite blocks and bone marrow cells. Scaffold seeding difficulties throughout the block resulted in absent central bone formation when block radius exceeded 300 micrometers. Solid freeform fabrication creates unique and precisely designed three-dimensional structures by assembling two-dimensional layers. By constructing thin layers of hydroxyapatite and individually seeding them with bone marrow cells, these layers will fuse. METHODS: Three 1mm thick layers of porous hydroxyapatite scaffold were individually seeded with New Zealand White rabbit bone marrow cells and sutured together into three-dimensional construct (n⫽6). Three layers of unseeded scaffold served as controls (n⫽6). They were implanted bilaterally into the rectus abdominis muscle near the vascular pedicle. At 8 weeks they were harvested and translayer tissue growth was evaluated with scanning electron microscopy. Blinded evaluators scored layer fusion on a ten point scale. RESULTS: Visual Fusion Scale Analysis of the seeded and unseeded Hydoxyapatite layers was performed. Fusion scores were based on percentage of pores with tissue growth across the layers. Seeded layers showed a mean score of 9.5 (SD 0.62). Unseeded layers showed a mean score of 3.9 (SD 0.96). Both groups were compared using the Two-Tailed Paired T-Test. A significant difference was found (P⬍0.001). CONCLUSIONS: Layer fusion by tissue growth occurred only in seeded implants. Layered manufacturing of three-dimensional bone grafts using 1 mm thick porous hydroxyapatite layers seeded with bone marrow cells is feasible in rabbits and may be used to create larger scale three-dimensional bone grafts.

Fluid heteromeric TGF-beta receptor complexes on human chondrocytes provide insight into cartilage regeneration Wendy L Parker MD, Anie Philip PhD McGill University, Montreal, PQ Canada INTRODUCTION: Articular cartilage injury unabated results in progressive joint degradation and dysfunction. TGF-beta has the potential to regulate almost all aspects of cartilage repair. Accessory TGF-beta receptors play a key role in modulating signaling. Our objectives were to define (i) the expression profiles of TGF-beta receptors in human chondrocytes (ii) their formation of oligomeric complexes and (iii) their functional significance in modulating TGFbeta responses.

S60

Plastic Surgery

J Am Coll Surg

METHODS: Human chondrocytes were cultured as monolayers, 3-D alginate beads, or protein was extracted by solubilization. TGFbeta receptor profiles were determined using affinity labeling techniques, immunoprecipitation (IP), IP-Western blot, and 2-D gel electrophoresis. Effects of TGF-beta receptor overexpression were determined using transient transfections, analysis of gene transcription activity, 3H-Thymidine incorporation, and Smad 2 phosphorylation.

Table 1. Cytokine Production in Wild-Type Mice Compared with CD40ⴚ/ⴚ Knockout Mice

RESULTS: We identified novel hetero-oligomeric TGF-beta receptor complexes on human chondrocytes involving the signaling receptors in combination with novel TGF-beta receptors (endoglin, betaglycan, Alk-1, Sol RI, and RIIB). Overexpression of individual receptors modulated TGF-beta signaling and receptor expression corresponded to cell differentiation. More importantly, variable phenotypic expression correlated with cell TGF-beta responsiveness and type II collagen production.

Data expressed as mean ⫾ standard deviation. *Significantly different compared with WT into WT. IFN, interferon gamma; IL, interleukin; KO, CD40⫺/⫺ knockout mice; WT, wild type.

CONCLUSIONS: TGF-beta administration has been linked to enhanced ECM production, cell proliferation, and cartilage healing whereas dysregulation of the TGF-beta signaling cascade results in degenerative joint disease in animals. We identified novel TGF-beta receptors and hetero-oligomeric complexes on human chondrocytes. These complexes are likely fluid in nature. Modulation of individual components alters TGF-beta action, cell phenotype, and may be critical for achieving the delicate regulation of TGF-beta signaling towards cartilage regeneration and repair.

The CD40/CD40L co-stimulatory pathway in nerve allograft rejection Anil K Mungara MD, Paul Cederna MD University of Michigan Health System, Ann Arbor, MI INTRODUCTION: The CD40/CD40L co-stimulatory pathway is an important mediator of rejection in tissue transplantation. However, the requirement of donor versus recipient CD40 has not been characterized. We utilized CD40-/- knockout (K0) mice as both donors and recipients to establish the requirement of CD40 in nerve allograft rejection. METHODS: Sciatic nerve grafts were transplanted from CD40-/KO BALB/c mice into a subcutaneous pocket on the back of either CD40-/- KO or wild type (WT) C57BL/6 recipient mice. WT BALB/c sciatic nerves were transplanted into WT C57BL6 mice as control. Following a 14 day recovery, recipient mice were sacrificed and their spleens and brachial lymph nodes were harvested. Splenocytes and nodal cells were stimulated with donor alloantigens and resultant production of interferon gamma (INF- gamma), and interleukins (IL)-5, -4, and –2 were quantified using the ELISPOT technique. RESULTS: WT recipient splenocyte cytokine production was similar regardless of whether CD40-/-KO or WT donors were used. However, when CD40-/-KO recipients were given CD40-/-KO nerve, splenocyte cytokine production was significantly lower.

Recipient splenocyte cytokine production Cytokine

WT into WT

KO into WT

KO into KO

IFN-␥ IL-5 IL-4 IL-2

219 ⫾ 164 23 ⫾ 17 38 ⫾ 25 93 ⫾ 78

190 ⫾ 290 15 ⫾ 5 41 ⫾ 77 53 ⫾ 78

3 ⫾ 1* 6 ⫾ 3* 15 ⫾ 15* 28 ⫾ 7*

CONCLUSIONS: These data demonstrate that CD40-/- nerve allografts are better tolerated in CD40-/- recipients than WT mice. This suggests that CD40 expression in recipients plays a significant role in nerve allograft rejection. Ongoing studies using WT donors and CD40-/- recipients may further elucidate the importance of recipient CD40 status.

Microvascular tissue engineering using recellularized arterial grafts Gregory H Borschel MD, Yen-Chih Huang BS, Douglas Dow PhD, Jenny Lynch MD, William Kuzon MD, PhD, Robert Dennis PhD, David Brown MD University of Michigan, Ann Arbor, MI INTRODUCTION: Tissue engineered small diameter vascular grafts would be of value to patients undergoing free tissue transfer, coronary artery bypass, or lower extremity vascular reconstruction in cases of limited donor vessel availability. We hypothesized that small recellularized arterial grafts would demonstrate short term patency and would have histologic characteristics similar to native vessels. METHODS: Aortic and femoral arterial grafts were harvested from F344 rats. The grafts were made acellular with a series of detergent solutions (previously shown to produce immunologically inert residual tissue). The grafts were incubated with a primary culture of endothelial cells for 24 hours. Recellularized constructs were microsurgically placed as interposition grafts in the common femoral artery. A control group consisting of non-recellularized grafts was also tested. No systemic anticoagulants were administered. Vessel patency was monitored at 48 hour intervals using Doppler ultrasound. Grafts were explanted at six weeks and three months for definitive patency evaluation and histomorphometric examination. RESULTS: Five of six recellularized grafts remained patent at six weeks. Three of five plain acellular grafts became thrombosed at six weeks. One group of recellularized vessels remained patent at three months. Immunohistochemical staining for von Willebrand factor demonstrated an organized endothelial neointimal layer. Staining for alpha smooth muscle actin demonstrated that smooth muscle cells had migrated into the constructs. CONCLUSIONS: Six week and three month patency was achieved in engineered vascular grafts. The grafts recapitulated aspects of normal vascular histology.

Vol. 197, No. 3S, September 2003

The effect of high dose radiation on distraction osteogenesis (DO) in the rat mandible Steven R Buchman MD, Alexander Ayzengart BS, Christi M Cavaliere MD University of Michigan, Ann Arbor, MI INTRODUCTION: Mandibular Reconstruction for oncologic patients undergoing adjuvant high dose radiation (HDR) presents a challenging restorative dilemma with limited treatment options. Although a small number of anecdotal clinical cases have been reported, the potential role of DO following HDR remains unknown. This study was performed to investigate mandibular DO in the setting of fractionated external beam HDR. METHODS: Male Sprague-Dawley rats (N⫽10) underwent preoperative mandibular irradiation in doses of 48 Gray (fractionated 4 Gy/d x 12d). Following two weeks recovery, a mandibular distractor was placed and DO performed 0.3 mm bid, up to 5.1 mm. Controls underwent DO without irradiation. RESULTS: Radiographic evaluation demonstrated a high incidence of nonunion and incomplete bridging of the distraction gap in irradiated animals. Densitometry on standardized radiographs confirmed this result with dramatically compromised bone formation. Gross inspection revealed large and consistent bony defects within the regenerate. Histologic analysis identified and confirmed essential disparities in bone formation when compared to controls. CONCLUSIONS: Although bone formation does occur during DO after HDR, our results demonstrate osteopenia, incomplete bridging of the distraction gap, gross bony defects and nonunion. Physical lengthening of the mandible was achieved; however, there was a consistent detrimental effect of HDR on the normal process of DO. Despite reports that suggest DO is a viable reconstructive option following HDR we found significant associated morbidity and the surgeon should proceed cautiously. Further study should help optimize DO as a tool for reconstruction in patients treated with HDR.

Endostatin impairs cutaneous neovascularization and myocutaneous flap survival in mice Michael Dobryansky MD, Curtis L Cetrulo MD, Robert D Galiano MD, Kirit A Bhatt MD, Russell L Ashinoff MD, Joseph Michaels MD, Daniel J Ceradini MD, Jamie P Levine MD, Geoffrey C Gurtner MD New York University, New York, NY

Plastic Surgery

S61

or saline control (group II, n⫽10). Flaps’ cranial attachments were divided on POD 9. pO2 was measured using a microprobe. The vasculature of the flap was stained with FITC-labeled lectin and CD31. RESULTS: Group I animals exhibited decreased flap survival compared group II. Lower vessel densities were observed in group I: 97⫾11 vessels/hpf vs 122⫾18 vessels/hpf in group II (p⫽0.013). Clinical flap survival was 100% in control group, 20% (p⬍0.05) in group I. pO2 was 7.006⫾0.277 in group I vs 18.059⫾5.486 in group II (p⫽0.004). CONCLUSIONS: We describe an easily reproducible model of a two-dimensional in vivo assay of functional neovascularization. Endostatin impairs myocutaneous flap survival. This finding has significant implications for patients with cancer undergoing antiangiogenic therapy and requiring reconstructive plastic surgery.

Skin graft vascularization: regulated regression and replacement of endothelial cells Jennifer M Capla BA, Oren Tepper BA, Kirit Bhatt MD, Robert Galiano MD, Daniel Ceradini MD, Joseph Michaels MD, Michael Dobryansky MD, Russell Ashinoff MD, Jamie Levine MD, Geoffrey Gurtner MD New York University Medical Center, New York, NY INTRODUCTION: Long-term survival of skin grafts is dependent upon revascularization. Skin graft revascularization is examined using transgenic models to determine whether this occurs by simple anastamosis, vascular ingrowth or recruitment of bone marrow (BM)-derived endothelial progenitor cells (EPCs). METHODS: 1x1 cm full-thickness skin grafts were transferred between wild type FVB/N (n⫽5) and transgenic mice (n⫽5) where lacZ, controlled by an endothelial-specific promoter (tie2), delineated host from graft endothelial cells (ECs). To differentiate circulating EPCs, lethally irradiated FVB/N mice were reconstituted with BM from tie2/lacZ mice (BMT; n⫽5). Grafts were harvested on days 3, 7, 14 and 21, paraffin embedded and stained with X-gal or von Willebrand factor to identify LacZ(⫹) cells or ECs, respectively.

INTRODUCTION: The impact of inhibitors of tumor angiogenesis (endostatin, angiostatin) on the neovascularization required for the healing of transferred tissue has not been examined. We investigated the effect of endostatin on the functional neovascularization of myocutaneuos flaps.

RESULTS: Vascular ingrowth from tie2/lacZ mice into FVB/N grafts began at day (d) 3 and increased to d21 (2⫾0.6/hpf d3, 5⫾2.2/hpf d7, 9⫾1.4/hpf d14, 10⫾1.8/hpf d21). Vascular regression from periphery of the tie2/lacZ graft on the FVB/N mouse appeared from d3 continuing to d21. No vessels from the graft were found growing into the bed and no vascular regression was noted in the central portion of the grafts. In BMT mice, pattern of vascular ingrowth was similar, however, not until d7 were EPC-derived blood vessels noted (0⫾0/hpf d3, 2⫾1.1/hpf d7, 4⫾1.2/hpf d14, 4⫾2.1/ hpf d21).

METHODS: 1.25x2.5 cm dorsal cutaneous flaps were raised in C57BL6 mice in both treatment and control groups. A silicone sheet was placed in the wound bed to prevent neovascularization. Previous work had shown that 100% flap survival is achieved when the remaining attachment of the flap is divided on POD 9. Mice were treated with Endostatin 3 days prior to flap creation (group I, n⫽10),

CONCLUSIONS: Vascular replacement appears to be critical to skin graft revascularization with involution of graft vessels coincident with ingrowth of vessels from the graft bed. Furthermore, BMderived EPCs play an important role in the process of skin graft revascularization and may be driven by the ischemia within the avascular skin graft.

S62

Plastic Surgery

Comparisons of rat femoral artery anastomosesusing either the da Vinci™ surgical robotic system or standard microscopic techniques Curtis E Bower MD, Clifton C Reade MD, William M Meadows MD, Richard S Zeri MD, FACS, William A Wooden MD, FACS, You Su Sun MD, L Wiley Nifong MD, W Randolph Chitwood Jr MD, FASC The Brody School of Medicine at East Carolina University, Greenville, NC INTRODUCTION: Microscopic vascular anastomoses are challenging technically. Robotic instrumentation may be more precise than the human hand, allowing tremor filtration, and high magnification with 3-D visualization. Currently, arterial reconstructive procedures have not been performed using robotic systems. We compared microvascular anastomoses performed using standard microscopic technique with the da Vinci™ surgical system (Intuitive Surgical, Sunnyvale, CA). METHODS: Two cohorts of rats underwent femoral artery dissection followed by vascular control and transection of the vessel. Controls (CTRL) were repaired microscopically, and the experimental group (EXP) with da Vinci™. A flow-meter (Advance Laser Flowmeter) measured flow prior to transection, immediately after reanastomosis, and 24-hours post-operatively. Paired T-test determined significance. RESULTS: CTRL had 100% patent anastomoses immediately post-repair and at 24 hours. The mean blood flow velocity (BFV) was similar pre-repair and post-repair, however, was lower at 24 hours (85.0, 84.0 and 46.5 mL/min/100g, respectively). EXP had 100% immediate patency, and 24 hour patency rate was 25%. Furthermore, in EXP, BFV was similar pre-repair and post-repair, but lower at 24 hours (55.4, 50.8, and 30.0 mL/min/100 g, respectively). BFV did not change significantly pre-repair compared with immediate post-repair in either group. However, BFV did decrease significantly in CTRL and EXP groups pre-repair compared with 24 hours (p⫽0.001 and 0.01, respectively). CONCLUSIONS: This pilot study demonstrates the possibility of robotic microsurgery; however, significant limitations include lack of microscopic robotic instruments and sufficient magnification. Further advancements in instrument miniaturization and visual magnification may allow non-microscopic trained surgeons to perform microvascular operations endoscopically.

Increased circulating endothelial progenitor cells in children with hemangioma Mark E Kleinman BS, Oren Tepper BA, Jennifer Capla BA, Robert Galiano MD, Edward Chang BA, Daniel Ceradini MD, Jamie Levine MD, Geoffrey Gurtner MD NYU School of Medicine, New York, NY INTRODUCTION: Hemangiomas are the most common soft-tissue tumor of infancy. Despite the frequency of these vascular tumors, the

J Am Coll Surg

origin of hemangioma-endothelial cells is unknown. Circulating endothelial progenitor cells (EPCs) are recently identified vascular stem cells capable of contributing to postnatal vascular development. We set out to determine if circulating EPCs are increased in hemangioma patients and thus provide insight into the role of EPCs in hemangioma growth. METHODS: Peripheral blood mononuclear cells (MNCs) were isolated from hemangioma patients undergoing surgical resection (n⫽5) along with age-matched controls (n⫽5) undergoing unrelated surgical procedures. MNCs were stained with fluorescentlabeled antibodies for AC133 (stem cell marker), CD34 (hematopoietic marker), and KDR (VEGF-receptor 2). Fluorescent-labeled isotype antibodies served as negative controls. Dual stained cells were measured using a BD FacScan Cytometer at 20,000 events/sample. All data was analyzed using Cellquest software (version 3.3). Histologic sections of surgical specimens were stained for Glut-1, merosin, and CD32 to confirm the diagnosis of hemangioma. RESULTS: The average age of hemangioma patients was 2.1 years (vs. 3.2 in controls). Hemangioma patients contained a 15-fold increase in the number of circulating AC133-CD34 dual-positive cells relative to controls (0.780.14% vs.0.052 0.017%, respectively). Similarly, the number of MNCs staining positive for both CD34 and KDR was also increased in hemangioma patients (0.490.074% vs. 0.190.041% in controls). CONCLUSIONS: This is the first study suggesting a role for EPCs in the pathogenesis of hemangioma. Our results show that increased levels of circulating EPCs may contribute to the formation of this vascular tumor.

Minimally invasive video-assisted thyroidectomy: 4 years’ experience. Paolo Miccoli MD, Piero Berti MD, Gabriele Materazzi MD, Leonardo Barellini MD University of Pisa, Italy, Pisa, Italy INTRODUCTION: Minimally invasive video-assisted thyroidectomy (MIVAT) is an operation quite widely performed and set up in our Department since 1998. Indications and advantages are discussed on the basis of our large experience. METHODS: From June 1998 to January 2003, 484 patients were selected to undergo MIVAT according to the following criteria: nodule size ⬍30 mm; thyroid volume ⬍20 mL; absence of both thyroiditis and irradiation’s history; no previous neck surgery. Preoperative diagnosis was: 148 follicular tumors, 129 papillary carcinomas, 16 toxic adenomas, 42 Hurtle cell tumors, 116 multinodular goiters, 14 Graves’ diseases, 5 toxic goiters, 13 completion thyroidectomies, 1 positive RET gene. The procedure, totally gasless, was carried out through a 15-mm central incision above the sternal notch. Dissection was performed using endoscopic instruments, haemostasis was achieved by means of a Harmonic Scalpel (Ultracision (r)).

Vol. 197, No. 3S, September 2003

RESULTS: 244 lobectomies and 240 total thyroidectomies were performed. Mean operative was 52.7⫾20.2 minutes (30–140) for total thyroidectomy and 41.02⫾19.2 minutes (15–120) for lobectomy. Convertion to open procedure was required in 8 cases (2 completion thryoidectomy, 1 intraoperative bleeding, 2 esophageal infiltration, 3 difficult dissection). Complications were: 4 transient, 2

Plastic Surgery

S63

definitive recurrent nerve palsies, 1 post-operative bleeding, 1 definitive and 4 transient hypoparathyroidisms. CONCLUSIONS: Both operative time and complication rate are comparable with traditional surgery; the cosmetic outcome and postoperative distress have been proved to be much better with MIVAT.